ID: 1165388706

View in Genome Browser
Species Human (GRCh38)
Location 19:35526561-35526583
Sequence CCGCCCCGCCAAATGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165388698_1165388706 2 Left 1165388698 19:35526536-35526558 CCAAACAAAGGCTACGCGGACCC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1165388706 19:35526561-35526583 CCGCCCCGCCAAATGTCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 48
1165388695_1165388706 16 Left 1165388695 19:35526522-35526544 CCAAGCTTCTTTCACCAAACAAA 0: 1
1: 0
2: 3
3: 40
4: 726
Right 1165388706 19:35526561-35526583 CCGCCCCGCCAAATGTCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 48
1165388694_1165388706 17 Left 1165388694 19:35526521-35526543 CCCAAGCTTCTTTCACCAAACAA 0: 1
1: 0
2: 2
3: 14
4: 263
Right 1165388706 19:35526561-35526583 CCGCCCCGCCAAATGTCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165388706 Original CRISPR CCGCCCCGCCAAATGTCCCA GGG Intronic
900928692 1:5722047-5722069 CAGCCCCTGCAAAAGTCCCATGG - Intergenic
904812940 1:33175581-33175603 CCAACACGCCAACTGTCCCAGGG - Intronic
905999960 1:42416072-42416094 CCCCCCCGCAAAATGTGCAATGG - Exonic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
1064322812 10:14321530-14321552 CTGCCCAGCCTCATGTCCCAGGG - Intronic
1083818758 11:65153755-65153777 CCTCCCCTCCACATGTCACAAGG - Intergenic
1084191824 11:67502849-67502871 CCGCCCCACCAAAGCTCCCTGGG + Intronic
1091793292 12:3283529-3283551 CCGCCCCGCCAGGTGCCCCATGG - Exonic
1101343970 12:103867680-103867702 CAGCCCTGCCAAATGTTCCCTGG + Intergenic
1114736246 14:25046980-25047002 ACCCCACGACAAATGTCCCATGG - Intronic
1122697512 14:103563136-103563158 CCTCCCGGCCCAATGTCCCCAGG - Intronic
1136114141 16:28083980-28084002 CCGCCTCCCCTAATGTCCCATGG - Intergenic
1137394276 16:48105897-48105919 CCTCCCCACCAAAGATCCCAGGG - Intronic
1141635377 16:85311489-85311511 CCTCCCTCCCCAATGTCCCACGG - Intergenic
1154088576 18:11333993-11334015 CTGCCTCGGCAAATGTCCCATGG + Intergenic
1154344478 18:13530843-13530865 CAGCCCCCGCAGATGTCCCAGGG + Intronic
1155107202 18:22679215-22679237 CCGACAAGCCAAATATCCCAGGG + Intergenic
1157517705 18:48322370-48322392 CCTCACCACCAAATGTCCCCTGG + Intronic
1160859246 19:1230754-1230776 CCGCCCCGCCCATGCTCCCAAGG - Exonic
1162029632 19:7911788-7911810 CCACCCCGCCAAATGCCACAGGG - Intronic
1162781880 19:13010887-13010909 CCGCCTCCCCATATGTCCCTGGG + Intronic
1165388706 19:35526561-35526583 CCGCCCCGCCAAATGTCCCAGGG + Intronic
1167780591 19:51596307-51596329 CTGGCCCTCCAAATGCCCCACGG - Intergenic
1168101948 19:54146022-54146044 CAGCCCAGCCAACTGTACCACGG + Exonic
1168577771 19:57527555-57527577 CCGCCCCGCCTAAAGTCCCATGG + Exonic
926607518 2:14912509-14912531 CTGCCATGCCAAATGACCCAGGG + Intergenic
947239613 2:227979598-227979620 CAGCCTTGCCAAATGTCCCCTGG - Intergenic
948378729 2:237538977-237538999 CAGCCCCTCCTAAGGTCCCAAGG + Intronic
948612902 2:239180937-239180959 CCTCCCCGTCCACTGTCCCATGG + Intronic
1169224304 20:3846789-3846811 CCGCCCCTCCACATGGCCAATGG + Intronic
1172612424 20:36261868-36261890 CCACCTCCCCAAATGTACCATGG - Intronic
1173594021 20:44247445-44247467 CAGCCCCGCCCATTGGCCCAGGG + Exonic
1175904490 20:62372695-62372717 ACCCCCAGCCAGATGTCCCAAGG - Intergenic
1176247393 20:64103988-64104010 CCGCCCCACGAGGTGTCCCAGGG - Intergenic
1185047877 22:48537941-48537963 TCCCCACGCCAAATGGCCCACGG - Intronic
956780474 3:72599389-72599411 GCGCCCCGGCCAAGGTCCCAGGG - Intergenic
956964887 3:74447425-74447447 CCACTCTGCCATATGTCCCAGGG - Intronic
964627936 3:158776848-158776870 CCAGCCCGCCAAATATCTCAAGG - Intronic
965698633 3:171436920-171436942 CAGCCTCGCCAAATGATCCAAGG - Intronic
975317424 4:72970556-72970578 CCGCCTCTCCAAATATCTCATGG - Intergenic
976612806 4:87047276-87047298 TTGCCCAGCCAAATCTCCCAAGG + Exonic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991360245 5:65812273-65812295 TCCCCCTGCCAAATGTCCAAAGG - Exonic
997301164 5:132806697-132806719 CTGACCCCCCAAATGTCCCAGGG + Intronic
997613845 5:135232977-135232999 CCGCCCTGCCAAGGGCCCCAAGG - Intronic
999658051 5:153829919-153829941 CCTACCAGCCAAATGCCCCATGG - Intergenic
1001014356 5:168127069-168127091 CTGCCCCTCCAAATCTCCCAGGG + Intronic
1001461472 5:171918856-171918878 CCAGATCGCCAAATGTCCCAGGG + Intronic
1002580893 5:180208990-180209012 CCGCACCGCCAGGTGTCCCTCGG + Intronic
1003405800 6:5826275-5826297 CATCCCCGCCAAATGTGCAAGGG - Intergenic
1018960162 6:168441878-168441900 CCGCCCCGCGGACTGTCCCAAGG + Intronic
1019336037 7:483297-483319 CCCGCCCGCCCAATATCCCACGG - Intergenic
1035326050 7:158066829-158066851 CAGCCACCCCATATGTCCCAGGG - Intronic
1055407193 9:75987404-75987426 CCGCCCCCCCACAAGTCCAATGG - Intronic
1060522565 9:124301974-124301996 CAGCCCGGCCACATGCCCCATGG + Exonic
1061517583 9:131098468-131098490 CCGCCTGGCCAAGTGACCCAGGG - Intronic
1062228780 9:135469415-135469437 CTGCCCGGCCATATGACCCAGGG + Intergenic