ID: 1165391715

View in Genome Browser
Species Human (GRCh38)
Location 19:35542864-35542886
Sequence GCATACCCCAAGAGGGGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165391704_1165391715 29 Left 1165391704 19:35542812-35542834 CCACAGATCCCTCTCACCCTCAT 0: 1
1: 0
2: 4
3: 38
4: 393
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165391705_1165391715 21 Left 1165391705 19:35542820-35542842 CCCTCTCACCCTCATCCTGACGT 0: 1
1: 0
2: 3
3: 14
4: 205
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165391703_1165391715 30 Left 1165391703 19:35542811-35542833 CCCACAGATCCCTCTCACCCTCA 0: 1
1: 0
2: 0
3: 36
4: 316
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165391706_1165391715 20 Left 1165391706 19:35542821-35542843 CCTCTCACCCTCATCCTGACGTT 0: 1
1: 0
2: 2
3: 14
4: 193
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165391707_1165391715 13 Left 1165391707 19:35542828-35542850 CCCTCATCCTGACGTTTCATAAA 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165391708_1165391715 12 Left 1165391708 19:35542829-35542851 CCTCATCCTGACGTTTCATAAAA 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165391709_1165391715 6 Left 1165391709 19:35542835-35542857 CCTGACGTTTCATAAAACCAAGT 0: 1
1: 0
2: 1
3: 1
4: 100
Right 1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165391715 Original CRISPR GCATACCCCAAGAGGGGTAA GGG Intronic
900097667 1:946640-946662 GGATACCCCAGGAGGGGACATGG + Intronic
903017707 1:20372034-20372056 GCAGTCCCCAAGAGGAGAAAAGG - Intergenic
903768165 1:25748013-25748035 TCCAACCCAAAGAGGGGTAATGG - Intronic
907800384 1:57759205-57759227 GCATGGCCCAATAGTGGTAAAGG + Intronic
918140219 1:181713753-181713775 GCATGCCCTATGAGGAGTAACGG - Intronic
919753679 1:201053622-201053644 GCAGAACCTCAGAGGGGTAAGGG + Intronic
920686527 1:208113226-208113248 CCCTACCCCAGGAGGGGGAAAGG + Intronic
921669002 1:217906072-217906094 GCATAGCCCCAGAGGGTGAAGGG - Intergenic
922464664 1:225838866-225838888 GCATCCTCCAAGAAGGGTACGGG + Exonic
923740077 1:236646862-236646884 GCATAGCCAAGGAGGGGTATAGG + Intergenic
924706545 1:246507168-246507190 GCAACCGCCAAGAGGGGAAACGG - Exonic
1084721551 11:70908930-70908952 TTCTACCCTAAGAGGGGTAAGGG - Intronic
1088176619 11:107059834-107059856 GGAGACCCCAAAAGGGGGAAGGG + Intergenic
1090201575 11:124861508-124861530 GCATACCCTAGTGGGGGTAAGGG + Intergenic
1090553668 11:127850718-127850740 GCATCTCCCAAGAGGAGCAAGGG + Intergenic
1104808515 12:131605107-131605129 CCAGACCCCAAGAGGGTTATTGG + Intergenic
1104934997 12:132359828-132359850 GCAAACCCCAAGGGGGGAGAGGG - Intergenic
1112296827 13:98195259-98195281 GCATACCACAAAAGGGAAAAAGG - Intronic
1112319216 13:98391838-98391860 GCAGAACCCAAGGAGGGTAAAGG + Intronic
1119770068 14:77215000-77215022 GCATAACACAAGAGGGTTGAGGG - Intronic
1129449985 15:75646095-75646117 GGAACCCCCAAGAGGGGAAAGGG - Intronic
1130313076 15:82771634-82771656 GCAGACCCCATGAGGGGTGAGGG - Intronic
1131242142 15:90755561-90755583 GCAGACACCAAGAGTGGGAAGGG - Intronic
1136021621 16:27444237-27444259 GCATATCTCAGGAGTGGTAATGG - Intronic
1138789641 16:59888137-59888159 ACATACCCAAAGAGGGGTGCAGG + Intergenic
1141008090 16:80371952-80371974 GCATTCCCCAAGATGGTCAAAGG - Intergenic
1142599213 17:1045076-1045098 GTATACCTCAAGAAGGGAAAAGG + Intronic
1143301738 17:5915605-5915627 GCATTTCCCAGGAGGGGTGATGG + Intronic
1145320428 17:21764240-21764262 GCTTCCCCCAGGAGGGGTTAGGG - Intergenic
1147727521 17:42575701-42575723 GCATGCCTCAAAAGAGGTAAGGG + Intronic
1149964947 17:61152824-61152846 GCTTACCCCAACTGGGGCAAAGG + Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1165370509 19:35402695-35402717 GCATGCACCAACAGGGGAAATGG - Intergenic
1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG + Intronic
1166647549 19:44543370-44543392 TCTTGCCCCAAGAGAGGTAATGG - Intergenic
935090371 2:99890143-99890165 GCATACGCCTGGAGTGGTAATGG + Intronic
936260039 2:110950937-110950959 GCAGACACCAAGAGGTGCAAAGG - Intronic
943753587 2:191535546-191535568 GCATAACCCAACTGGGCTAAGGG + Intergenic
946405820 2:219491605-219491627 GCATACCCCAAGAGACATATGGG - Intronic
1174759653 20:53194571-53194593 ACATACCCCTAAAGGGTTAAGGG - Intronic
1177508385 21:22049330-22049352 CTATACCCCAAGCTGGGTAAAGG + Intergenic
1182825173 22:33258773-33258795 CCAGACCCCAAGAGAGGTAAAGG - Intronic
1183780006 22:39993524-39993546 CCAGTTCCCAAGAGGGGTAAAGG + Intergenic
954429379 3:50461870-50461892 TCCAACCCCAAGAGGGGGAAAGG + Intronic
968430568 4:556003-556025 GCAGACCCCAAGAGGGAAGAAGG - Intergenic
981933545 4:150215435-150215457 TCAAACCCAAAGAGGGGTCATGG - Intronic
1001087409 5:168710847-168710869 GCAGACCCCAAGAGGGGCAGGGG + Intronic
1002208077 5:177577995-177578017 GCATATCCTAAGAGGAGTGATGG - Intergenic
1002452348 5:179326073-179326095 GCAGGCCCCAAGAAGGGAAATGG - Intronic
1004027731 6:11835546-11835568 ACAGACCCCAAGAGTGGCAAGGG + Intergenic
1008365717 6:50677278-50677300 GCTTAGCCCAAGAGAGCTAATGG - Intergenic
1020862769 7:13515671-13515693 AGAAACCCCAAGAGGGGTCATGG - Intergenic
1029788249 7:102815434-102815456 GCAGAAGCCAAGAGGGTTAAAGG - Intronic
1032915622 7:136485989-136486011 CCATACAGCAACAGGGGTAAGGG - Intergenic
1034732096 7:153396807-153396829 GCCTACCCCAAAAGAAGTAACGG + Intergenic
1036789883 8:11710250-11710272 GGCTCCCCCAAGAGGGGTGAGGG - Intronic
1038699560 8:29837029-29837051 GCAGACCCCAAGTAGGGTGAAGG + Intergenic
1044024754 8:87154980-87155002 GCACACTCCAAGAGGAGGAATGG - Intronic
1045656510 8:104392471-104392493 GCAGACACCAAGATGGATAAAGG - Intronic
1049408213 8:142460981-142461003 TCATACCCTAAGAGGGTTCAAGG + Intronic
1055422838 9:76162068-76162090 GGAGACCCCAAGAGATGTAAAGG + Intronic
1060641415 9:125241895-125241917 GCATACCCCAATACCGGTAGTGG - Intergenic
1060868731 9:127022166-127022188 ACAAACCACAAGAGGGGGAAAGG - Intronic
1189357835 X:40324930-40324952 GTCTACCACAAGAGGGATAAGGG - Intergenic
1194054078 X:89109718-89109740 GCATGCCCTACGAGGGGGAAGGG - Intergenic
1195646348 X:107235103-107235125 GCTTCCCTCAAGAGAGGTAAAGG - Intronic
1196150763 X:112370800-112370822 CTATACCCCAAGAGGAGTGAAGG - Intergenic