ID: 1165393515

View in Genome Browser
Species Human (GRCh38)
Location 19:35551437-35551459
Sequence AAGGCTTCTTCAGGTGTCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165393515_1165393524 30 Left 1165393515 19:35551437-35551459 CCAGGGACACCTGAAGAAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1165393524 19:35551490-35551512 GGATGAGGACATCGGCGATCTGG 0: 1
1: 0
2: 0
3: 1
4: 54
1165393515_1165393520 -3 Left 1165393515 19:35551437-35551459 CCAGGGACACCTGAAGAAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1165393520 19:35551457-35551479 CTTGCTGGAAGGCAGAGAGACGG 0: 1
1: 0
2: 6
3: 53
4: 525
1165393515_1165393522 15 Left 1165393515 19:35551437-35551459 CCAGGGACACCTGAAGAAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1165393522 19:35551475-35551497 GACGGCGCGTCTTGCGGATGAGG 0: 1
1: 0
2: 0
3: 1
4: 27
1165393515_1165393521 9 Left 1165393515 19:35551437-35551459 CCAGGGACACCTGAAGAAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1165393521 19:35551469-35551491 CAGAGAGACGGCGCGTCTTGCGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165393515_1165393523 22 Left 1165393515 19:35551437-35551459 CCAGGGACACCTGAAGAAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1165393523 19:35551482-35551504 CGTCTTGCGGATGAGGACATCGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165393515 Original CRISPR AAGGCTTCTTCAGGTGTCCC TGG (reversed) Exonic
900101058 1:962283-962305 TAGGCATCTTCAGGGCTCCCTGG + Intronic
903977738 1:27162207-27162229 AAGCCTTCTTCCAGTCTCCCCGG + Intronic
904699184 1:32348172-32348194 AAGTCTTCTGGAGGGGTCCCTGG - Intergenic
905597894 1:39224280-39224302 ATAGCTTCTTCAGATGTCCAAGG - Intronic
906155389 1:43611138-43611160 GAGGCTTCTTCAGGTGGCCTGGG + Intronic
907309097 1:53529239-53529261 CAGGCTCCTGCAGGTGACCCAGG - Intronic
908522216 1:64955370-64955392 AAGGCCCCTTCAAATGTCCCTGG - Intronic
915244485 1:154546666-154546688 GGAGCTTCTTCAGGTGACCCAGG + Intronic
917116519 1:171609001-171609023 TAATCTTCTTCAGGTTTCCCAGG - Intergenic
918322805 1:183381015-183381037 AAGTCTTCTTCAGTGGTCCAGGG + Intronic
919871687 1:201826825-201826847 AAGGCCTCTTCAGCTGGCTCTGG - Exonic
920502054 1:206491672-206491694 AAGACTCCTGCAGGTGTTCCAGG + Exonic
923050904 1:230390681-230390703 TGGGCTTCTTGAGATGTCCCAGG - Intronic
924002790 1:239572244-239572266 AAGGATTCTTCAGCAGTCACTGG - Intronic
1066385698 10:34939558-34939580 AAGGTTTCTTCCTATGTCCCTGG - Intergenic
1067237090 10:44460167-44460189 ACTGGTTCGTCAGGTGTCCCAGG - Intergenic
1068939265 10:62664764-62664786 AAGGTTTCGTTAGGTTTCCCTGG - Intronic
1070681366 10:78451566-78451588 CAGGCTTCATCAGGTCTCCAGGG + Intergenic
1071108416 10:82125847-82125869 AAGGCACCGTCAGGTCTCCCTGG + Intronic
1071948888 10:90680226-90680248 AAGACTATTTCAGTTGTCCCAGG + Intergenic
1074477025 10:113782698-113782720 AAAGCTTCCTGAGGTCTCCCCGG + Intronic
1074771176 10:116735419-116735441 AAGGCCTCTTGAGGCGTTCCTGG - Intronic
1076049934 10:127324269-127324291 AAGGCCACTTCATGTTTCCCAGG - Intronic
1076265411 10:129105879-129105901 AAGTCATCTTCAGATGCCCCTGG - Intergenic
1076607477 10:131698458-131698480 CACCCTTCTTCAGGTGTGCCTGG + Intergenic
1076755701 10:132570492-132570514 AAGGCTTCTCTAGCTGTCACTGG + Intronic
1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG + Intergenic
1081872894 11:46391397-46391419 GAGGCTTCTCCAGGTGCGCCCGG - Intergenic
1083212727 11:61198754-61198776 ATGGCTTCTCCAAGTGCCCCTGG + Intergenic
1083921625 11:65784157-65784179 AAGGCTTGTTCAGGGGACGCGGG + Intergenic
1085307987 11:75499106-75499128 AGGTCTGCTTCAGGTGTCTCAGG + Intronic
1085417367 11:76328286-76328308 GAGGCTGCTTCAGGGGACCCAGG + Intergenic
1089257010 11:117199410-117199432 AAGGCTTCCTCAGGGCTCGCAGG - Intronic
1089770275 11:120797449-120797471 CATGCTTCTTCAGTAGTCCCAGG - Intronic
1091779973 12:3207663-3207685 AGGGCTTCTCCAGTTCTCCCGGG - Intronic
1091908447 12:4208743-4208765 GAGGCCTCTTGAGGTGTCTCTGG + Intergenic
1092118093 12:6023793-6023815 AAGGCAGCCTCAGGTGGCCCAGG + Intronic
1093753950 12:22831578-22831600 AAGGTTTCTTCATGTTGCCCAGG + Intergenic
1094150766 12:27280542-27280564 GAGGCTACTTCAGGCGTCCTGGG + Intronic
1096021786 12:48331433-48331455 AAAGCTTGGTCAGGTGTACCTGG - Intergenic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1098306129 12:69104553-69104575 GAGGATTCTTTAAGTGTCCCTGG - Intergenic
1099247514 12:80211888-80211910 AAGGCTTGTTCAGGTTGCCTAGG + Intronic
1102748154 12:115268158-115268180 AAGGCATCTTCAAGAGTCCCTGG - Intergenic
1102976772 12:117212425-117212447 AGGGCTTCTTTTGGTTTCCCTGG - Exonic
1103226438 12:119291858-119291880 AAGCCCTCTTCAGCTATCCCTGG - Intergenic
1103949413 12:124542926-124542948 CAGGCTGCCTCAGCTGTCCCTGG - Intronic
1104531461 12:129575077-129575099 AAAGCATCTTCATGTGTTCCAGG - Intronic
1105366976 13:19774260-19774282 AAAGCCTCTTCAGTTGTCCTTGG - Intronic
1105423127 13:20270695-20270717 AATGCATCTTCAGGTTTTCCTGG - Intergenic
1105708150 13:22981585-22981607 AAGGCTTCTTCAGGGCTGTCAGG + Intergenic
1106344879 13:28866377-28866399 AATGCTTATACAGGTGTCCACGG + Intronic
1107113507 13:36722911-36722933 AAGGTTTCTTTAGGTTTCCTTGG + Intergenic
1108847734 13:54696709-54696731 ATGGCTTCTTCATGTTGCCCAGG + Intergenic
1109208373 13:59506488-59506510 AGGGCTGCTTCAGTTGTGCCAGG - Intergenic
1113628335 13:111863077-111863099 GAGGCGTCCTCAGGTGTCTCAGG - Intergenic
1113865524 13:113519969-113519991 AAGGCTTCTCCATGTGTTTCTGG + Intronic
1113881005 13:113626182-113626204 CAGGCATCCTCAGGTGTCCCTGG + Intronic
1115414588 14:33116747-33116769 TAAGCTTCTCCAGGTGACCCAGG - Intronic
1116174945 14:41456592-41456614 AAAGCTTCTTGAGTTCTCCCTGG + Intergenic
1116948818 14:50859872-50859894 ACGGCCTCTTCAGGTGGACCAGG + Intronic
1118715520 14:68556938-68556960 ATGGCATCCTCAGGAGTCCCCGG + Intronic
1119333305 14:73811678-73811700 GAGGCTTTTTCAGTTGTCCAGGG - Intergenic
1119998735 14:79279724-79279746 AAGAGTTCTTCGGGTGTTCCTGG - Intronic
1121712082 14:96046000-96046022 AGGGCTTCTTCAGGTGACTTGGG + Intronic
1124666295 15:31595766-31595788 CAGCCTCCTTCAGGTGTGCCAGG + Intronic
1126534961 15:49751378-49751400 AAGGCTGCTTCATGGTTCCCTGG - Intergenic
1126859591 15:52871016-52871038 AAGGGGTGTGCAGGTGTCCCAGG + Intergenic
1127654991 15:61047256-61047278 AGGGCTTCTGCAGGGGGCCCAGG - Intronic
1127871533 15:63078009-63078031 AAGGCTCCTTCAGACCTCCCTGG - Intergenic
1128183059 15:65621827-65621849 CAGGCTTGGTCAGGTGTACCGGG + Intronic
1129079205 15:73024377-73024399 AAGGGTGCTTCAGGTGTGGCGGG - Intergenic
1129543078 15:76367115-76367137 AAGGCTTCTTCAGAGCACCCAGG + Intronic
1129683364 15:77670998-77671020 AAGGCTTTCTCAGGCTTCCCAGG + Intronic
1132389783 15:101429839-101429861 CAGGCTTCTCCAGGAGTCACAGG - Intronic
1133960692 16:10490461-10490483 AAGGCTTTTTCTGGTGTCTGGGG - Intergenic
1134562313 16:15221111-15221133 AAGGCTTCTTCAGGCATCCAGGG - Intergenic
1134630403 16:15752168-15752190 CAGGCTTCATCATGTGTCCTGGG + Intronic
1134922853 16:18132738-18132760 AAGGCTTCTTCAGGCATCCAGGG - Intergenic
1135109323 16:19678351-19678373 AAGGTGTCCCCAGGTGTCCCTGG - Intronic
1136119237 16:28119682-28119704 AAAATTTCTTCAGTTGTCCCAGG - Intronic
1136677323 16:31922543-31922565 AAGGCAGGTTCTGGTGTCCCTGG - Intergenic
1139661129 16:68421558-68421580 ATGGCTTCTTCAGGTGTACTGGG - Intronic
1141635901 16:85313597-85313619 AGGGCCTCTCCAGCTGTCCCAGG - Intergenic
1143896537 17:10141043-10141065 AAGGCTGCTTCTGGGGACCCAGG + Intronic
1147856605 17:43485130-43485152 AAGGCTTCTTCAGTTGTAACAGG + Intronic
1148834374 17:50458106-50458128 AAGGTTCCTTCTGATGTCCCTGG + Intronic
1149480907 17:57002386-57002408 AAGGTTTCTCCATGTGGCCCAGG - Intronic
1150099139 17:62406845-62406867 TAGGCTTCATCAGGTGTCTGAGG - Intronic
1150104564 17:62452799-62452821 AGGGTTTCATCATGTGTCCCAGG + Intergenic
1151416287 17:73967846-73967868 AAGTCTCCTTCATGGGTCCCGGG - Intergenic
1152121231 17:78419962-78419984 AGGGCTTCTTCAGGACCCCCTGG - Intronic
1157349734 18:46873766-46873788 AAGGATTTTTCTGGTGTCCTGGG - Intronic
1158604637 18:58884501-58884523 AAGGCTTATTCAGGTGACAAAGG + Intronic
1160720855 19:596374-596396 GAGGCTTCTTCCGGTCCCCCAGG + Intronic
1162996228 19:14337456-14337478 AAGGGTTCTTCAAGTGTTCTGGG - Intergenic
1163106512 19:15125808-15125830 AAGGCTCTTTCGGGTGGCCCCGG - Intergenic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
1165895195 19:39137068-39137090 GTGGCTGCTTCAGGTGTTCCTGG + Intronic
1166716372 19:44970740-44970762 TAAGCTTCTTCATGTGTCCGAGG - Intronic
1167747056 19:51358079-51358101 AAGGCTTCTGTGGATGTCCCTGG - Intronic
925474830 2:4201644-4201666 AATGCTTCTGAAGGTCTCCCAGG + Intergenic
926743240 2:16129374-16129396 AGGACTTCATCAGTTGTCCCTGG + Intergenic
927091930 2:19719009-19719031 AAGGCTTGTCCAGGAGTACCTGG + Intergenic
928609498 2:32977542-32977564 AAGGCTTGTATAGGTGTCCTTGG + Intronic
930007420 2:46909255-46909277 ACTGCTTCATCAGGTTTCCCAGG - Intronic
930784484 2:55257981-55258003 AAGGCTTCATCATGTTGCCCAGG + Intronic
936646632 2:114379317-114379339 AGGGCTTCTTTAAGTGTGCCTGG - Intergenic
938259378 2:129884347-129884369 AGGGCTTCACCAGGAGTCCCAGG - Intergenic
941373849 2:164703118-164703140 ATGGCTGCCTCAGGTGTCCCAGG + Exonic
941710381 2:168705593-168705615 AAGTCTTCTTCAGGTCAACCAGG - Intronic
941932178 2:170953162-170953184 AACGGTTCTTCAGGTTGCCCAGG - Intronic
943910617 2:193561737-193561759 AAGGCTTTCTCAGGTGACCAGGG - Intergenic
946141180 2:217692058-217692080 ATGGGCTCTGCAGGTGTCCCTGG + Intronic
946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG + Intergenic
946752170 2:222903331-222903353 AGGGCTTCGTCATGTTTCCCAGG + Intronic
947932786 2:233977457-233977479 CAGGCTTCTGCAAGTCTCCCGGG + Intronic
948607839 2:239147178-239147200 AAGGCCACTTCATGTGCCCCGGG - Intronic
948701451 2:239763135-239763157 AAAGCTTTCTCAGATGTCCCTGG + Intronic
1174008260 20:47427773-47427795 AAGGCTACTTCAGATTTACCTGG + Intergenic
1175386640 20:58600209-58600231 CATGCATCTCCAGGTGTCCCTGG + Intergenic
1178483929 21:33005153-33005175 AAACCTTCTTCAGTGGTCCCTGG + Intergenic
1180142668 21:45901563-45901585 AAGGCTACATCAGCTGTCACGGG - Intronic
1180569525 22:16702209-16702231 AAGGCAGCCTCAGGTGGCCCAGG + Intergenic
1180711481 22:17842353-17842375 AAGGCTGCTTCAGGGGCACCTGG - Intronic
1181525523 22:23483109-23483131 AAGGCTTCTTCAAGTCACCTAGG + Intergenic
1182390877 22:29994874-29994896 AAGGCTTCTGCAGGTTTCACAGG - Intronic
1182767913 22:32772062-32772084 ATGGCTTTTTCAGATGTCCTAGG - Intronic
1184414546 22:44344612-44344634 CAGACTGCTCCAGGTGTCCCGGG - Intergenic
950183181 3:10929142-10929164 AAGGCTGCTCCTGGTGGCCCAGG - Intronic
950447642 3:13047495-13047517 GAGGCTGCTTCCGGTGTCCAGGG + Intronic
950569993 3:13793807-13793829 GAGGCTTCTCCAGGTCCCCCAGG - Intergenic
950827733 3:15843110-15843132 AAAGCTTCTTGAGGCCTCCCTGG - Intronic
953052528 3:39358695-39358717 AAGGCTCCTTCAAGTATGCCTGG + Intergenic
955867682 3:63402295-63402317 CAGGCTTTGTCAGATGTCCCTGG + Intronic
957481302 3:80799479-80799501 AATGGTTATTCAGGTTTCCCAGG - Intergenic
960908252 3:122622983-122623005 AATGCTCCTGCAGGTATCCCAGG + Intronic
961612453 3:128152035-128152057 AAGGGCTCTCCAGGTCTCCCAGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963453650 3:145516532-145516554 AATGGTGCTTGAGGTGTCCCTGG + Intergenic
965733113 3:171792978-171793000 AAGTCTCCTTCAGGTATTCCTGG - Intronic
965776733 3:172239585-172239607 AAGGCTTCCCCAGATGGCCCAGG - Intronic
968054869 3:195683787-195683809 AGGGCTTCTTCTGTTGCCCCTGG - Intergenic
968101041 3:195965485-195965507 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
969117416 4:4879627-4879649 AAGGCTTCATCATGTTACCCAGG + Intergenic
971365131 4:25971186-25971208 AAGTCTCCTTCAGGTTCCCCTGG - Intergenic
974686416 4:65237118-65237140 CAGGCTTATTCAAGTGTCCCTGG - Intergenic
978499849 4:109397625-109397647 TAGGGTTCTTCAGGGGGCCCTGG + Intergenic
979467292 4:121055269-121055291 AAGGCTACTGCAGTTGTCCATGG + Intronic
985502041 5:254428-254450 AGGGCTTCTTCTGTTGCCCCTGG - Exonic
985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
985957576 5:3276494-3276516 AGACCATCTTCAGGTGTCCCAGG + Intergenic
990191412 5:53264130-53264152 CTGGCTTCTTCAGGATTCCCAGG + Intergenic
995889576 5:116935868-116935890 AAGGCTTCATCAGGTGGCTTTGG - Intergenic
997261781 5:132470812-132470834 CAGGCTTCCTCAGGGGTGCCTGG + Intronic
999193672 5:149767370-149767392 ATGGCTTATTCAGGACTCCCAGG + Intronic
1000375189 5:160574239-160574261 AAGGTTTCATCATGTTTCCCAGG - Intronic
1002259242 5:177982581-177982603 AAGGCTTCCGCAGGGGCCCCAGG + Intergenic
1003493345 6:6642507-6642529 GAGGTTTCTTCAGGTTTCCATGG - Intronic
1005495390 6:26383528-26383550 CCGGTTTCTTCAGTTGTCCCTGG - Intronic
1005560268 6:27033257-27033279 AAGGCTTGTTCAGGGGTTCCAGG - Intergenic
1006848272 6:37078289-37078311 AAAGTGTCTTCAGCTGTCCCTGG + Intergenic
1008514680 6:52307638-52307660 AGAGATCCTTCAGGTGTCCCGGG - Intergenic
1010742736 6:79527244-79527266 AAGGGTTCCTTAGGTGACCCAGG - Intronic
1013287492 6:108693761-108693783 AGGCCATCTTCAGGTGTTCCAGG - Intergenic
1014427577 6:121327511-121327533 AAGTCTTCTTGAGGTATCCAGGG - Intronic
1019505997 7:1391707-1391729 GAGGCTGCGTCAGGTGGCCCTGG + Intergenic
1020277528 7:6633991-6634013 GAGGCATCCTCAGGTGGCCCAGG + Intergenic
1022822043 7:33971665-33971687 AAGGATTTTTCAGGTGACTCTGG - Intronic
1026481519 7:70783765-70783787 GAGACTTCTTCAGATGACCCTGG + Intronic
1027257295 7:76439194-76439216 AAGGCTTCTTTATGTGCCCAAGG + Intronic
1027281552 7:76612847-76612869 AAGGCTTCTTTATGTGCCCAAGG - Intronic
1032496909 7:132369441-132369463 AAGGCTTCTTGAGGTGGCAGTGG - Intronic
1038579155 8:28732212-28732234 AAGGCTACTCCAGGTATCTCAGG + Intronic
1041442784 8:57915497-57915519 AATGCCTCTTCAGATGTGCCTGG - Intergenic
1041899103 8:62961086-62961108 AAGGCTTCATCATGTTGCCCAGG - Intronic
1042588899 8:70375429-70375451 AAGGATTCATCATGTGTCCTTGG + Intronic
1042832593 8:73048351-73048373 AGGGCTTCTCCATGTTTCCCAGG + Intergenic
1047403224 8:124563195-124563217 AATGCTTTTCCAGGTGACCCAGG + Intronic
1048163419 8:132041020-132041042 TAAGCATCTCCAGGTGTCCCAGG - Intronic
1048544703 8:135376021-135376043 CAGGCTTCTTCATGTGTCTGTGG + Intergenic
1049792663 8:144479136-144479158 GAGGCCTCTTCAGGAGGCCCAGG - Intronic
1050018325 9:1259282-1259304 AAGTATTATTCAGGTCTCCCGGG - Intergenic
1050567101 9:6896865-6896887 TTGACTTCTTCTGGTGTCCCTGG + Intronic
1051279115 9:15423348-15423370 AGGACTTCTCCTGGTGTCCCAGG - Intronic
1051365650 9:16319783-16319805 AAGACTTCCACAGGTGTACCAGG + Intergenic
1051705548 9:19875905-19875927 AAGGCTTCTCCAGTTGTGCATGG + Intergenic
1051971189 9:22889775-22889797 AAGGGTGCTTCAGGTGTCCATGG - Intergenic
1055455364 9:76466942-76466964 AAGGCTATTTCAGGTGTACAGGG - Intronic
1057665744 9:97044097-97044119 AGGGCTTATTCAGGTAACCCAGG + Intergenic
1058073472 9:100625773-100625795 AAGGTTTCTTCATGCTTCCCAGG + Intergenic
1058639409 9:107068468-107068490 AGGTCTTCTTCAGGTGTCTCAGG + Intergenic
1059411813 9:114137276-114137298 AAAGCTTCCTGAGGTCTCCCTGG + Intergenic
1059483619 9:114611255-114611277 GAGGCTCCTTCCGGCGTCCCGGG + Exonic
1188107701 X:26163814-26163836 AGGGCTTCTACTGGTGCCCCAGG + Intergenic
1188111090 X:26197037-26197059 AAGGCTTCTACTGGTGCCCCAGG + Intergenic
1188897094 X:35682618-35682640 ATGGCTTCTCCACGTGGCCCAGG - Intergenic
1191662571 X:63666159-63666181 AAAGCTTTTTGAGGAGTCCCAGG - Intronic
1195668700 X:107451612-107451634 AAGTCTTGTTGAGGTCTCCCCGG - Intergenic
1197020592 X:121683284-121683306 AAGGCTTCTTCTTGTCTTCCAGG + Intergenic
1197023684 X:121720388-121720410 AAGGTTTCTTCATGTTGCCCAGG + Intergenic
1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG + Intergenic
1199163437 X:144642474-144642496 AAGGCTAATTCAGGTGGCTCTGG + Intergenic
1199538644 X:148932523-148932545 AAGGCTTCTTAATGTGTAGCTGG - Intronic
1202073994 Y:21020384-21020406 AAGGTTTCTGCAGGTGTAGCTGG + Intergenic
1202078694 Y:21062239-21062261 AAGGTTTCTGCAGGTGTAGCTGG + Intergenic