ID: 1165394006

View in Genome Browser
Species Human (GRCh38)
Location 19:35554165-35554187
Sequence ACTGAAGATACACAGAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165394006_1165394012 22 Left 1165394006 19:35554165-35554187 CCCTATCTCTGTGTATCTTCAGT 0: 1
1: 0
2: 2
3: 27
4: 316
Right 1165394012 19:35554210-35554232 TCATCTGCTTGTGCCTAGAGTGG 0: 1
1: 0
2: 3
3: 4
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165394006 Original CRISPR ACTGAAGATACACAGAGATA GGG (reversed) Intronic
901342295 1:8506109-8506131 ACTGGAAATACACAGTGAGAGGG + Intronic
902744856 1:18467007-18467029 ACAGATGCTACCCAGAGATAAGG + Intergenic
903295820 1:22342561-22342583 ACAGAGGGGACACAGAGATAAGG + Intergenic
904041066 1:27585604-27585626 ACTGAAGACACACAAGGAAACGG + Intronic
904705463 1:32386950-32386972 ACTGAAGAAACACAGGGAACAGG - Intronic
904824872 1:33267628-33267650 ACTGAAGGCACAAAGAGATCAGG - Intronic
905015691 1:34777060-34777082 GCTGCAGACACACAAAGATAAGG + Intronic
905117603 1:35655853-35655875 AATGAATATACAAAGGGATATGG + Intergenic
905790673 1:40787656-40787678 ACTGAGGGTCCACAGAGAGAGGG - Intronic
908047451 1:60185666-60185688 GCTGAAGATACACAAAAATGTGG - Intergenic
908286779 1:62613316-62613338 GATGAAGATACACAAATATATGG - Intronic
908887611 1:68808108-68808130 AATAAAGATACACACAGATTAGG + Intergenic
910489158 1:87749015-87749037 ATTGAAGATACGAAGACATAAGG - Intergenic
911172251 1:94782292-94782314 ACTGTAGAAACACAGAGGGAAGG + Intergenic
912187818 1:107301393-107301415 ACTAAAGTTACACTGTGATAGGG + Intronic
912855661 1:113166796-113166818 ACTGAAGATAAACATACATAGGG + Intergenic
916456750 1:164978765-164978787 TCTGAAGAAACACAGACATTTGG + Intergenic
916776645 1:167972208-167972230 ACTGCAGATAAACAGCAATAAGG - Intronic
917107199 1:171504065-171504087 TATGAAGATACTCAGTGATATGG - Intronic
917232261 1:172851233-172851255 ACTGAGGAGAAACAGAGATCAGG - Intergenic
917768777 1:178253213-178253235 ACAGAAGAGACACACAAATAAGG - Intronic
918404397 1:184197069-184197091 ACACAAGGTACACAGAGAAAAGG + Intergenic
919546286 1:198923684-198923706 ACTGATGATAATCTGAGATAGGG + Intergenic
921431666 1:215073080-215073102 TGTGAAGACACACAGAGAGAAGG + Intronic
921695489 1:218204342-218204364 ACTGAAGATAGACAGCCATGAGG - Intergenic
922824762 1:228510199-228510221 ACTGAAGAGGAACAGAGATAAGG - Intergenic
923375678 1:233359615-233359637 AATACAGACACACAGAGATAAGG - Intronic
923923824 1:238600713-238600735 ACTGAACATAAACACAGGTAGGG + Intergenic
924492920 1:244557379-244557401 ACTGAAGAAACACATATAAATGG - Intronic
1063406800 10:5803775-5803797 TGTGAAGAAACACAGAGATGGGG + Intronic
1063990487 10:11556050-11556072 AAGGAAGAAATACAGAGATATGG + Intronic
1064927497 10:20585284-20585306 GCTGAAAATACTCTGAGATAGGG - Intergenic
1065438558 10:25726316-25726338 ACTGGAGTTAGACAGAGAAAGGG + Intergenic
1066576403 10:36829997-36830019 ACTATATATACACAGACATAAGG + Intergenic
1068684056 10:59851033-59851055 ACTGGAGATACATAGAGAAAAGG + Intronic
1068782322 10:60934195-60934217 TCTTAAGGTACACAGAGAGAAGG - Intronic
1069227630 10:65963354-65963376 ACTGAAATAAAACAGAGATAGGG - Intronic
1070688912 10:78510466-78510488 AATGAAGACACAAAGAGATGAGG + Intergenic
1070811760 10:79301609-79301631 ACGGAGGCTACACAGAGATAGGG + Intronic
1071004260 10:80864233-80864255 GCTGAAGATGAACAGAAATACGG - Intergenic
1071470313 10:85979525-85979547 TGTGAAGATACAGAGAGAAATGG - Intronic
1072217855 10:93302994-93303016 ACTGAAAATACAAAAAAATAGGG + Intergenic
1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG + Intronic
1074800378 10:116994497-116994519 ACTGTAGAGACAGAGAGAGAAGG + Intronic
1075668734 10:124248690-124248712 ACAGAAGATACACAGAGGGGAGG + Intergenic
1076404819 10:130204768-130204790 AATGAAGATTCAGAGAGGTAAGG + Intergenic
1077753616 11:5001908-5001930 AGTGAAGATACATAGATAAAAGG + Intergenic
1079296391 11:19238646-19238668 ACTGAAGAGTCAGAGAGACAAGG + Intronic
1079980037 11:27141222-27141244 ACTGAAGATACCCAGAGCCTTGG + Intergenic
1080751089 11:35151102-35151124 AAAGAAGATAGACAGAGAGAGGG + Intronic
1080913634 11:36631405-36631427 ACTGATGGGAAACAGAGATAAGG - Intronic
1082250979 11:49979949-49979971 ACTGAAGATATACAGACAGAGGG - Intergenic
1088047894 11:105475568-105475590 AGTGGAGACACACAGAGAAATGG - Intergenic
1088363485 11:109016010-109016032 GCTGAAGAGACAAAGAGAAATGG - Intergenic
1088564583 11:111155305-111155327 AATGAACAGACACAGACATATGG - Intergenic
1090523169 11:127500576-127500598 TCTGAAGATAGACAGAGGTGAGG + Intergenic
1091130353 11:133141492-133141514 GCTGAAGACAGATAGAGATAAGG - Intronic
1091595563 12:1876576-1876598 AAGCAAGATACACAGTGATAGGG - Intronic
1092576820 12:9793414-9793436 ATGGAAAAAACACAGAGATACGG - Intergenic
1092594941 12:9991945-9991967 ACTGAGGAGACACAGAGACCTGG - Intronic
1093441356 12:19200638-19200660 AATGAAGATACAGACAGATTTGG - Intronic
1093558665 12:20510704-20510726 ATAGAAGATACAGAGAGTTATGG + Intronic
1093827574 12:23713120-23713142 ATTTAAGACACACAGACATAGGG + Intronic
1095398933 12:41792394-41792416 ACTGTAGAGAGACAGAGAGATGG - Intergenic
1096601612 12:52733859-52733881 GATGAAGAGACAGAGAGATATGG - Intergenic
1096967769 12:55642078-55642100 ACTGAAAAGATAGAGAGATACGG + Intergenic
1097080718 12:56428845-56428867 ACTGGAGATACAGTGAGCTAGGG - Intronic
1097087389 12:56478437-56478459 ATTGCGGATACACAAAGATATGG - Exonic
1098672128 12:73244753-73244775 ACTAGAGATACAAAGAGAGAGGG - Intergenic
1100047385 12:90399228-90399250 AATGCAGATCCACAGAGAAAAGG - Intergenic
1101051280 12:100866571-100866593 ACTGAACTAACACAGAGAAAAGG - Intronic
1101115276 12:101525444-101525466 CATGAAGATCCACAGAGAGAAGG - Intergenic
1104013846 12:124949716-124949738 ACTAAAGACACACAGAGAGATGG + Intronic
1105318442 13:19291018-19291040 ACTGAAGTCTCACAGAGAAATGG + Intergenic
1105568755 13:21578730-21578752 ACTAAAGATATACACAAATAGGG + Intronic
1105941164 13:25149258-25149280 ACTGAAGCTACACAAAGAAAAGG - Intergenic
1106395814 13:29379832-29379854 ACTGAGGAGAAACAGACATAAGG + Intronic
1106935885 13:34719150-34719172 ACTGAAGATACAAACCAATAAGG + Intergenic
1107071669 13:36276846-36276868 ACTTAAGATCAACAGATATAGGG - Intronic
1107696827 13:43008452-43008474 TTTGAAGATACACAGATACATGG - Intergenic
1109096688 13:58127875-58127897 GCTGAAATTACACAGAGCTATGG + Intergenic
1109564566 13:64095418-64095440 ACTGAAGAGAAGCAAAGATAGGG + Intergenic
1109619634 13:64886351-64886373 CCTGAGGAGACACAGAGAGATGG - Intergenic
1109773820 13:67013490-67013512 ATTGAAAATAATCAGAGATATGG - Intronic
1110349094 13:74486180-74486202 TCTAAAGATACAAGGAGATAGGG + Intergenic
1110597734 13:77337691-77337713 TCTGAAGACTCACATAGATATGG + Intergenic
1110719653 13:78747075-78747097 ACTGAATGTAGACACAGATATGG - Intergenic
1111130403 13:83967883-83967905 ACTGACTATACAAAGAAATAGGG - Intergenic
1112776872 13:102853600-102853622 CCTGAAGATATACACTGATATGG + Intronic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1115089762 14:29559755-29559777 ACTCAACATACAGAGAAATAAGG + Intergenic
1116176026 14:41471490-41471512 AGTGAAGACACAGAGAGAGAAGG - Intergenic
1116502786 14:45640407-45640429 AAAGAAGATAAACAAAGATAAGG + Intergenic
1116886383 14:50225852-50225874 ACTGTAGGTACACTGAGTTAAGG - Intronic
1117002263 14:51382828-51382850 ACTTAAGATATAAAGAGATTAGG + Intergenic
1117227336 14:53675989-53676011 ACTACAGATAAACAAAGATAAGG - Intergenic
1117958069 14:61137953-61137975 ACAGTAGAGACACAGAGAAAGGG + Intergenic
1118155893 14:63241338-63241360 ACTCAAGAGGCACAGAGACAGGG + Intronic
1118458204 14:65964015-65964037 ACTGAACAGACACAGAGAGCAGG - Intronic
1122927365 14:104911588-104911610 ACAGAAGATACAAAAACATAAGG + Intergenic
1123204166 14:106695530-106695552 ACTGAAGAAAGACACAGATATGG + Intergenic
1123209174 14:106741998-106742020 ACTGAAGAAAGACACAGATATGG + Intergenic
1126082601 15:44979873-44979895 ACCCAAGATATACAAAGATAAGG + Intergenic
1126576349 15:50200813-50200835 ACTAAAACTACACTGAGATACGG + Intronic
1126694893 15:51317548-51317570 GCTTTAGATACACAGAGATTTGG + Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1128485889 15:68088236-68088258 ACAGACCATATACAGAGATATGG - Intronic
1128765044 15:70246243-70246265 TCTAAAGATACCCAGAGATAGGG - Intergenic
1129675180 15:77629430-77629452 ACTGCAGAGACACAGAGAGCAGG - Intronic
1129770053 15:78197417-78197439 ACTTAAGAAAAACAGAGAGAGGG + Intronic
1129907236 15:79196934-79196956 ATTTAAGACACACAGAGAAAAGG - Intergenic
1130244466 15:82232006-82232028 AATGAAAAGCCACAGAGATAAGG - Intronic
1131905652 15:97139183-97139205 TCTGAAGAGACAGAGAGATTTGG + Intergenic
1132213569 15:100045836-100045858 ACTGAAGAGAAATAGAGAAATGG - Intronic
1133678693 16:8099833-8099855 ACTGAAGAGAGAGAGAGAGAAGG - Intergenic
1135237742 16:20774539-20774561 TGTAAAGATACACATAGATAGGG - Intronic
1135803445 16:25520476-25520498 ACTGAGGGTACAAAGATATATGG - Intergenic
1137270802 16:46901251-46901273 ACTGAAGAAAGCCAGAGAAAGGG - Intronic
1138597255 16:58035623-58035645 ACTGATGACCGACAGAGATAAGG + Intronic
1138713723 16:58998189-58998211 ACTGAGGATTCACTGGGATAAGG + Intergenic
1139151707 16:64389420-64389442 ATTTTAGATACACAGAGATAAGG - Intergenic
1139626967 16:68197578-68197600 ACTTAAAATACTCAGAGACAGGG - Intronic
1141367039 16:83453164-83453186 AATGAAGATGCAAAGACATAAGG + Intronic
1143843872 17:9757189-9757211 TCTGAAGGTGCTCAGAGATAAGG + Intergenic
1144203804 17:12964952-12964974 ACTGAGGAAACACAGAGGTAGGG - Intronic
1148398730 17:47334243-47334265 AAAGAAGATACACAGAAACATGG - Intronic
1149467713 17:56892911-56892933 ACTGTAGGGACACAGAGACAAGG + Intronic
1152776967 17:82208080-82208102 ACTAAAAATACACAGAGAAGGGG + Intronic
1154181913 18:12145579-12145601 AGTGAAGAGACACAGAAACAGGG - Intergenic
1155831065 18:30515164-30515186 ACTGAAGATACAGGGAGATGAGG - Intergenic
1156454982 18:37287756-37287778 ACTGCAGATAGACATAGAGATGG + Intronic
1156540249 18:37902797-37902819 ACTGAAAATCCACATAGAAAGGG - Intergenic
1156609675 18:38711650-38711672 ACAGAGGAAACACAGAGATAAGG - Intergenic
1157151244 18:45220917-45220939 AATGTACATACACAGAGAAAAGG - Intronic
1158034322 18:53006083-53006105 ACTGAAGACACACATATATGTGG - Intronic
1160169090 18:76538102-76538124 AATGAAAATATACAGAGAGAGGG - Intergenic
1161731306 19:5962429-5962451 ACTGAGAATACAGAGAGAAACGG - Intronic
1164108374 19:22130459-22130481 ACTGAAGAAACACAAACTTATGG + Intergenic
1164491911 19:28722707-28722729 GCTCAAGATTCACAGAGGTATGG + Intergenic
1164715377 19:30387076-30387098 AGTGGAGACACACAGAGAAAAGG + Intronic
1165394006 19:35554165-35554187 ACTGAAGATACACAGAGATAGGG - Intronic
1165409581 19:35651088-35651110 TCTCAACATACACAGAGATGAGG - Intronic
1165683261 19:37795945-37795967 TCCTAAGATACACAGATATATGG - Intronic
1166517853 19:43460835-43460857 ACTGATCACACACAGACATAAGG + Exonic
1167409153 19:49334905-49334927 AATAAAGAAACACAGAGAGAGGG + Intergenic
1168639810 19:58023579-58023601 ACTGAACATACACACAAAAACGG + Intergenic
925512386 2:4642132-4642154 ACTAAAGATACAAAAAGAAAGGG - Intergenic
925549409 2:5055040-5055062 AAAAAAGATACATAGAGATATGG + Intergenic
927646687 2:24881744-24881766 AATGAAGATAAACAGAGAAGTGG + Intronic
929335957 2:40745947-40745969 ACTGAAGATTCACACACAGATGG - Intergenic
929337765 2:40771655-40771677 CCTGAAAATACACAGTGATATGG + Intergenic
930861997 2:56084089-56084111 ACTGAAGAAGCAAAAAGATATGG + Intergenic
933594836 2:84273011-84273033 ACAGAAGAAACTCAGAGTTAGGG + Intergenic
934631028 2:95922295-95922317 ACTGAAGAGACAGAGACATGAGG - Intronic
936855606 2:116953737-116953759 ACTGAGAATACACACAGAGAGGG - Intergenic
936919227 2:117670657-117670679 ACTGAAGAGAAACAGAGGGAAGG + Intergenic
937478840 2:122238896-122238918 ACTGAAGAGACCCAGGGAAAAGG - Intergenic
937489723 2:122352805-122352827 AGAGAAGATAAACAGAGAAATGG + Intergenic
940432776 2:153612869-153612891 AATGAAGATAAAGAGAAATAAGG - Intergenic
940482582 2:154253972-154253994 CCTTGAGATACACAGTGATAAGG + Intronic
940550147 2:155143935-155143957 AATGAAGACACAGAGATATAGGG + Intergenic
942466692 2:176215515-176215537 ACTGGAGATACAAAGATAAATGG + Intergenic
942674042 2:178407674-178407696 ACTGAATATACAAACAGACAAGG - Intergenic
943870878 2:192997046-192997068 ACTGAAGATACAGAGATAAAAGG + Intergenic
944250039 2:197572720-197572742 ACAGAAGAGTCACAGTGATATGG + Intronic
945650103 2:212547093-212547115 ACAGCAAATACAAAGAGATAAGG - Intergenic
946028522 2:216687326-216687348 CCTGAAGATATATAGAGAAAAGG + Intronic
946653570 2:221920348-221920370 ACTGAAGATGCAGAGAGATAAGG + Intergenic
947902816 2:233736975-233736997 AGTCAAGATACACAGAGGTCAGG + Intronic
948466804 2:238156176-238156198 ACTGAGGATACGCAGGGATGAGG - Intergenic
1170065368 20:12304489-12304511 AATAAAGATACACAGAAATGTGG - Intergenic
1171483479 20:25469985-25470007 ACTCACGATGCACAGAGGTAAGG - Exonic
1172851518 20:37969655-37969677 ACTGGATATACACAGTAATATGG - Intergenic
1174721118 20:52813449-52813471 AATGAAGATGCACAGAGACATGG + Intergenic
1176060852 20:63172310-63172332 ACAGGAGAGACACAGAGACATGG + Intergenic
1176111111 20:63411246-63411268 AGGGAAGAGACACAGAGATGCGG + Intronic
1176552497 21:8233101-8233123 ACAAAAGATACACACAGAGAGGG - Intergenic
1176571402 21:8415694-8415716 ACAAAAGATACACACAGAGAGGG - Intergenic
1176579316 21:8460256-8460278 ACAAAAGATACACACAGAGAGGG - Intergenic
1177065795 21:16433903-16433925 AATGAAGATGTACAGAGAAATGG + Intergenic
1177705343 21:24696936-24696958 ACTGCACATATACAGAGACATGG + Intergenic
1178197629 21:30366594-30366616 ACTGAAAAATCACAGAGAGAAGG + Intronic
1181388922 22:22565061-22565083 ACTGTAGGTACGAAGAGATATGG - Exonic
1183014994 22:34978793-34978815 ATTGAAGCTACAGAGAGGTAAGG - Intergenic
1203257488 22_KI270733v1_random:149843-149865 ACAAAAGATACACACAGAGAGGG - Intergenic
949720022 3:6978180-6978202 GCAGAAGAGACACAGAGAAAAGG + Intronic
951435478 3:22657589-22657611 ACAAAAGACACACAGAAATAAGG + Intergenic
951912105 3:27761612-27761634 ACTGAGGAAACAAAGAGATGTGG + Intergenic
952191749 3:31029981-31030003 GCTGAAGACACACAGATTTATGG - Intergenic
952798650 3:37267033-37267055 ACTGAAGATACTTTGAGAGATGG - Intronic
953177037 3:40562188-40562210 ACAGTAGAGACACAGAGAAAGGG - Intronic
953524074 3:43672694-43672716 ACTAAAAATACACAAAGAAATGG - Intronic
956419372 3:69070511-69070533 GTCAAAGATACACAGAGATAAGG - Intronic
958997309 3:100919230-100919252 ATTGAAGAAAAACAGAAATAGGG - Intronic
959166318 3:102783273-102783295 ACTGAAGATTTAAAGTGATAGGG + Intergenic
960375169 3:116891941-116891963 ACTGAAGAAACTGAGACATAGGG - Intronic
961067368 3:123887274-123887296 ACTAAAGATACATAAACATAAGG - Intergenic
961215174 3:125154086-125154108 ACTGAAGACCCACAGATATTGGG + Intronic
961526274 3:127500176-127500198 TCTGCAGATACACAGATATCGGG + Intergenic
961861901 3:129923372-129923394 ACTGAGTATACACAGAGCCATGG - Intergenic
964007050 3:151843535-151843557 GCTGAAGGTATACAGAGAGAAGG + Intergenic
964128634 3:153263430-153263452 AGGGAAGATACAGAGAAATAGGG + Intergenic
964261227 3:154839860-154839882 ACTGAAAATACACATAGGTTAGG - Intergenic
964700798 3:159563918-159563940 ATTGAAGATACATAAAGAGAAGG - Intronic
965120854 3:164554330-164554352 AGTGAAGATAAGCAGAGAGATGG - Intergenic
966333970 3:178847953-178847975 ACAGCAGATACAAAGAGATCTGG - Intergenic
967083816 3:186075931-186075953 ACTCAAGATATAATGAGATACGG + Intronic
968061249 3:195727551-195727573 GCTGCGGATACACAGAGATGAGG - Intronic
969003964 4:4004733-4004755 AGAGTAGAGACACAGAGATAAGG + Intergenic
969306406 4:6328549-6328571 AGAGAAGAGACACAGAGGTAAGG + Intronic
969809966 4:9640091-9640113 AGAGTAGAGACACAGAGATAAGG - Intergenic
970300817 4:14679760-14679782 ACTGCAGTTTCACAGAGAAAAGG - Intergenic
970347415 4:15166686-15166708 ACTGAATTTACACATAGACAGGG - Intergenic
971353840 4:25876736-25876758 CCTGAAGGAACACAGAGAGAGGG - Intronic
974724475 4:65780869-65780891 AATGAAGATTCAAAGAAATAGGG - Intergenic
974903622 4:68031802-68031824 AGGGTAGAGACACAGAGATAAGG - Intergenic
975679500 4:76862044-76862066 ATTGGAGATACACAAAGAAAGGG + Intergenic
979213132 4:118131493-118131515 ATTCAAGATTAACAGAGATAAGG - Intronic
979342896 4:119548660-119548682 ACTGAAGAAAGACAAAAATAAGG - Intronic
979375586 4:119942779-119942801 TCTTCAGATACACAGACATAGGG + Intergenic
979994952 4:127420557-127420579 CTTGGAGATACACAGAAATATGG + Intergenic
980002137 4:127502178-127502200 ACATATGATACAGAGAGATAAGG - Intergenic
980064290 4:128167082-128167104 ACTTATGATAAACAGAGAAATGG - Intronic
981045542 4:140261747-140261769 GCTGAAGGTACAGAGGGATAAGG + Intronic
981479189 4:145219453-145219475 ACTGCAGATACACAGACCCAAGG - Intergenic
983121949 4:163897327-163897349 ATTTAAGTTAGACAGAGATAGGG - Intronic
983759694 4:171389996-171390018 ACTGAAGAGACACAGTAATTTGG + Intergenic
984271210 4:177550636-177550658 ACTGAAGGGACAAAGAGAAAAGG - Intergenic
984706764 4:182852909-182852931 TGTGAAGAGACACAGAGAGAAGG + Intergenic
985167897 4:187117097-187117119 ACAGGAGATCCACTGAGATAAGG + Intergenic
986741756 5:10710993-10711015 ACAGAAGAGACAAAGAGAAAAGG + Intronic
987301405 5:16600763-16600785 ACACAAAATACACAGAAATAAGG + Intronic
987463887 5:18249236-18249258 ATTGAAGATACAAATAAATAGGG - Intergenic
988437744 5:31195137-31195159 AGTGAAGATTCGCAGAGACACGG - Intronic
988960619 5:36367636-36367658 ACTGAAGAAACAGAGAGATGAGG - Intergenic
989544442 5:42656785-42656807 AATGAAACTACACAGAGATTGGG - Intronic
990001498 5:50898456-50898478 AATGAAGATTCAAAGAAATAGGG - Intergenic
990046548 5:51439791-51439813 AGTGATGCTACACAAAGATAAGG - Intergenic
991376257 5:65970921-65970943 ACTAAAGATACAAAGATAAATGG - Intronic
991500913 5:67276485-67276507 ACAGAAGACCCACAGATATATGG - Intergenic
991996622 5:72394089-72394111 ACTGAAGAAAAATAGTGATAAGG + Intergenic
992092308 5:73328138-73328160 TCTGAGGATAGACAGAGAAAGGG - Intergenic
994104526 5:95931664-95931686 ACTCAAAATACAGAAAGATAAGG + Intronic
994728738 5:103466653-103466675 ACTCAAGATACACAGTGCCAAGG + Intergenic
994817451 5:104602068-104602090 ACTCAAGATGAACAGAGAAATGG - Intergenic
995453985 5:112332739-112332761 ACTGAAAATATGCACAGATATGG + Intronic
995648143 5:114336857-114336879 AGTGAAGGTACACAGAGCAAGGG + Intergenic
996540513 5:124626447-124626469 AGTGCAGATCCACAGAGTTAAGG + Intergenic
996912886 5:128675800-128675822 ACTGAAATTACAGTGAGATATGG - Intronic
997337312 5:133117454-133117476 ACTGGGGAGACACAGAGGTAGGG - Intergenic
998868229 5:146527240-146527262 AATTAAGATATAAAGAGATAGGG + Intergenic
999026535 5:148238859-148238881 ACTGAAGAGAAACAGATACAAGG + Intergenic
999040760 5:148408547-148408569 ACTACAGCTACACAGCGATATGG + Intronic
1003272456 6:4619532-4619554 ACTCAAGAGACAGAAAGATAAGG + Intergenic
1003815248 6:9832962-9832984 AGTGAAGACACACAGGGAGAAGG + Intronic
1004433589 6:15568354-15568376 AATGAAGATACAAAGAAACAGGG - Intronic
1005119107 6:22370779-22370801 ACATAAGACACACAGAGAGAAGG - Intergenic
1005902969 6:30235165-30235187 ACTAAAGATACAAGGGGATAAGG - Intergenic
1005920406 6:30396452-30396474 CCTGAAGAAACACAGGGAGAAGG - Intergenic
1006617343 6:35339511-35339533 ACTTAAGCAACAAAGAGATACGG + Intergenic
1006655146 6:35584970-35584992 TCTGAATATATACAGAGAGATGG - Intronic
1007769675 6:44182919-44182941 CCTGAAGAGACAGACAGATATGG - Exonic
1008872955 6:56293132-56293154 ACTGAACATGCACAAATATACGG - Intronic
1009372270 6:62920540-62920562 ACTGAGGATAAATAGAAATATGG - Intergenic
1009686344 6:66962512-66962534 ACAGCAGATACAAAGAGATCTGG + Intergenic
1010064806 6:71669826-71669848 CCTGAAGAAACAGAGAGAGATGG - Intergenic
1010156922 6:72805466-72805488 ACTGTAGATATATAGATATATGG + Intronic
1010891958 6:81324427-81324449 AGTGAAGATAAACAAAGACAAGG + Intergenic
1011557058 6:88581889-88581911 AGTGAAGAGACACAGAGAATTGG - Intergenic
1012101980 6:95101401-95101423 ACTGAAGAAAAACAGAGAGAAGG - Intergenic
1012437138 6:99226551-99226573 ACAGAAGATACACAGGGAGGAGG + Intergenic
1012947112 6:105478734-105478756 CCTGAAGACACACAGAGAGAAGG + Intergenic
1014807431 6:125845848-125845870 ACCAAATATACACATAGATATGG - Intronic
1014942339 6:127457449-127457471 ACTGGAGAGCCAAAGAGATATGG - Intronic
1016296953 6:142583360-142583382 AATGGAGATACACAAAGAAAGGG - Intergenic
1017595705 6:156026587-156026609 ATTGCAGCTACACAGAGACATGG + Intergenic
1018153070 6:160958490-160958512 ACTGATGATACACAGTGTTGGGG - Intergenic
1018961685 6:168454016-168454038 AAAGAAGACACACAGAGACAAGG - Intronic
1022001360 7:26229355-26229377 AATGAACATACACAAAGACATGG - Intergenic
1022437989 7:30408538-30408560 ACTGGAGATACACAGGGCTGGGG - Intronic
1022606362 7:31818531-31818553 GATGAAGATACATACAGATAAGG - Intronic
1023361156 7:39416445-39416467 ACAGAAGATTCACTGGGATAGGG - Intronic
1024777311 7:52802489-52802511 AATGCAGATACACTGAGATAGGG - Intergenic
1024938923 7:54742057-54742079 ACTTAAGGTACAGAGAGAAAAGG - Intergenic
1025789860 7:64679569-64679591 ACTGAAGAAACAGAGAGACAGGG - Intronic
1026489533 7:70850837-70850859 ACTGGATATGCACAGTGATATGG + Intergenic
1027595006 7:80162462-80162484 ACTGAAGGTACACAGCTGTATGG + Intronic
1028263214 7:88688720-88688742 TGTGAAGATAGACAGAGATTGGG + Intergenic
1028619986 7:92814754-92814776 ACTGAAAATAAACAGAAATAAGG + Intronic
1029438365 7:100574670-100574692 ACAGTTTATACACAGAGATAGGG + Exonic
1029867702 7:103653011-103653033 ACTGAAGATAAACTGATATAAGG + Intronic
1029969878 7:104778519-104778541 ACTGGAGAAACACAGAGTGAAGG - Intronic
1029969976 7:104779410-104779432 ACTGGAGAAACACAGAGTGAAGG + Intronic
1030689388 7:112517056-112517078 ACTGGAGATACAAACATATAGGG - Intergenic
1030775334 7:113527971-113527993 ACTGAATATACACATTGATCTGG - Intergenic
1030859783 7:114611057-114611079 ACTATAGATACACAAAGATACGG - Intronic
1031558833 7:123211714-123211736 TCTGAAGATCCACAGAGATAAGG + Intergenic
1032461544 7:132115059-132115081 ACTGTAGATACAGAGGGATCTGG - Intergenic
1032817479 7:135491779-135491801 ATTGATGATATACAGAGAGAAGG + Intronic
1033120407 7:138662992-138663014 ACTAAAGAGAAACAGTGATAAGG + Intronic
1034103928 7:148474593-148474615 ACTGAAGCTGCCCAGAGAGAGGG - Intergenic
1034674505 7:152882871-152882893 AGAGAAGAGACACAGAGAGAAGG - Intergenic
1038121990 8:24627614-24627636 GCTGAAAATCCACACAGATACGG + Intergenic
1038885718 8:31660564-31660586 ACAGAAGTTACCCAAAGATAGGG - Intronic
1039691535 8:39870058-39870080 AGTGAAGTTCCACAGAGTTAAGG + Intergenic
1040072521 8:43200249-43200271 CATCCAGATACACAGAGATAGGG - Exonic
1040806407 8:51401719-51401741 TCTGAAAATACACACAGATTTGG + Intronic
1041183371 8:55271985-55272007 ACTGAAGATACAAATGGACAAGG - Intronic
1041987600 8:63944048-63944070 CATGAAGATAAACAAAGATAAGG - Intergenic
1042203164 8:66301792-66301814 AGTGAAGATACAGAAAAATAAGG + Intergenic
1042398758 8:68321204-68321226 ATTGAAGATGTATAGAGATATGG + Intronic
1042614560 8:70634072-70634094 GCTGAAGATATGCAGAGAGAAGG + Intronic
1043054997 8:75426296-75426318 AATGGAGAAACACAGAGATCAGG - Intronic
1044175926 8:89122160-89122182 ACTGAAGATGCACAGTTATATGG + Intergenic
1046690782 8:117282197-117282219 AAAGAAGACACACAGACATAGGG - Intergenic
1046834101 8:118780085-118780107 AATGGAGAGACACAGAGAGAAGG - Intergenic
1047166569 8:122445940-122445962 ATTGAAGAGACAGAGAGACAGGG - Intergenic
1049291502 8:141805353-141805375 ACTGGACAGACACACAGATAGGG - Intergenic
1051916278 9:22211776-22211798 ACTGAACATACACAGATATTTGG - Intergenic
1051954250 9:22670848-22670870 ACTGATGAGAGACAGAGAAATGG - Intergenic
1052315247 9:27109762-27109784 ACTGGAGACTCACAGAGAAATGG - Intronic
1053156658 9:35785627-35785649 ACTGGAGAGACCCAGAGAGAAGG + Intergenic
1054752038 9:68917146-68917168 ACTGGAGGCACAGAGAGATAAGG - Intronic
1054852792 9:69865697-69865719 AATGAAGTTAAGCAGAGATATGG + Intronic
1056137981 9:83647851-83647873 AGTGAACACACAGAGAGATAAGG + Intergenic
1056155216 9:83827849-83827871 TCTCAAGATACAGAGAGACATGG + Intronic
1056355271 9:85795264-85795286 TCTCAAGATACAGAGAGACATGG - Intergenic
1058681659 9:107445611-107445633 AGTGAGGATACACAGAGGTCAGG + Intergenic
1059530044 9:115027248-115027270 AGTGAAGATCCAAGGAGATAAGG + Intronic
1060172133 9:121470486-121470508 TCTGAAGTTCAACAGAGATATGG + Intergenic
1203473677 Un_GL000220v1:131714-131736 ACAAAAGATACACACAGAGAGGG - Intergenic
1186304089 X:8235346-8235368 ACTGAGGAGAAAGAGAGATAGGG + Intergenic
1186451292 X:9675918-9675940 AATTAAGATACATAGAGAAAAGG + Intronic
1186526032 X:10249184-10249206 ACTGAAGGCACACAGAGGTCAGG - Intergenic
1187095227 X:16140929-16140951 AAAGAAGATACACAGAGAACGGG - Intronic
1187978297 X:24727175-24727197 ACTGAAGAAACAAACAGAAAAGG - Intronic
1188028766 X:25240227-25240249 ACTGAATTTACACAGAGTTTTGG + Intergenic
1188515162 X:30977596-30977618 ACTGAGGATACACAAAGGGATGG - Intergenic
1189873616 X:45410501-45410523 AATGAAGATATAAAGAAATAGGG + Intergenic
1192570184 X:72197000-72197022 ACAGAAGAAACACAGAAGTAGGG + Intronic
1194426805 X:93748819-93748841 AGTTAAAATACACAGAGAGAAGG + Intergenic
1195105417 X:101598619-101598641 ATTGATGATACACACAGATGCGG - Intergenic
1195107465 X:101615148-101615170 ATTGATGATACACACAGATGCGG + Exonic
1198732649 X:139749298-139749320 AATGAAGATACACAAATTTAAGG - Intronic
1198983170 X:142422546-142422568 AATGAAGATCCAAAGATATAGGG - Intergenic
1199588752 X:149445345-149445367 GGTGATGATACAGAGAGATAAGG + Intergenic