ID: 1165394151

View in Genome Browser
Species Human (GRCh38)
Location 19:35555166-35555188
Sequence CATTGTGACAGGCGTGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165394151_1165394156 1 Left 1165394151 19:35555166-35555188 CCTGCTCCACGCCTGTCACAATG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1165394156 19:35555190-35555212 AGGCAAAGTTGTCATCCAGCAGG 0: 3
1: 1
2: 0
3: 13
4: 129
1165394151_1165394158 23 Left 1165394151 19:35555166-35555188 CCTGCTCCACGCCTGTCACAATG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1165394158 19:35555212-35555234 GATCATGTCAGCTGCATTTTTGG 0: 1
1: 0
2: 2
3: 32
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165394151 Original CRISPR CATTGTGACAGGCGTGGAGC AGG (reversed) Exonic
900159876 1:1218460-1218482 CATCGTGACCGCCGAGGAGCTGG - Exonic
900646469 1:3711029-3711051 CATGGTGAGAGGGGTGGAGCTGG + Intronic
903257484 1:22112669-22112691 CAATCTGACAGGCCTGGAGCTGG + Intergenic
904261893 1:29292256-29292278 CATTGTGACAGTCGTCAAGGAGG + Intronic
905357613 1:37395657-37395679 CATTGGGAAAGGGCTGGAGCTGG - Intergenic
914901872 1:151715424-151715446 CAATGTGGAAAGCGTGGAGCTGG - Intronic
916168489 1:161983713-161983735 CATTGTCCCAGGCATAGAGCAGG + Exonic
917941489 1:179927039-179927061 CAGTGAGAAAGGCATGGAGCTGG - Intergenic
918877702 1:190070872-190070894 CATTCTGACTGGCGTTGAGATGG + Intergenic
919608986 1:199721765-199721787 CATTCTGGGAAGCGTGGAGCAGG - Intergenic
919819810 1:201465850-201465872 CTTTGTGCCAGGCCTGGAGGAGG - Exonic
920738275 1:208555241-208555263 CTTTCTGATAGGCTTGGAGCTGG + Intergenic
921264872 1:213414090-213414112 GATTTTGACAGGCCTGGAGGTGG + Intergenic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
1064034018 10:11900965-11900987 CACTGTGGCAGGCGTGGCGCTGG + Intergenic
1067116107 10:43436814-43436836 CATTGTGACGCGCTCGGAGCAGG - Intergenic
1070383855 10:75906063-75906085 CTCTGTGGCAGGGGTGGAGCTGG - Intronic
1072639829 10:97203530-97203552 CATTGTGTGATGCCTGGAGCTGG + Intronic
1076619780 10:131779792-131779814 GATGGTGACAGTCGTGGAGATGG - Intergenic
1076724662 10:132407745-132407767 CCTTGGGGCAGGCGTGGGGCAGG + Intronic
1077058692 11:608339-608361 CTGTGTGACTGTCGTGGAGCCGG + Exonic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078507812 11:11965495-11965517 CATTGTGACAGGTCTGGGGAGGG + Intronic
1079138693 11:17793118-17793140 CACTGTGTCAGGCATGGTGCTGG - Intronic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1084190334 11:67495758-67495780 CATTCTGGCAGGAGTGCAGCTGG - Intronic
1085790303 11:79492007-79492029 CCATGTGGCAGGCGTGGAGAGGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1089361047 11:117886875-117886897 CTATGTGCCAGGCCTGGAGCCGG + Intergenic
1093177885 12:15933829-15933851 CATAGTGACAGAGTTGGAGCTGG + Intronic
1094254615 12:28408478-28408500 CATTCTGACTGGCGTTGAGATGG + Intronic
1095866977 12:46983145-46983167 CACTGTGGCAGGCCTGGGGCAGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102061076 12:109931562-109931584 CATGGCAACAGGCGTGGAGCTGG + Exonic
1104364112 12:128161646-128161668 CCTTGTGACAAGGGAGGAGCAGG + Intergenic
1104715168 12:131011506-131011528 CACTGTGTCAGGCGTGGTTCCGG + Intronic
1106775035 13:33000412-33000434 CATGGTGATAGGCTTGGAGATGG + Intergenic
1114500115 14:23162273-23162295 CAGCGGGACAGGTGTGGAGCTGG + Intronic
1118252089 14:64171677-64171699 CAGTGTGACTGGCGCAGAGCTGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1130701440 15:86186562-86186584 CATTTTGACAGGCCTGCAGCAGG - Intronic
1133226492 16:4343249-4343271 CATTGTGATGGGCGTGCAGGTGG - Exonic
1133896174 16:9931380-9931402 CATGGTGCCAGGCATGGAGAAGG - Intronic
1134066024 16:11228887-11228909 CAGTGTGCCTGGCGCGGAGCAGG - Intergenic
1135771926 16:25224406-25224428 CTTTGTGACAGTCCAGGAGCAGG + Exonic
1137394129 16:48105053-48105075 CAGTGTGCCAGGCATGGTGCTGG - Intronic
1137534120 16:49304643-49304665 CCTTGTGACAGGAATGGGGCAGG + Intergenic
1141279175 16:82615082-82615104 CATTGTGCCAGGCGGGGGCCTGG - Intergenic
1141293965 16:82749421-82749443 TATCGTGACAGGAGTGGGGCAGG + Intronic
1142089933 16:88204393-88204415 GATTGTGACACCCGTGGACCAGG + Intergenic
1142502985 17:343866-343888 CACTGTGACAGGCTTTGTGCTGG - Intronic
1142742297 17:1938103-1938125 CAGTGTGACAGAGCTGGAGCAGG - Intronic
1143527566 17:7481432-7481454 CATTGTGACATGGTTGGAGTGGG - Exonic
1143651396 17:8266048-8266070 CAGGGTGCCAGGCGTGCAGCAGG + Intronic
1143687176 17:8526986-8527008 CACTGTGTGAGGCATGGAGCAGG + Intronic
1147234179 17:39045021-39045043 CATTGTGAGAGGCGTGGGAACGG + Intergenic
1147462092 17:40579633-40579655 CTATGTGCCAGGCGTGGTGCTGG + Intergenic
1150720525 17:67610506-67610528 CTTTGGGCCAGGCGTGGTGCCGG + Intronic
1153952513 18:10069181-10069203 CGCTGTGAGAGGCGGGGAGCTGG - Intergenic
1154207226 18:12347508-12347530 AACTGTAACAGGCGTAGAGCTGG - Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1156586791 18:38439895-38439917 CATTGTGAGAGAGGAGGAGCTGG + Intergenic
1157314212 18:46574879-46574901 CATTGTCACATGCATGGTGCTGG - Intronic
1159016654 18:63106357-63106379 CATTGTGCCAGGCCTGCAGGCGG + Intergenic
1159776623 18:72609938-72609960 CAGTGAGACAGGCGTAGAGGTGG - Intronic
1160978359 19:1805355-1805377 CAAGGTGAGAGGCGTTGAGCAGG - Exonic
1161493491 19:4575373-4575395 CAGTGTGAGAGGCCTGGAGGGGG + Intergenic
1161802381 19:6423691-6423713 CATTGGGACAGCCCAGGAGCCGG + Intronic
1163273312 19:16267077-16267099 CCTTGTGACAGGCTGGGGGCAGG + Intergenic
1165246883 19:34503040-34503062 CATGGTGACCGGGATGGAGCAGG - Exonic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1166313357 19:41975629-41975651 CATCGTCACAGGGGTGGAGGAGG - Exonic
1166763553 19:45239043-45239065 CATTTTGACAGGTGGGGACCTGG + Intronic
925342377 2:3146434-3146456 CACAGTGAGAGGGGTGGAGCCGG - Intergenic
926188618 2:10710754-10710776 CTTTATGCCAGGCGTGGTGCTGG + Intergenic
927256765 2:21046284-21046306 CATTGTGAGATGCTTGGAGGTGG + Intergenic
927471972 2:23384187-23384209 CATTCAGACAGGGGTGGAGGAGG + Intergenic
929227322 2:39524239-39524261 CCTTCTGATAGGAGTGGAGCAGG + Intergenic
932272415 2:70422483-70422505 CATTGTGTCAGGCGTGGCTTGGG + Intergenic
934857286 2:97737319-97737341 CTGTGTGCCAGGCGTGGGGCTGG - Intronic
936093076 2:109513116-109513138 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
938967241 2:136399376-136399398 CACTGTGCCAGGCCTGGATCTGG + Intergenic
941336794 2:164255438-164255460 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
942960373 2:181823116-181823138 AATGGTGAGAGGCTTGGAGCAGG - Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945495038 2:210499395-210499417 CCCTGTCACAGGCCTGGAGCTGG - Intronic
948599287 2:239099296-239099318 CATTCTGAAAGGCGTGGAGGTGG + Intronic
948647243 2:239413344-239413366 CACTGTGACAGACGTGGTGTGGG - Intergenic
949071002 2:242024127-242024149 CAATTTGAGAGCCGTGGAGCTGG + Intergenic
1170871374 20:20209795-20209817 CATCGTGGCAGGCGGGGAGGAGG + Intronic
1172012126 20:31851612-31851634 CATGGGGACAGGGCTGGAGCTGG + Intronic
1173467166 20:43292405-43292427 CATTGTGATTGGCTTGGAGTAGG - Intergenic
1173493790 20:43504559-43504581 CATTGATACAGGAGTGGGGCAGG + Intergenic
1174149278 20:48474764-48474786 CAGTGTGAGGGTCGTGGAGCTGG - Intergenic
1174156457 20:48518652-48518674 CATTGAGACAGGAGAGGGGCAGG + Intergenic
1174446929 20:50596762-50596784 GATTGTGAGAGGCGAGGAGAAGG + Intronic
1179233044 21:39522760-39522782 CACTGGGACAGGAGTGAAGCTGG - Intergenic
1181530281 22:23513384-23513406 CCGTGTGACAGGCGCGGCGCTGG + Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182657806 22:31903751-31903773 GATTCTGACAGGTGTGGAACAGG - Intronic
1183715666 22:39532261-39532283 CTGTGTGCCAGGCGCGGAGCGGG - Intronic
951695442 3:25441396-25441418 CATTGTTACAGGCCTGGGACTGG - Intronic
960545534 3:118910451-118910473 CCTAGTGACAGGGGTGGAGAAGG - Intronic
966028408 3:175314957-175314979 GATTGTGACTGGCTTGAAGCAGG - Intronic
968045760 3:195623235-195623257 CATGATGACAGGTCTGGAGCGGG - Intergenic
968308896 3:197666852-197666874 CATGATGACAGGTCTGGAGCGGG + Intergenic
970116577 4:12703251-12703273 CATCATGACAGACGTGGAGAAGG + Intergenic
970403203 4:15737543-15737565 AAGTGTGCCAGGCATGGAGCTGG - Intronic
976798220 4:88958348-88958370 CTTTGAGCCAGGGGTGGAGCTGG - Intronic
977472166 4:97455200-97455222 CATTGATACAGGAGTGGGGCAGG + Intronic
977751361 4:100613623-100613645 CACTGGGACAGGCCTGGGGCTGG + Intronic
980665965 4:135935932-135935954 CATTGATGCAGGCGTGGGGCAGG - Intergenic
985747529 5:1655607-1655629 CATGATGACAGGTCTGGAGCGGG + Intergenic
987232129 5:15905874-15905896 CATTGTGACATGGGTGGGGTTGG - Intronic
988721057 5:33879508-33879530 GATGATGACAGCCGTGGAGCTGG + Intronic
995198288 5:109398105-109398127 CATTCTGACTGGTGTGGAGATGG - Intronic
995698861 5:114910391-114910413 TAGTGTGACAGGTGAGGAGCAGG - Intergenic
996911860 5:128665701-128665723 CATTGTTACAAGCCTGGAGAAGG - Intronic
998403043 5:141858049-141858071 CAGTGAGACAGGTGAGGAGCTGG - Intronic
1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG + Intergenic
1005375699 6:25180171-25180193 AGTTGTGAGAGGCCTGGAGCCGG + Intergenic
1006827678 6:36948168-36948190 CATTGTGCCAGGCGCTGAGCTGG - Intergenic
1011639123 6:89402731-89402753 AAATGTGACAGGCTTGAAGCAGG + Intronic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014932240 6:127348791-127348813 CACTGTGGCAGGCCTGGTGCTGG - Intergenic
1017118071 6:150997392-150997414 CATTGTCACAGACTTGGAGCCGG - Intronic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1018234178 6:161706401-161706423 CATTTTGAGAGGCGTGAACCCGG - Intronic
1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG + Intronic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1032417100 7:131744216-131744238 CATTGGCACAGTCGTGGTGCAGG + Intergenic
1034445068 7:151109893-151109915 CATGGTGCCTGGCGTGCAGCGGG - Intronic
1036830720 8:12017624-12017646 CCTTGCAACAGGCGGGGAGCGGG - Intergenic
1039440921 8:37594955-37594977 CATTGGGAGGGGCGTGGAGACGG - Intergenic
1039450899 8:37674385-37674407 CAAAGAGACAGGAGTGGAGCAGG - Intergenic
1039518828 8:38154035-38154057 CATTCTGAAAGGGGTGGAGGTGG + Intergenic
1046887837 8:119387611-119387633 CATGGTGGCAGGAGTGGGGCAGG - Intergenic
1048644968 8:136409854-136409876 CTTTGTGTTAGGCCTGGAGCTGG - Intergenic
1051867050 9:21695122-21695144 CATTGAGACAGCCCAGGAGCCGG - Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057509147 9:95663295-95663317 CATTGTGCCAGGCTCTGAGCCGG + Intergenic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1060945434 9:127567469-127567491 CCTTGTGCCAGGCCTGGGGCTGG - Intronic
1061250078 9:129421424-129421446 CCGTGTGACAGGCGCGGCGCTGG - Intergenic
1061719027 9:132540216-132540238 CACTGTGCCAGGCTTAGAGCTGG + Intronic
1062688290 9:137827670-137827692 AATTGTGACAGCAGTGGAGGGGG - Intronic
1187004731 X:15220832-15220854 CAATGTTACAGGCTTGGATCAGG + Intergenic
1201567670 Y:15383919-15383941 CACTGTGTCAGGCATGGAGGAGG + Intergenic