ID: 1165397137

View in Genome Browser
Species Human (GRCh38)
Location 19:35570656-35570678
Sequence TGGGAGACCTTGGGAAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165397128_1165397137 6 Left 1165397128 19:35570627-35570649 CCTGGGCACGCCCAGGTAGGAGG No data
Right 1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG No data
1165397132_1165397137 -4 Left 1165397132 19:35570637-35570659 CCCAGGTAGGAGGGCATGCTGGG No data
Right 1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG No data
1165397134_1165397137 -5 Left 1165397134 19:35570638-35570660 CCAGGTAGGAGGGCATGCTGGGA No data
Right 1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165397137 Original CRISPR TGGGAGACCTTGGGAAGAAG TGG Intergenic
No off target data available for this crispr