ID: 1165399043

View in Genome Browser
Species Human (GRCh38)
Location 19:35586046-35586068
Sequence GCTGCACTCTCTGTGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165399035_1165399043 11 Left 1165399035 19:35586012-35586034 CCTACCAGGGTGGGCGGAGCCCA No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data
1165399038_1165399043 -8 Left 1165399038 19:35586031-35586053 CCCACTTCCTGATTGGCTGCACT No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data
1165399036_1165399043 7 Left 1165399036 19:35586016-35586038 CCAGGGTGGGCGGAGCCCACTTC No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data
1165399039_1165399043 -9 Left 1165399039 19:35586032-35586054 CCACTTCCTGATTGGCTGCACTC No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data
1165399034_1165399043 12 Left 1165399034 19:35586011-35586033 CCCTACCAGGGTGGGCGGAGCCC No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data
1165399032_1165399043 17 Left 1165399032 19:35586006-35586028 CCAATCCCTACCAGGGTGGGCGG No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data
1165399029_1165399043 21 Left 1165399029 19:35586002-35586024 CCAACCAATCCCTACCAGGGTGG No data
Right 1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165399043 Original CRISPR GCTGCACTCTCTGTGTCTTG GGG Intergenic
No off target data available for this crispr