ID: 1165399216

View in Genome Browser
Species Human (GRCh38)
Location 19:35586939-35586961
Sequence TGGAGACCTGCAGTCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165399216_1165399219 -7 Left 1165399216 19:35586939-35586961 CCCTCAGTGACTGCAGGTCTCCA No data
Right 1165399219 19:35586955-35586977 GTCTCCAACCGTTCTCCCCAGGG No data
1165399216_1165399218 -8 Left 1165399216 19:35586939-35586961 CCCTCAGTGACTGCAGGTCTCCA No data
Right 1165399218 19:35586954-35586976 GGTCTCCAACCGTTCTCCCCAGG No data
1165399216_1165399221 0 Left 1165399216 19:35586939-35586961 CCCTCAGTGACTGCAGGTCTCCA No data
Right 1165399221 19:35586962-35586984 ACCGTTCTCCCCAGGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165399216 Original CRISPR TGGAGACCTGCAGTCACTGA GGG (reversed) Intergenic
No off target data available for this crispr