ID: 1165406389

View in Genome Browser
Species Human (GRCh38)
Location 19:35633706-35633728
Sequence GAGAGCTGGGCCTAGGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 455}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165406379_1165406389 2 Left 1165406379 19:35633681-35633703 CCACAGGAAGAGCCAGCAGCACC 0: 1
1: 0
2: 3
3: 47
4: 345
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406370_1165406389 29 Left 1165406370 19:35633654-35633676 CCGGCCCCCCTCATGCTCTCCTC 0: 1
1: 0
2: 4
3: 68
4: 641
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406371_1165406389 25 Left 1165406371 19:35633658-35633680 CCCCCCTCATGCTCTCCTCTTAC 0: 1
1: 0
2: 1
3: 59
4: 600
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406381_1165406389 -10 Left 1165406381 19:35633693-35633715 CCAGCAGCACCCCGAGAGCTGGG 0: 1
1: 0
2: 1
3: 37
4: 254
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406373_1165406389 23 Left 1165406373 19:35633660-35633682 CCCCTCATGCTCTCCTCTTACCC 0: 1
1: 0
2: 3
3: 36
4: 425
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406375_1165406389 21 Left 1165406375 19:35633662-35633684 CCTCATGCTCTCCTCTTACCCAC 0: 1
1: 0
2: 3
3: 42
4: 459
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406377_1165406389 10 Left 1165406377 19:35633673-35633695 CCTCTTACCCACAGGAAGAGCCA 0: 1
1: 0
2: 1
3: 23
4: 212
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406374_1165406389 22 Left 1165406374 19:35633661-35633683 CCCTCATGCTCTCCTCTTACCCA 0: 1
1: 0
2: 2
3: 28
4: 374
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406378_1165406389 3 Left 1165406378 19:35633680-35633702 CCCACAGGAAGAGCCAGCAGCAC 0: 1
1: 0
2: 2
3: 29
4: 264
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455
1165406372_1165406389 24 Left 1165406372 19:35633659-35633681 CCCCCTCATGCTCTCCTCTTACC 0: 1
1: 0
2: 1
3: 48
4: 516
Right 1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165406389 Original CRISPR GAGAGCTGGGCCTAGGCCTG GGG Exonic
900387447 1:2417014-2417036 GAGAGAGGGGCATGGGCCTGTGG + Intergenic
901460053 1:9386001-9386023 GAGACTTGGGCCTGTGCCTGGGG - Intergenic
901627003 1:10630200-10630222 GGCAGCTGGGCCTGGGGCTGGGG - Exonic
901772338 1:11536774-11536796 GCGCCCTGGGCCCAGGCCTGGGG - Exonic
901835667 1:11922588-11922610 GAGAGCAAGGCCAAGGCCTCGGG + Intronic
902200134 1:14827113-14827135 GAGGGATGGGCCCAGTCCTGAGG + Intronic
902754942 1:18542731-18542753 GAGAGCTGAGGCTGGGGCTGGGG + Intergenic
902884762 1:19396608-19396630 GAAAGCTGGACCGAGGACTGAGG - Intronic
903332180 1:22601833-22601855 GAGAGGAGGGCAGAGGCCTGGGG - Exonic
903679743 1:25089027-25089049 GAGCACTGGGCGGAGGCCTGAGG + Intergenic
903986708 1:27234368-27234390 GAAAGCTGGGCTAAGCCCTGGGG - Intergenic
904267389 1:29325657-29325679 GATAGCGGGGCCCTGGCCTGGGG + Exonic
904391573 1:30189503-30189525 AGGATCTGGGCCTAGCCCTGGGG - Intergenic
904611156 1:31727070-31727092 CAGAGCTGGGCCTTTACCTGAGG + Intergenic
904680584 1:32226323-32226345 GAGGGCTGGGAATAGGGCTGGGG + Intronic
904975595 1:34453732-34453754 GAGGGCCAGGCCTAGGGCTGGGG - Intergenic
905017174 1:34785758-34785780 GAGGGCTGGCACTGGGCCTGTGG - Exonic
905179434 1:36156940-36156962 GAGGTCTGGGCCAGGGCCTGAGG - Intronic
905893949 1:41533376-41533398 GAGAGCTGGGCTTGTGTCTGTGG - Intronic
906227329 1:44132672-44132694 GAGAGGAGGACCTAAGCCTGGGG + Intronic
907263306 1:53238315-53238337 GGGAGCGGGGACCAGGCCTGGGG - Intronic
907469707 1:54665330-54665352 GAGAGCTGGGCAGAGGCATGGGG - Intronic
908246095 1:62228678-62228700 GAGAGCTGGGCCTGGAACAGAGG - Intergenic
913585707 1:120273378-120273400 GAGAGCTGGGATGAGGCATGGGG + Intergenic
913622475 1:120624988-120625010 GAGAGCTGGGATGAGGCATGGGG - Intergenic
914567714 1:148885237-148885259 GAGAGCTGGGATGAGGCATGGGG + Intronic
914605108 1:149245008-149245030 GAGAGCTGGGATGAGGCATGGGG - Intergenic
914931496 1:151938143-151938165 TGGAGATGGGCCTAGGACTGGGG + Intergenic
915528576 1:156490563-156490585 GAAAGCTGGGCCTAGGGCAGGGG + Intronic
915911577 1:159918772-159918794 GAGGGCAGGGGCAAGGCCTGGGG + Exonic
916224216 1:162473691-162473713 TAGTGCTAGGCCTAGGCCTGTGG + Intergenic
918190938 1:182173951-182173973 GAAAGCTGAGCCTTGGCCAGAGG - Intergenic
920301647 1:204992574-204992596 GAGAGGTGATCCCAGGCCTGGGG + Intronic
920524740 1:206658484-206658506 GAAAGCTGGGCCGGGGCCGGAGG + Intronic
920756340 1:208737617-208737639 CAGAGCAGGGCCTAGAACTGAGG - Intergenic
922730037 1:227945004-227945026 CAGGGCTGGGCCTGGGTCTGGGG - Intronic
922763497 1:228146269-228146291 GAGAGGCCGGCCAAGGCCTGGGG + Intronic
923007010 1:230058183-230058205 GAGAGTTGGGCCTAGGAAGGAGG - Intronic
924820470 1:247485084-247485106 GAGATGTGGGCCTATGCCAGTGG + Intergenic
924943254 1:248826720-248826742 GAGGGGAGGGCCTAGGCCTAAGG + Intergenic
1062815928 10:499978-500000 AAGAGCTGGGCTTAGGGTTGGGG - Intronic
1065167398 10:22994193-22994215 GAGGGCTGGGCATTGTCCTGGGG + Intronic
1067118806 10:43456470-43456492 GTGAGCTGGGCCTAAGGCTAGGG + Intronic
1067232797 10:44424013-44424035 GAGAGCTGGCCCCAGCCCTGAGG - Intergenic
1067257963 10:44662397-44662419 GAGAGCTGGGCCTTGAGTTGTGG - Intergenic
1068688963 10:59896396-59896418 CAGAGCTGGGCGTAGGGCTAGGG + Intronic
1069729214 10:70600339-70600361 GAGAGCTGGGGCTAGGGGTGGGG - Intronic
1069806117 10:71126041-71126063 GAAAGCTGGGCCGAAGCATGAGG - Intergenic
1070351086 10:75592670-75592692 GAGAGCTGAGCCGAAGCCTGGGG - Intronic
1070543705 10:77436208-77436230 GAGAGCAGGGCCTGGGTATGTGG - Intronic
1070607433 10:77908652-77908674 GTGAGCTGGGCATAGGCAGGCGG - Intronic
1070728777 10:78810580-78810602 AAGAGCTTGGACTAGGCCAGTGG + Intergenic
1070742071 10:78909782-78909804 CAGAGCTGGACCTAAGTCTGAGG + Intergenic
1071404770 10:85319259-85319281 GAGAGCCAGGCCTGGGTCTGAGG - Intergenic
1073118631 10:101107935-101107957 GAGGACTGGGTCCAGGCCTGAGG + Intronic
1073326998 10:102648901-102648923 GGCAGCTGGGCCTCTGCCTGAGG - Intronic
1073328150 10:102654482-102654504 GAGAGCTGGGAATAGGCCCCTGG + Intronic
1073330046 10:102664372-102664394 AAGAGCTGGGGCAGGGCCTGGGG + Intergenic
1074391108 10:113058738-113058760 GAGAGATGGGCTTGGGCCAGTGG + Intronic
1074538276 10:114344575-114344597 AAGTGCTGGGCCTGGCCCTGGGG + Intronic
1075060018 10:119250095-119250117 GAGTGCTGTGCCCAGACCTGTGG + Intronic
1075071193 10:119320889-119320911 GTGAGGTGGGCCTAGGGCAGCGG + Intronic
1075682662 10:124343613-124343635 TTGAGCTGGGCCTGGGTCTGGGG - Intergenic
1075859343 10:125661468-125661490 GAGCCCTGGCCCAAGGCCTGGGG + Intronic
1076401595 10:130188939-130188961 AAGCGCTGTGCTTAGGCCTGGGG + Intergenic
1076402870 10:130194951-130194973 GAGAGCTGGGGATGGGGCTGTGG + Intergenic
1076485141 10:130811025-130811047 GAGAGCTGGGCGTTGGCGGGTGG - Intergenic
1076888635 10:133273701-133273723 GAGAGGAAGGCCTAAGCCTGTGG - Intronic
1076906268 10:133363091-133363113 CAGAGCTGGGCCTGGGCGCGGGG + Intronic
1077094053 11:791904-791926 GGGTGCTGGGCTCAGGCCTGGGG + Exonic
1077164414 11:1128745-1128767 CAGAGGGGGGCCGAGGCCTGGGG + Intergenic
1077183845 11:1227835-1227857 GGGAGCTGGGCCGAGGTCTGAGG + Intronic
1077579085 11:3405234-3405256 GAGGGCTGGGCCTGGGGTTGGGG + Intergenic
1078083052 11:8217831-8217853 GAGAGCTGGGCCGAGGCAGGTGG - Intergenic
1078186450 11:9055718-9055740 GGGAGCAGGGCCTACCCCTGAGG - Intronic
1078448388 11:11422099-11422121 CAAAGCAGGGCCCAGGCCTGGGG + Intronic
1078577955 11:12517399-12517421 GAGATCAGGGCCTGGGCTTGTGG + Intronic
1078757094 11:14221664-14221686 GAGAGCTGGGTGTGGGGCTGAGG - Intronic
1078836298 11:15033956-15033978 GAGAGATGGGCCTGGGTCAGAGG - Intronic
1079078179 11:17396503-17396525 GAGAGCTGGGCCAGGGCCATAGG + Intronic
1079104459 11:17561412-17561434 GAGACCAGGGCCTAGCCTTGAGG - Intronic
1080034103 11:27693597-27693619 GAGAGTTTGGCCTAGGAATGTGG + Intronic
1081603596 11:44512732-44512754 GAAAGCTGGGGCTGGGACTGAGG + Intergenic
1081977474 11:47244895-47244917 GAGAGGCTGGCCTAGGCCTGGGG - Intronic
1083161749 11:60858718-60858740 GTGGGCTGGGCCTATGCTTGGGG - Intergenic
1083446021 11:62708528-62708550 GAGAGCTGTCCCCAGGCCTCTGG + Intronic
1083621841 11:64053159-64053181 GAGAGCTGGGGCTGGGCTTGGGG + Intronic
1083625971 11:64072151-64072173 GGGAGCTGTGGCTGGGCCTGGGG + Intronic
1083860206 11:65416379-65416401 CAGGGCTGGGCCTGGGTCTGAGG + Intergenic
1083951516 11:65959184-65959206 GTGAGCCGGGCATTGGCCTGAGG - Exonic
1084079121 11:66807670-66807692 GAGAGCTGAGCCTAGCATTGGGG + Intronic
1084220455 11:67674527-67674549 CAGAGCAGGGCTGAGGCCTGGGG - Exonic
1084236107 11:67788753-67788775 GAGGGCTGGGCCTGGGGTTGGGG + Intergenic
1084276125 11:68051830-68051852 GAGAGCTGGGCAGAGACTTGGGG + Intergenic
1084487049 11:69454621-69454643 GAGAGGTGGGGGTGGGCCTGAGG - Intergenic
1084562455 11:69912405-69912427 GCCAGCTGGGCCAAGGCCAGGGG - Intergenic
1084836296 11:71804237-71804259 GAGGGCTGGGCCTGGGGTTGAGG - Intergenic
1085308076 11:75499724-75499746 GAGAGCTGGGCCCAGAGATGGGG + Intronic
1085324852 11:75598771-75598793 GAGATCTGGCCCTTGCCCTGGGG + Intronic
1088723558 11:112615032-112615054 GAGTGATGGGCTTGGGCCTGGGG - Intergenic
1088724001 11:112618549-112618571 GAGAGCAGAACCTAGACCTGGGG + Intergenic
1088921170 11:114260664-114260686 CAGAGCTGGGCCCTGGCCTTGGG + Intronic
1089099788 11:115952703-115952725 GAGAGCTGGTCCACAGCCTGGGG + Intergenic
1089359914 11:117878860-117878882 GAGACCTGGGCCAAGATCTGAGG + Intergenic
1089704969 11:120271492-120271514 GAGAGGTGGGCCCTGGGCTGGGG - Intronic
1090070294 11:123538547-123538569 TAGAGCTGGGCCGAGGGGTGAGG - Intronic
1091238574 11:134037412-134037434 GGGAGCTGGGCGGAGGCGTGGGG + Intergenic
1092407015 12:8228117-8228139 GAGGGCTGGGCCTGGGGTTGGGG + Intergenic
1093116323 12:15216033-15216055 GAGTGCAGGGTCTAGGCTTGAGG - Intronic
1093496552 12:19763932-19763954 GGGAGCTAGGACAAGGCCTGGGG - Intergenic
1095478336 12:42608904-42608926 CACAGCTGGGCCCTGGCCTGTGG + Intergenic
1095942687 12:47737122-47737144 AAGGGCAGGGCCTTGGCCTGGGG - Exonic
1096177840 12:49534845-49534867 GAGAGCCAGGCTCAGGCCTGGGG + Intergenic
1096682873 12:53268510-53268532 AAGGGCTGGGCCGAGGCCTCTGG + Intronic
1097251158 12:57632872-57632894 GGGAGCTGGGCATGAGCCTGAGG + Exonic
1099439882 12:82686966-82686988 GGGAGCTGGGGCTGGGGCTGGGG + Exonic
1101173253 12:102121187-102121209 AAGAGCTGGGACTAGACCAGGGG + Intronic
1101245892 12:102884222-102884244 GAGAGCAGGGACAAAGCCTGAGG + Intronic
1101282751 12:103276398-103276420 TAGAGCTGGGCCTAGTGCAGAGG - Intronic
1101719561 12:107339277-107339299 GATAGCTGAGCCGAGGCATGTGG - Intronic
1102040341 12:109796750-109796772 CTGAGCTGGGCCCAGCCCTGGGG - Intronic
1102151204 12:110689782-110689804 CAGAGCTGGGCCTGCGCCTGCGG - Intronic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1102465784 12:113130176-113130198 GAGAGCTGTCCCTCGGCCTGCGG + Intronic
1103724913 12:122992692-122992714 CAGAGCTGGGGCTGGCCCTGAGG + Intronic
1103936825 12:124481452-124481474 GAGACCTGTGGCTAGCCCTGTGG - Intronic
1104758471 12:131283236-131283258 GTGAGCAGGGCCCAGGCCTGGGG - Intergenic
1104822219 12:131683755-131683777 GTGAGCTGGGCCCAGGCCTGGGG + Intergenic
1105511532 13:21055930-21055952 GAGAGGTAGCCCTTGGCCTGTGG - Intronic
1106588030 13:31073884-31073906 GAGCTCTGGGCCTATGACTGTGG + Intergenic
1107481426 13:40789299-40789321 GAGAGCGGGGCCTGCGCCTCCGG - Intergenic
1112562785 13:100528878-100528900 GAGAACTTGGCCTAGGTGTGGGG + Intronic
1113014708 13:105815686-105815708 CAGAGCTGGGTGTAGGCCTACGG + Intergenic
1113201981 13:107875847-107875869 GGGGGCTGGGACTAGGCCTGTGG - Intergenic
1113579845 13:111421118-111421140 GACAGCTGGCCCCTGGCCTGGGG + Intergenic
1113953036 13:114082366-114082388 GGGAGCAGGGCCTGAGCCTGGGG + Intronic
1114402124 14:22419676-22419698 GTCAGCTTGGCCTGGGCCTGTGG - Intergenic
1115546168 14:34466543-34466565 GAGAGCTGGGGGTGGGACTGGGG - Intergenic
1115852433 14:37598743-37598765 GACAGCAGGGCCTGGGCCGGCGG + Intronic
1121329129 14:93039085-93039107 GAGAGCTGGGCGTATGCAGGCGG - Intronic
1121331414 14:93052105-93052127 CAGAGCTGGGATTTGGCCTGGGG - Intronic
1121630329 14:95417083-95417105 GAGAGCTGGGGTTAGGGCTCCGG + Intronic
1121645786 14:95516502-95516524 CAGAGCTGGGCCAGGGGCTGAGG + Intronic
1121734172 14:96206296-96206318 GAGAGCTGGGATGAGGCCTGGGG - Intronic
1122071708 14:99209375-99209397 GAGAGCAGGGCAGAGCCCTGGGG + Intronic
1122115193 14:99523969-99523991 GAGTGCTGGGCCTAGGGGTGGGG - Intronic
1122151975 14:99730453-99730475 GGGAGCCGGGCCTGGGTCTGGGG + Intergenic
1122558493 14:102593641-102593663 GTGAGCTGCGCCTCGGCCAGGGG + Intronic
1122907862 14:104810486-104810508 GAGAGCTGGGCCTGGGTAAGCGG - Intergenic
1122924066 14:104891788-104891810 GAGTGCTGGGCGGGGGCCTGAGG + Intronic
1123034997 14:105468381-105468403 GGGCGCTGGGCCTTGGCTTGTGG + Intronic
1124219333 15:27835669-27835691 GAGAACAGGGCCTGCGCCTGAGG - Intronic
1124562927 15:30791928-30791950 GAGGGCGGGGCCTGGGGCTGGGG - Intergenic
1124593947 15:31078355-31078377 CACAGCTGGGACTAGGGCTGGGG - Intronic
1124960374 15:34389295-34389317 GAGGGCGGGGCCTGGGGCTGGGG + Intronic
1124977003 15:34535516-34535538 GAGGGCGGGGCCTGGGGCTGGGG + Intronic
1126348189 15:47718179-47718201 GAGAGCTGAGCCAAGGCCGAAGG + Intronic
1127759636 15:62125865-62125887 GAGAGCTGGGAGTAGGGATGGGG + Intergenic
1127960626 15:63887785-63887807 CAGTGCTGGGGCTAGGCCTGGGG + Intergenic
1128530362 15:68441044-68441066 GAGAGCTGGTCCTAGCCTTCTGG + Intergenic
1129242852 15:74261826-74261848 TGGAGCTGGGTCCAGGCCTGGGG - Intronic
1129403628 15:75300578-75300600 GAGAGGTGGCCCTGGGCCAGTGG - Intergenic
1129461053 15:75700294-75700316 GAGAGCTGGACCCCAGCCTGGGG + Intronic
1129674603 15:77625697-77625719 CAGACCTGGGACTGGGCCTGAGG + Intronic
1129702168 15:77774324-77774346 GAGAGGTGGGCAGAGGGCTGAGG - Intronic
1129723767 15:77891431-77891453 GAGAGCTGGACCCCAGCCTGGGG - Intergenic
1129843622 15:78758356-78758378 CAGGGCTGGGCCTGGGCCTGGGG + Intergenic
1130232657 15:82108686-82108708 GAGAGCTGGGGCTGGGGCTGGGG + Intergenic
1130260271 15:82348946-82348968 GAGGGCAGGGCCTGGGGCTGGGG + Intronic
1130268459 15:82430487-82430509 GAGGGCAGGGCCTGGGGCTGGGG - Intronic
1130280962 15:82520061-82520083 GAGGGCAGGGCCTGGGGCTGGGG - Intergenic
1130472332 15:84236242-84236264 GAGGGCAGGGCCTGGGGCTGGGG - Intronic
1130479823 15:84350813-84350835 GAGGGCAGGGCCTGGGGCTGGGG - Intergenic
1130491947 15:84437316-84437338 GAGGGCAGGGCCTGGGGCTGGGG + Intergenic
1130503561 15:84516356-84516378 GAGGGCAGGGCCTGGGGCTGGGG + Intergenic
1130557546 15:84933369-84933391 GAGAGATGGGCCCAGGCTAGTGG - Intronic
1130594630 15:85240878-85240900 GAGGGCAGGGCCTGGGGCTGGGG - Intergenic
1131646082 15:94346470-94346492 GAGAGCTGGGCTTAGTCCTGTGG - Intronic
1132600060 16:769249-769271 GAGGGCTGGGGCTGGGGCTGGGG - Intergenic
1132625370 16:889046-889068 GGGAGCGGGCCCTTGGCCTGCGG + Intronic
1132702948 16:1229772-1229794 AAGGGCTGGGCCCAGGCCTGGGG - Intronic
1132705375 16:1241096-1241118 AAGGGCTGGGCCCAGGCCTGGGG + Intronic
1132747855 16:1444391-1444413 CAGAGCTGGGCACAGGCCAGGGG + Exonic
1133321269 16:4915077-4915099 GGGAGCTGGCCCTGTGCCTGAGG - Intronic
1133347687 16:5081314-5081336 GAGGGCTGGGCCTGGGGTTGGGG + Intronic
1134018653 16:10906789-10906811 GTGAGCCGGGCCTGGGCTTGTGG + Exonic
1134234556 16:12455245-12455267 TAGAGCTTGGTCTACGCCTGGGG + Intronic
1135691369 16:24540058-24540080 GGGGCCTGGGCCTGGGCCTGGGG + Intronic
1136429051 16:30186470-30186492 GGGAGCTGGACCAGGGCCTGGGG - Intronic
1136561116 16:31039849-31039871 GAGGGCTGGGGCCAGGGCTGGGG - Intronic
1136574957 16:31117895-31117917 GAGGGCGGGGCCCAGGGCTGGGG + Intronic
1136657755 16:31721862-31721884 GAGATCTGGGGCTGGGGCTGGGG - Intronic
1137586171 16:49665038-49665060 CTGAGCTGGGCCTGGGGCTGGGG + Intronic
1137789944 16:51166413-51166435 GTGAGCTGGGCTTATGTCTGTGG - Intergenic
1138420324 16:56894762-56894784 GAGAGCTGGCCCTGGGCTTTGGG - Intronic
1138604811 16:58081803-58081825 GAGATGTGGGCCGAGTCCTGAGG - Intergenic
1138753998 16:59459834-59459856 CAGAGCAGGCCCAAGGCCTGAGG - Intergenic
1139270996 16:65682415-65682437 TAGAGCTGGGCCTATCCTTGGGG - Intergenic
1139917694 16:70438646-70438668 GAGGGCTGGGGCTGGGGCTGGGG + Intronic
1140042531 16:71418018-71418040 GAGGGCTGTTCCTTGGCCTGAGG - Intergenic
1141605298 16:85149797-85149819 GAGAGCTGGGGCTGAGCATGGGG - Intergenic
1141711962 16:85704974-85704996 GAGAGCTGGCCCTGGCCTTGGGG + Intronic
1141746356 16:85929159-85929181 GAGAACTCGGCATAGCCCTGCGG + Intergenic
1141791574 16:86239694-86239716 GACAGCTGTCCCCAGGCCTGGGG - Intergenic
1141811188 16:86377554-86377576 GAAGGCTCGGCCCAGGCCTGAGG - Intergenic
1141827745 16:86493125-86493147 GAAAGTTGGGCCTTGGCCAGTGG + Intergenic
1141849637 16:86636570-86636592 AAGAGCAGGGCCTGGGTCTGAGG - Intergenic
1141909305 16:87047679-87047701 GAGAGCTGGGGCTTGAACTGTGG - Intergenic
1141955768 16:87370457-87370479 GAGAGCTTTGCCCAGCCCTGGGG + Intronic
1142141125 16:88473359-88473381 TACAGCTGGGCTGAGGCCTGAGG - Intronic
1142191448 16:88720051-88720073 GAGAGGTGGGCCCACGCGTGGGG - Exonic
1142223851 16:88867921-88867943 GAGAGGATGGCCTCGGCCTGGGG - Intergenic
1142502401 17:340326-340348 GAGGCCTGGGCCTGGGCATGAGG - Intronic
1142967865 17:3592229-3592251 GAGAGCTGGGGCTTGGCTGGAGG + Exonic
1142988306 17:3711344-3711366 GAGTGCTGGGCTCAGCCCTGTGG - Intergenic
1143106613 17:4533462-4533484 GGGAGCTGGGCCTGGGCCGCGGG + Intronic
1143555221 17:7655694-7655716 CAGTGCAGGGTCTAGGCCTGGGG - Intronic
1143575776 17:7792346-7792368 AAGAGCTGGGCCTGGGTGTGAGG + Intronic
1143584951 17:7846388-7846410 CAGAGCTGGGCCTGGGGGTGGGG - Exonic
1144454433 17:15407331-15407353 GAGACCTGGGCCTAGGCTGATGG - Intergenic
1144825870 17:18105453-18105475 GAGACCTGGGGCTGGGCTTGCGG - Intronic
1144828901 17:18121114-18121136 GAGGGCTGGGGCGAGGCCAGCGG - Exonic
1145058313 17:19717139-19717161 GGGGCCTGGGCCTGGGCCTGGGG + Intronic
1145249307 17:21288639-21288661 GAGAGCTGGGCCATGCCCAGGGG - Intronic
1145911663 17:28546824-28546846 GAGGGATGGGGCTAGGCCTAGGG + Exonic
1145915820 17:28573489-28573511 GATGGCTGGGCCAAGGGCTGTGG + Exonic
1146639729 17:34531144-34531166 GAGAGCTGGGATTGGGCCCGTGG - Intergenic
1146909906 17:36641833-36641855 GCGAGCCGGGCCTGGGCCAGGGG - Intergenic
1147377612 17:40032270-40032292 GTGTCCTGTGCCTAGGCCTGGGG - Intronic
1147395590 17:40140277-40140299 CTGGGCGGGGCCTAGGCCTGCGG - Intergenic
1147579034 17:41618245-41618267 GGGGGTTGGGCCCAGGCCTGAGG - Intergenic
1147783890 17:42964271-42964293 GAGGGCTAGGGCTAGGGCTGGGG - Intronic
1148124377 17:45229350-45229372 GGGTGCTGGGCCTAGTTCTGGGG - Intronic
1148128905 17:45250917-45250939 GGGACCTGGGACCAGGCCTGTGG + Intergenic
1148223601 17:45882559-45882581 GAGATCTGGGCAGAGGCATGTGG - Intergenic
1148771497 17:50069979-50070001 CAGAGCTGTGACTATGCCTGGGG - Intronic
1150212359 17:63448089-63448111 GGGAGCTGGGGCAAGGCCTCTGG - Intergenic
1150286427 17:63956921-63956943 CAGCTCTGGGCCTAGGCCTGGGG - Intronic
1150336473 17:64334222-64334244 GAGAGCTGGGCGCTGGCCCGGGG - Intronic
1151263075 17:72931937-72931959 GAGAGCAGGGCCTGGGGTTGGGG - Intronic
1151367477 17:73626774-73626796 GAGACCTGGGGACAGGCCTGAGG + Intronic
1151977868 17:77492582-77492604 GAGAGATGGGCCCATCCCTGTGG - Intronic
1152782343 17:82231878-82231900 GGGCGCAGGGCCCAGGCCTGGGG + Intronic
1153054980 18:937045-937067 AAGCGCTGGTCCTCGGCCTGAGG + Intergenic
1155371840 18:25110312-25110334 GAGAGGTGGGCCTGCGCCTTGGG + Intronic
1156226976 18:35118924-35118946 GAGACCTGAGCCAAGACCTGAGG - Intronic
1156450987 18:37266437-37266459 CAGTGCTGGCCCCAGGCCTGAGG + Intronic
1157292889 18:46422601-46422623 GAGAGCTGGACCTCGGTCGGGGG - Intronic
1157368895 18:47092030-47092052 GAGGGTTGGGCCTTGGCATGTGG - Intronic
1158579964 18:58672039-58672061 GAGAGCGGGGCCCAGGGCTCTGG + Intronic
1159871476 18:73763241-73763263 GTCAGCTGGGCAGAGGCCTGAGG - Intergenic
1159897679 18:74012355-74012377 GAGGCCTGGGCCTGGGCCTGGGG + Intergenic
1160223321 18:76992791-76992813 GAGAGCTGGGGCTGGGGCTCTGG - Intronic
1160846802 19:1169560-1169582 CAGAGCTGGGCCTGGGCGAGGGG + Intronic
1160973473 19:1780589-1780611 GAGGGCTGGGCCTGGGGCTGAGG + Exonic
1160974218 19:1784796-1784818 GTGAGGTGGGCCTGGGCCTGGGG - Intronic
1162363931 19:10236538-10236560 GAGAGCTTGGCCTACCCCGGTGG + Intergenic
1163456005 19:17406011-17406033 GAGGGCAGGGCCTGGGTCTGGGG + Intronic
1163599934 19:18242952-18242974 GAGAGCAGGGCCTATCCCTGGGG + Intronic
1163690338 19:18735236-18735258 CAGGGCTGGGCAGAGGCCTGAGG + Intronic
1164521626 19:28984112-28984134 GAGTCCTGGGCCTAGCTCTGTGG - Intergenic
1164556423 19:29256152-29256174 AAGGGCTGGGCCTGGGGCTGCGG + Intergenic
1164586078 19:29476850-29476872 GGGAGCTGGGCTAAGGCTTGGGG - Intergenic
1164586295 19:29478187-29478209 GGGAGCTGGGCCAAGACCTGGGG + Intergenic
1164922979 19:32103438-32103460 GAGAGCTGGGGCTGGCCTTGGGG - Intergenic
1165386206 19:35511966-35511988 AAGAGACGGGCCTGGGCCTGGGG - Intronic
1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG + Exonic
1165482489 19:36072931-36072953 GGGAGCTGTCCCTTGGCCTGGGG - Intronic
1165914455 19:39248950-39248972 CAGAGCTGGCCCCAGGCCTCTGG + Intergenic
1166300060 19:41908135-41908157 GAGGGCTGGTCCTGGGCCTTGGG + Intronic
1166873788 19:45885476-45885498 GACGGCTGGGGCTGGGCCTGCGG + Exonic
1166917328 19:46204303-46204325 ACGAGCTGGGCCTGGGACTGGGG + Intergenic
1167108869 19:47447370-47447392 GAGAGATGGGACGGGGCCTGGGG - Intronic
1167383462 19:49151114-49151136 GAGACCTGGACCTAGACTTGAGG - Intergenic
1167792525 19:51690605-51690627 GGGAGGGGGACCTAGGCCTGGGG + Intergenic
1168294124 19:55370402-55370424 GTCAGCTGGGCCGCGGCCTGGGG + Intronic
1168306910 19:55440778-55440800 GAGAGGTGGTCAAAGGCCTGGGG + Intronic
926537504 2:14131323-14131345 GACAGCTGGGCCCATGGCTGGGG + Intergenic
927212495 2:20647272-20647294 GGGAGCTGGGCCTAAGGCAGAGG - Intronic
927643241 2:24859297-24859319 GAGGGCTGTGCCTCTGCCTGTGG - Intronic
927850098 2:26493471-26493493 GATGGCAGGGCCCAGGCCTGTGG + Intronic
928024485 2:27728637-27728659 AAGGGCTGGGGCCAGGCCTGGGG - Intergenic
929411337 2:41700159-41700181 GAGAGGTGGGTCTAGACCTCGGG - Intergenic
929760408 2:44801927-44801949 GAGAGCGAGGCCAAGGTCTGGGG + Intergenic
932276960 2:70458786-70458808 GAAAGGTGGGCATAGTCCTGGGG - Intronic
932666921 2:73705429-73705451 GAAAGGTGTGCCAAGGCCTGTGG + Intergenic
933628487 2:84629760-84629782 CAGAGCTGGTTCTAGGTCTGGGG + Intronic
936081736 2:109437041-109437063 GGGTGCTGGGCGTGGGCCTGGGG - Exonic
937090785 2:119205016-119205038 GAGAACCAGGCCTTGGCCTGTGG + Intergenic
937153678 2:119703177-119703199 CAGGGCTGGGCCCAGGGCTGAGG - Intergenic
937286713 2:120758580-120758602 GAGCCCTGGGTCTAGGCCTTGGG - Intronic
937399464 2:121569424-121569446 GACAGCTAGGGCTAGGCCTTCGG + Intronic
937993077 2:127674942-127674964 GCGAGCTGCGCCTCGGCCAGGGG + Intronic
938066016 2:128282489-128282511 CAGAGCTGGGCTGCGGCCTGAGG + Intronic
942042378 2:172079316-172079338 GACTGCCGGGCCTAGGCCAGTGG - Intronic
944911050 2:204310718-204310740 GAGAACTGGGCCTCGGCCGGGGG - Intergenic
945097024 2:206229909-206229931 AAGAGCTGGGGCTGGGGCTGGGG + Intergenic
946039944 2:216774808-216774830 CAGAGCTGGCCCTGGGGCTGCGG - Intergenic
946249079 2:218402135-218402157 GAGTCCTGGGCCTTGGCCTCAGG - Exonic
946909376 2:224444446-224444468 AAGACCTGTGCCTAGACCTGGGG + Intergenic
947383772 2:229570668-229570690 GAGAGCAGGGCACAGGCATGTGG + Intronic
948054826 2:235003279-235003301 GAGAGCTAGGCCCTGGCCAGGGG - Intronic
1168774851 20:438985-439007 GAGATCTGAGCTTAGGCCAGTGG - Intronic
1169166979 20:3432440-3432462 AAAACCTAGGCCTAGGCCTGAGG - Intergenic
1169720159 20:8667510-8667532 GAAGGCAGGGCCTGGGCCTGAGG + Intronic
1170899758 20:20450618-20450640 GGAAGCTGGGTCTTGGCCTGGGG - Intronic
1171187365 20:23132405-23132427 CAGAACTGGGCCTAGGACCGGGG + Intergenic
1171958002 20:31474686-31474708 CTTAGCTGGGCCTGGGCCTGAGG - Intronic
1172293739 20:33793426-33793448 TGGAGCTGGGCCTTGGCCCGGGG + Intergenic
1172421885 20:34825249-34825271 GGGAGCGGGCCCCAGGCCTGCGG - Intronic
1172951762 20:38726995-38727017 GTGAGCTGGGCCTGGGCCAGTGG - Intronic
1173662462 20:44744167-44744189 GAGAGCTGAGCTTGGCCCTGAGG - Intergenic
1173849251 20:46207482-46207504 GAGGTCTGGGCCCAGGCCAGAGG + Intronic
1173970539 20:47148883-47148905 CAGAGCTGGACCTAGGTCTGCGG + Intronic
1173981150 20:47225072-47225094 GCTAGCTGGGCCTAGACCTCAGG + Intronic
1174411753 20:50341018-50341040 GACATCTGGGCTTAGGACTGGGG + Intergenic
1174523799 20:51155443-51155465 AGGAGCTGGGCCTGGGACTGAGG + Intergenic
1174696490 20:52564899-52564921 CAGAGCTGGGCATAGGCCGCAGG - Intergenic
1175124672 20:56742394-56742416 GAGAGCTGGGGCTGGGTGTGGGG + Intergenic
1175283159 20:57819018-57819040 GAGAGCTGGGCCAGCCCCTGGGG - Intergenic
1175745125 20:61451198-61451220 GAGAGCTGTGCCTGGTGCTGCGG + Intronic
1175851886 20:62098062-62098084 GGGACCTGGGCCTGGGGCTGGGG + Intergenic
1175893055 20:62323753-62323775 GTGAGCTGGGGCTAGGGCAGTGG - Intronic
1175899437 20:62354254-62354276 GAGAGAAGGGCCTGGGCCTGGGG - Intronic
1175973337 20:62698318-62698340 GAGAGCTGGGCCCAGCCTTCGGG + Intergenic
1176143351 20:63554553-63554575 AAGAGCAGGGCTTAGGCCTGGGG + Exonic
1178230133 21:30773450-30773472 GAGAGGTGTGCCAAGGACTGAGG + Intergenic
1178416247 21:32407543-32407565 CAGAGCTGGGACTTGACCTGAGG + Intergenic
1178735219 21:35142898-35142920 GAGAGCTTGATCTAGGTCTGTGG - Intronic
1179471373 21:41612916-41612938 CAGGGCTGGGCCTCAGCCTGGGG + Intergenic
1179668017 21:42925802-42925824 GAGCGTTGGGACTGGGCCTGAGG + Intergenic
1180914860 22:19479037-19479059 GGGGGCTGGGCCTTGGCCCGGGG - Intronic
1180950028 22:19716790-19716812 CAGCCCTGGGCCTAGGCCTCAGG - Intronic
1180988521 22:19919693-19919715 GTGGGCAGGGCCTGGGCCTGCGG + Intronic
1181045006 22:20210328-20210350 GAGAGCCTGGCCTGGGGCTGGGG - Intergenic
1181235090 22:21443800-21443822 GGGAGTTGGGCTTAGGGCTGAGG + Intronic
1181572496 22:23775176-23775198 AAGAGCTGGACCTAGACCTGGGG - Intronic
1181573773 22:23781514-23781536 GAGAGCTGCCCCAAAGCCTGGGG + Intronic
1181644968 22:24226157-24226179 TACAGCTTGGCCGAGGCCTGGGG - Exonic
1182145071 22:27992550-27992572 GAGGGCTGAGCCAGGGCCTGAGG - Intronic
1182356492 22:29724536-29724558 GAGAGCTGGGACTTGACCTTGGG + Intronic
1182358433 22:29733288-29733310 GAGAGAAGGGCTTGGGCCTGCGG + Intronic
1182422589 22:30255886-30255908 GAAAGCTGGGCCCAGGGCTAGGG + Intergenic
1182442709 22:30373538-30373560 CATGGCTGGGCCTAGCCCTGTGG + Intronic
1183454128 22:37912259-37912281 GGGAGCTGGGCCTAGGCTGAGGG + Intronic
1183472302 22:38016199-38016221 CACAGCTGGGCCAAAGCCTGGGG + Intronic
1183484415 22:38081663-38081685 GAGGGCCAGGCCCAGGCCTGCGG + Exonic
1183521943 22:38300664-38300686 GAGAGCTGGGCCCCAGCCAGTGG + Intronic
1184088986 22:42282706-42282728 GAGAGCTGGGACAGCGCCTGGGG + Intronic
1184147334 22:42619309-42619331 GAGGCCTGGGCCTGGCCCTGAGG + Exonic
1184207460 22:43014477-43014499 GAGGGCAGGGCTTAGTCCTGGGG - Intronic
1184763732 22:46560964-46560986 GATGACTGGGCCTAGGCCTCCGG + Intergenic
1184860944 22:47173093-47173115 GAGAGCTGGGTCTCCCCCTGAGG + Intronic
1185053456 22:48565689-48565711 GAGAGCTGAGCACAGGGCTGCGG - Intronic
1185062866 22:48616099-48616121 TGGAGCTGGGCCTGGGGCTGGGG + Intronic
1185342217 22:50296784-50296806 GAGAGTGGGGCCTGGCCCTGCGG - Intronic
1185380759 22:50506609-50506631 GACGGCTGGGCCTGGGGCTGTGG - Intronic
1185388628 22:50547673-50547695 CAGGGCTGGGGCTAGGACTGAGG - Intergenic
1185388698 22:50547898-50547920 TGGAGCTGGGCTTAGGGCTGGGG - Intergenic
1185388723 22:50547970-50547992 TGGAGCTGGGCTTAGGGCTGGGG - Intergenic
950114060 3:10439041-10439063 GACTGCTGGGCCAAGGCCTGGGG + Intronic
950893606 3:16427717-16427739 GAGAAGTGGGCCCTGGCCTGAGG + Intronic
952900446 3:38108701-38108723 GAGAGCCTGGAGTAGGCCTGGGG + Intronic
954163815 3:48740210-48740232 GTGAGCTGAGTCTTGGCCTGTGG - Intronic
954304265 3:49717231-49717253 GAGAGCAGGGCCTCTGGCTGGGG + Exonic
954423270 3:50430034-50430056 GGGTGCTGGGCTTAAGCCTGGGG + Intronic
955839376 3:63096252-63096274 GAGGGCTGGGGCTGAGCCTGAGG + Intergenic
956659405 3:71583340-71583362 CAGAGCTGGGCCTCGACCCGGGG + Intronic
956695881 3:71919104-71919126 GAGAGCTGGGCTCTGTCCTGAGG - Intergenic
960047269 3:113210896-113210918 GAGAGCTGGGGCTGGGGTTGGGG - Intergenic
960571226 3:119187278-119187300 GAGAGCTGGGCCAAGAGCTCTGG - Intronic
960938916 3:122921040-122921062 CGGAGCTGGGCAGAGGCCTGTGG - Intronic
961043836 3:123695255-123695277 AAGAGGTCCGCCTAGGCCTGGGG - Intronic
961326342 3:126111646-126111668 GAGAGCTGGTGCTGGACCTGGGG - Intronic
961451383 3:127003842-127003864 GAGACCCAGCCCTAGGCCTGAGG - Intronic
961652207 3:128422248-128422270 GAAAGCTGGGCGCAGGCCTTGGG + Intergenic
961885682 3:130094784-130094806 GAGGGCTGGGCCTGGGGTTGGGG + Intronic
961960093 3:130845687-130845709 AAGAGATGGGCATTGGCCTGAGG + Intergenic
962263781 3:133931268-133931290 GGGAGGTGGGCCTAACCCTGGGG + Intergenic
962933730 3:140060513-140060535 CAGAGCTGGGGCTACCCCTGAGG - Intronic
964681568 3:159345781-159345803 AAGAGGAGGGCCTGGGCCTGAGG + Intronic
967123820 3:186407170-186407192 AAGAGAAGGGCCGAGGCCTGAGG + Intergenic
967891366 3:194366616-194366638 GAGGGATGGGGCCAGGCCTGTGG - Intronic
968443137 4:634497-634519 GAAAGCTGGGCCTGTCCCTGTGG - Intronic
968542664 4:1175775-1175797 CAGTGGTGGGCCTAGGCCTGGGG + Intronic
968879770 4:3292977-3292999 GAGGGCGGGGCCGAGGCCGGAGG - Intergenic
968968261 4:3780522-3780544 GGGGGCTGGGCCGAGGCCTCTGG - Intergenic
968994875 4:3938927-3938949 GAGGGCTGGGCCTGGGGTTGGGG + Intergenic
969128113 4:4969103-4969125 CAGAGCTGGGCCTGGGACTCAGG - Intergenic
969251367 4:5970775-5970797 GGGGGCTGGGCCTTGGGCTGAGG - Intronic
969535881 4:7755786-7755808 GAGAGCGGGGACTCTGCCTGGGG + Intergenic
969621325 4:8280310-8280332 GGGAGGAGGGCCTGGGCCTGGGG + Intronic
969641659 4:8402325-8402347 GGCAGCTGGGCCTAGGGCTTTGG - Intronic
969759128 4:9169867-9169889 GAGGGCTGGGCCTGGGGTTGGGG - Intergenic
969819091 4:9707347-9707369 GAGGGCTGGGCCTGGGGTTGGGG - Intergenic
973535770 4:51880524-51880546 AAGAGCTGGGCTCAGGCCTCAGG - Intronic
974929896 4:68349953-68349975 GAAGGCTGGGCCTAGGCCGCTGG - Exonic
976415308 4:84766957-84766979 GAGAGCTGGGCCTAGAACTCTGG - Intronic
976814626 4:89133222-89133244 GAGAGCTGGGCCTAGGGCAAGGG + Intergenic
980213344 4:129818156-129818178 GAGATCTTGGGCTGGGCCTGTGG + Intergenic
985683123 5:1266986-1267008 GGGCGCTGGGCTTGGGCCTGAGG - Intronic
985813714 5:2111035-2111057 GAGAGGTGGGCAGAGGCCTGCGG + Intergenic
985852646 5:2399918-2399940 AAGAGCATGGCCCAGGCCTGAGG - Intergenic
987099800 5:14581854-14581876 GGGCGCTGGGCCTCGGCCCGTGG - Exonic
987562019 5:19536759-19536781 TAGATCTGGGCCAAGGCCTGAGG + Intronic
988202218 5:28083182-28083204 GACAGCTGGGCTCAGTCCTGTGG + Intergenic
988365120 5:30288890-30288912 GAGAGCAGGACCCAGGCCTGTGG - Intergenic
988623768 5:32849479-32849501 GAGAGCTGAGCCAAGACTTGAGG - Intergenic
990443543 5:55870628-55870650 GGGAGCTGGGTATAGGCCTGGGG - Intronic
992457351 5:76927970-76927992 CAGAGCAGAGTCTAGGCCTGTGG - Intergenic
995687064 5:114782906-114782928 GAGAGCCGGCCATAGGCCTCTGG + Intergenic
998168300 5:139856948-139856970 GAGAGCTGGAGCCAGGGCTGTGG - Intronic
998402592 5:141855769-141855791 GGGAGCTGGGGCAAGGCCAGGGG - Intronic
999241883 5:150132652-150132674 GAAAGCTGGGCCTAGGTTTGTGG + Intronic
999242173 5:150134017-150134039 GAGAGATTGGCTTAGGTCTGGGG + Intronic
999305030 5:150513991-150514013 GAAAGCTGGGACTAGGGCTAGGG + Intronic
1000199000 5:158988992-158989014 GAGAAGAGGGCCTAAGCCTGCGG - Intronic
1001269898 5:170303108-170303130 CAGAGCTGTGTCCAGGCCTGGGG - Intergenic
1001845548 5:174917973-174917995 GAGAGGTGGCCCTGGGCCAGTGG + Intergenic
1001976891 5:176007394-176007416 GAGTGCTGGGCCGATGTCTGGGG + Intronic
1002021267 5:176365749-176365771 GAGTGCCGGGCCGAGGCCTGCGG + Intronic
1002240537 5:177836386-177836408 GAGTGCTGGGCCGATGTCTGGGG - Intergenic
1002279985 5:178124323-178124345 GAGAGCTGAACCTGAGCCTGGGG + Exonic
1002298863 5:178246569-178246591 GTAAGCTGGGGCCAGGCCTGGGG - Intronic
1003172862 6:3733806-3733828 GGGGGCTGGCACTAGGCCTGTGG - Intronic
1003426603 6:6002190-6002212 GGGGCCTGGTCCTAGGCCTGGGG + Intronic
1003831072 6:10012309-10012331 AAGAGTTGGGCCTAGGGCTGGGG - Intronic
1004615721 6:17286844-17286866 GAGAGCTGGGCATAGGAATTTGG + Intronic
1006294456 6:33163878-33163900 GAGAGGTGAGCCTGGGCCTGAGG - Intronic
1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG + Intronic
1006634445 6:35452222-35452244 GTGGGCGGGGCCAAGGCCTGGGG - Intergenic
1007321872 6:41033519-41033541 GAGAACTGGTGCTAAGCCTGGGG + Intronic
1007635569 6:43297953-43297975 GAGAGCTGGCCCCAGGCCCCAGG + Intronic
1010302141 6:74273577-74273599 GTGAGCAGGGCATAGGCTTGGGG - Intergenic
1011930187 6:92701547-92701569 GACAGCTTGGCACAGGCCTGTGG - Intergenic
1014693241 6:124587619-124587641 GAAACCTGGCCCTGGGCCTGGGG - Intronic
1015880500 6:137866772-137866794 CAGAGCCGGCCCGAGGCCTGCGG + Intergenic
1017870191 6:158480428-158480450 GAGAGCAGGCCCTAGAACTGGGG - Intronic
1019097192 6:169591906-169591928 GAGAGCTGGTTCCAGGTCTGTGG - Intronic
1019333430 7:471497-471519 GTGAGCTGGGCCTGGGCTGGAGG + Intergenic
1019483357 7:1276311-1276333 GGGGCCTGGGCCTGGGCCTGGGG + Intergenic
1019570324 7:1708437-1708459 CAGAGCTGCGCTTGGGCCTGAGG + Intronic
1019664063 7:2242459-2242481 GAGAGCGGGGCGGAGGCTTGGGG + Intronic
1019751699 7:2734853-2734875 CAGAGCTGGGCCTCTGCCTGGGG - Intronic
1019801644 7:3092230-3092252 GGGAGCTGGGGAGAGGCCTGGGG + Intergenic
1019994048 7:4711864-4711886 GTGAGCTGGGCCTGGAGCTGAGG + Intronic
1020319137 7:6927250-6927272 GAGGGCTGGGCCTGGGGTTGGGG + Intergenic
1025230845 7:57202465-57202487 CAGAGCTGGGCCCAGGGATGGGG - Intergenic
1025255680 7:57382504-57382526 GAGAGCTGGCCAGGGGCCTGTGG - Intergenic
1026851572 7:73727008-73727030 GATGGCTGAGCCCAGGCCTGGGG - Intergenic
1032015701 7:128379193-128379215 GAGAGCGGGACCTGGCCCTGTGG - Intergenic
1034275263 7:149821237-149821259 CAGAGCTGGCCCAGGGCCTGGGG - Intergenic
1034433134 7:151050847-151050869 GAGGGCTGGGGCTGGGGCTGGGG - Exonic
1034470430 7:151251825-151251847 GAGAGATGCGCCGCGGCCTGCGG + Intronic
1035269598 7:157711651-157711673 TAATGCAGGGCCTAGGCCTGAGG + Intronic
1035347828 7:158217291-158217313 GTGACCTGGGACCAGGCCTGTGG - Intronic
1035761165 8:2070011-2070033 CAGGGCAGGTCCTAGGCCTGGGG - Intronic
1036806764 8:11840229-11840251 TAGTGCCGGTCCTAGGCCTGGGG - Intergenic
1036847386 8:12179094-12179116 GAGGGCTGGGCCTGGGTTTGGGG + Intergenic
1036868752 8:12421415-12421437 GAGGGCTGGGCCTGGGTTTGGGG + Intergenic
1037583564 8:20261367-20261389 GAGGGCTGGGACTGGTCCTGGGG - Intronic
1039518590 8:38152970-38152992 GGGAGCAGGGCCTGGGCCAGGGG - Intergenic
1042260494 8:66854502-66854524 GAGAGGTGGGTCTGGACCTGGGG + Intronic
1042334372 8:67614730-67614752 GAGAGTTGGGCACAAGCCTGGGG - Intronic
1044166733 8:88993819-88993841 GAGAGACTGACCTAGGCCTGAGG + Intergenic
1044531622 8:93314218-93314240 GAGGGCTGGGTCCAGGCCAGGGG - Intergenic
1044973848 8:97644607-97644629 CCGAGCTGGGCCTCGACCTGGGG + Exonic
1045850950 8:106697396-106697418 GAGGGCAGGGGCAAGGCCTGGGG + Intronic
1047643640 8:126846956-126846978 AACAGCTGGGCCAAGGGCTGAGG + Intergenic
1048442306 8:134469091-134469113 GTGACCTGGGACTAGGCCTCAGG + Intergenic
1048896589 8:138997805-138997827 GAGAGGTGGGCTGAGGGCTGAGG - Intergenic
1049353058 8:142174521-142174543 CAGGGCTGGCCCTAGGCCAGGGG + Intergenic
1052584718 9:30411661-30411683 GAAAGCTTGGCCTGGGACTGTGG - Intergenic
1053299240 9:36936875-36936897 GAGAGGTGGTCTTTGGCCTGAGG - Intronic
1055000817 9:71447126-71447148 GAGTGCAGGGCCCACGCCTGAGG + Intergenic
1057793735 9:98141310-98141332 GAGACCTGGGCCAGGGCCTGTGG - Intronic
1058985926 9:110208147-110208169 CAGAGCTGGGACTGGGGCTGGGG + Exonic
1060273449 9:122164482-122164504 AGGAGCTGGGCCCAGGGCTGGGG - Intronic
1060408374 9:123383808-123383830 GGGAGCTGGGACAGGGCCTGTGG + Exonic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061038277 9:128125481-128125503 GGGGGCAGGGCCTGGGCCTGGGG - Intronic
1062047807 9:134432473-134432495 GAGAGCAGGGCTTGGGGCTGTGG + Intronic
1062095097 9:134698994-134699016 AAGTGCTGGGCCTAAGGCTGTGG - Intronic
1062192095 9:135253354-135253376 GAGAGCCAGGCCTGGGCCTGTGG + Intergenic
1062283108 9:135760615-135760637 GGGAGCTGGGGCTGAGCCTGGGG - Intronic
1062531508 9:137003028-137003050 CAGAGCTCAGCCTGGGCCTGCGG + Intergenic
1062541151 9:137042106-137042128 TGGAGGTGGGCCCAGGCCTGGGG - Intronic
1062571088 9:137185706-137185728 GGGAGCTGGGCCCAGCCATGTGG - Intronic
1062597310 9:137305094-137305116 CAGAGCTGGGCCGAGGCCTGCGG + Intergenic
1062689892 9:137836181-137836203 GAGAGCTGGGCCGGGTCCAGGGG - Intronic
1186247712 X:7631846-7631868 GAGTGCTGGGCTGAGACCTGTGG + Intergenic
1186522103 X:10214870-10214892 GACAGAGGGGCCTAGGGCTGCGG + Intronic
1189705589 X:43756003-43756025 GAGATCTAGTCCGAGGCCTGTGG + Intergenic
1190108032 X:47573076-47573098 CAGGGCTGGGGCTGGGCCTGGGG - Intronic
1190301393 X:49059437-49059459 GAGAGCTGGGCCCTGGGTTGGGG - Intronic
1190938123 X:55014843-55014865 GAGAGGAGGGCCAAGCCCTGAGG - Exonic
1192161820 X:68794124-68794146 GAGAGCTGGGCTCAGGCCTGGGG - Intergenic
1192212693 X:69137665-69137687 TAGAGCTGGGCCTAACCCAGGGG + Intergenic
1192361642 X:70444678-70444700 GGGAGCTGGGGCTGAGCCTGGGG + Intergenic
1192990772 X:76453991-76454013 GAGGGTTGGGACTGGGCCTGTGG - Intergenic
1194227765 X:91282354-91282376 GAGAGATGGGATTTGGCCTGTGG + Intergenic
1194245039 X:91500353-91500375 GAGAGCTGAGCCAAGATCTGTGG + Intergenic
1197730471 X:129805231-129805253 CAGAGGTGGGCCGAGGCCTTAGG + Exonic
1200064210 X:153497038-153497060 CAGGGCTGGGGCTAGGCCTGTGG - Intronic
1200077477 X:153558336-153558358 GACACCTGGGCTCAGGCCTGAGG + Intronic
1200126283 X:153816383-153816405 CAGGGCTGGGGCTAGGCCTGTGG + Intronic
1200564014 Y:4741663-4741685 GAGAGCTGAGCCAAGATCTGTGG + Intergenic
1202068743 Y:20968569-20968591 GAGACATGAGCATAGGCCTGGGG - Intergenic
1202374124 Y:24218050-24218072 GAGGGCAGGGCCTGGGGCTGGGG + Intergenic
1202496657 Y:25452070-25452092 GAGGGCAGGGCCTGGGGCTGGGG - Intergenic