ID: 1165409651

View in Genome Browser
Species Human (GRCh38)
Location 19:35651424-35651446
Sequence CAGAATAAAAGGGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 643}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165409651_1165409656 -7 Left 1165409651 19:35651424-35651446 CCAGCCTCCTCCCTTTTATTCTG 0: 1
1: 0
2: 4
3: 64
4: 643
Right 1165409656 19:35651440-35651462 TATTCTGAACATCCTTACTCTGG 0: 1
1: 0
2: 0
3: 9
4: 116
1165409651_1165409662 26 Left 1165409651 19:35651424-35651446 CCAGCCTCCTCCCTTTTATTCTG 0: 1
1: 0
2: 4
3: 64
4: 643
Right 1165409662 19:35651473-35651495 CCTCTCATCACCTGCTGTTCAGG 0: 1
1: 0
2: 0
3: 20
4: 170
1165409651_1165409657 -3 Left 1165409651 19:35651424-35651446 CCAGCCTCCTCCCTTTTATTCTG 0: 1
1: 0
2: 4
3: 64
4: 643
Right 1165409657 19:35651444-35651466 CTGAACATCCTTACTCTGGAAGG 0: 1
1: 0
2: 2
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165409651 Original CRISPR CAGAATAAAAGGGAGGAGGC TGG (reversed) Intronic
900763876 1:4490974-4490996 CAGAAGAAAAAGGAGGTGACAGG - Intergenic
900868589 1:5286046-5286068 CAGAGGAAAAGGGAGGATTCTGG + Intergenic
900871332 1:5305794-5305816 CAGAATAAAAAGGCTGAGGAAGG - Intergenic
901383343 1:8889985-8890007 TAGAATAAGAGGCAGGAGCCTGG - Intergenic
902434080 1:16385953-16385975 CAGAAGGAAAGAGCGGAGGCAGG - Intronic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
902812135 1:18894242-18894264 CAGGTTAAAACGGAGTAGGCCGG + Intronic
903116607 1:21183497-21183519 GAGAAAAAAAAGGAGGTGGCGGG + Intergenic
903357200 1:22755478-22755500 CAGAAGGGCAGGGAGGAGGCAGG - Intronic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
903432182 1:23314247-23314269 AATAATAAAAGGGTGGAGGGAGG + Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904384428 1:30132186-30132208 AGGACTAGAAGGGAGGAGGCAGG - Intergenic
904834584 1:33326981-33327003 TAAAATAAAAAGGAGGAAGCAGG + Intronic
905227075 1:36486011-36486033 CACAGTATAATGGAGGAGGCAGG - Intergenic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
905345188 1:37306425-37306447 CAGAGTGAGAGAGAGGAGGCTGG + Intergenic
906349555 1:45046264-45046286 CAGAAGAAGAGGGAGAAGTCAGG + Intronic
906786104 1:48617549-48617571 GAGAATAGCAGGAAGGAGGCGGG - Intronic
906809296 1:48809878-48809900 CAGAATAAAACTGAGGAAGGAGG - Intronic
907046768 1:51304462-51304484 CAGAGAAAAGGGGATGAGGCTGG + Intronic
907641899 1:56199054-56199076 ATGAATTAAAGGGAGGAGGTTGG - Intergenic
907811069 1:57870347-57870369 CAGCCTAATAGGGAGGTGGCTGG + Intronic
907903452 1:58762693-58762715 CAGAGTACATGGGGGGAGGCCGG + Intergenic
908046980 1:60181336-60181358 CAGAGTAAAAGTAAGGAAGCTGG - Intergenic
909434651 1:75626923-75626945 GAGAGTAGAAGAGAGGAGGCTGG - Intergenic
909995677 1:82276375-82276397 CAGAAAAAAAGAGAGGACGTGGG - Intergenic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
910321470 1:85949894-85949916 TACAGTAAAAGGGAGGAGGGAGG - Intronic
910492756 1:87790809-87790831 CAGAAGAAAAGAGAAGAGGAAGG - Intergenic
910505860 1:87949478-87949500 CAGCATACAAGGGAGCTGGCAGG - Intergenic
910506114 1:87951779-87951801 CAGAGTCTAAGGGATGAGGCGGG - Intergenic
910669550 1:89759321-89759343 CAGAACACAAGGAAGGAGACTGG + Intronic
911100520 1:94092439-94092461 CAAATGAAAAGGGAGGAAGCGGG + Intronic
911314488 1:96339586-96339608 CAGAGGAAAAGAGAGGAGGAAGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912117299 1:106422548-106422570 CAAAAAAAAATGGAGGAGGAGGG + Intergenic
912358641 1:109076111-109076133 CAGTCTCTAAGGGAGGAGGCCGG + Intergenic
912640673 1:111342623-111342645 CAGAGGCAAAGGGAGGAGGCAGG - Intergenic
912796597 1:112697157-112697179 AAGAAAAATAGGGAGGAGGTCGG + Intronic
913384187 1:118241713-118241735 GAGAAAAAGAGGGAGGAGTCAGG - Intergenic
914003926 1:143716540-143716562 CAAAAAAAAAGGGAGGGGGGGGG + Intergenic
914776502 1:150740686-150740708 GAAAAAAAAAGGAAGGAGGCCGG - Intronic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
916302275 1:163289214-163289236 AAGCAGAAAAGGGTGGAGGCAGG - Intronic
916771579 1:167914040-167914062 CAGAAGACAGGAGAGGAGGCCGG + Exonic
916826161 1:168444000-168444022 AAGAATAAAGGGGAGAAGCCAGG + Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917336650 1:173930358-173930380 AAGAAGAAAAGGGAGGAGGTTGG - Intergenic
917740112 1:177953574-177953596 CAGGATCAAATGGAGGTGGCGGG - Intronic
918446585 1:184623012-184623034 CAGAAAAACAGGGATGAGGCTGG - Exonic
919078380 1:192839780-192839802 GAGAGTAAAAGGGAGGAGATAGG - Intergenic
919552098 1:199003559-199003581 CAGAACAAAAGGGAAAGGGCAGG - Intergenic
920232731 1:204481223-204481245 CAGAAGAGAAGAGAGGAAGCTGG + Intronic
920381484 1:205536932-205536954 GAGAAAACAAGGGAGGAAGCGGG - Intergenic
920456392 1:206104872-206104894 TAGAAAAAAAGGGCGGAGGCCGG + Intergenic
920771004 1:208885184-208885206 CAGGAAAGAAGGGAGGAGCCTGG + Intergenic
921202826 1:212823488-212823510 CAGAAGAAAAGTCAGGAGTCAGG + Intergenic
922086162 1:222349072-222349094 CACAATCAAAGGCAGGAAGCAGG + Intergenic
922536842 1:226387279-226387301 GAGAATAAATGAGATGAGGCCGG - Intronic
923488193 1:234457036-234457058 TACAAAAAGAGGGAGGAGGCTGG + Intronic
923511699 1:234658792-234658814 TAGTATAAAAGGGAGGGGGAAGG + Intergenic
923526310 1:234775489-234775511 CAGAATAACAGAGGGAAGGCAGG + Intergenic
923715068 1:236418247-236418269 CAGAAAAAAAGAAAAGAGGCCGG - Intronic
1063022120 10:2139673-2139695 CAGAGTAAGAGGGTGAAGGCCGG + Intergenic
1063549593 10:7017707-7017729 GAGACACAAAGGGAGGAGGCAGG + Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063742308 10:8837471-8837493 TAGAATAAAAGGGCTGAGGATGG - Intergenic
1064190441 10:13201285-13201307 CAGAACAGAATGGAAGAGGCAGG - Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1064706320 10:18076052-18076074 CAGAGCAAAAGTGAGGAGGCAGG - Intergenic
1064805533 10:19126374-19126396 GAAAATAAAAAGGAGGAGTCAGG - Intronic
1064891663 10:20181932-20181954 TAGAATGAAAAGGAAGAGGCTGG + Intronic
1065035097 10:21629996-21630018 GAAGACAAAAGGGAGGAGGCAGG + Intronic
1065699783 10:28413850-28413872 TAGAATAAAAGAAAGGAGGCCGG + Intergenic
1065866424 10:29919076-29919098 CAGAAGAGAGGGGAGGAGGGAGG - Intergenic
1066244339 10:33567964-33567986 CAGAATAAAAGGGCTGAGGCCGG + Intergenic
1066365160 10:34769426-34769448 GAGGATAAATGGGAGGAGGTGGG - Intronic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067993457 10:51242160-51242182 CAGGATAAAAGACAGGAGGCTGG + Intronic
1068625110 10:59236392-59236414 AAGAAGAAAAGGGAGAAGGGAGG - Intronic
1069098221 10:64286496-64286518 CAGAAGACAAGGGCAGAGGCTGG - Intergenic
1069431020 10:68333699-68333721 CAGTACAAAAGGGAGGAGAAAGG + Intronic
1069842151 10:71346684-71346706 TAGAATGAAAGGGAGGAGTCAGG + Intronic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070837483 10:79458994-79459016 CAGAATAACAGGCATGAGTCTGG - Intergenic
1071241602 10:83712231-83712253 AAGAAAAGAAGGAAGGAGGCAGG + Intergenic
1071943759 10:90617114-90617136 CAAAATAACAGAGATGAGGCAGG + Intergenic
1072267618 10:93745615-93745637 CAGAATAACTGGGGCGAGGCAGG - Intergenic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1073140185 10:101242166-101242188 GAGAATAAAAGGGAGGATTGAGG - Intergenic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1074371715 10:112905771-112905793 AAGAATAACAGGGAGGGTGCAGG - Intergenic
1074448031 10:113536547-113536569 CAAAAAAAAAGGGAGGGGGAGGG + Intergenic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1074895692 10:117775845-117775867 AAGAATAAAAGGGGAGAGGGAGG + Intergenic
1075584318 10:123646108-123646130 CAGAAAAGAAGCGAGAAGGCTGG - Intergenic
1076254894 10:129014451-129014473 CAGGAGAAAAGAGAGAAGGCAGG - Intergenic
1077051916 11:570568-570590 CACAAAAAAAGAGAGAAGGCCGG + Intergenic
1077380573 11:2235129-2235151 CAGAAGCAAAGGGAGGTGGTGGG - Intergenic
1077539833 11:3141322-3141344 CAGAGTCACAGGGAGGATGCTGG - Intronic
1077676102 11:4194060-4194082 CAGAATAAAACAGAGGAGGGAGG - Intergenic
1077960944 11:7076468-7076490 TATAATAAAAGAGAGAAGGCTGG - Intergenic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1079006338 11:16793865-16793887 CAGAATAAAAGAGAAGGGCCAGG + Intronic
1079623883 11:22592155-22592177 GAGAATAAAAGGGAGTAAGTGGG - Intergenic
1080596942 11:33781474-33781496 AAGGATAAAAGAGAGGAAGCAGG + Intergenic
1080674079 11:34408610-34408632 CAGATTAGAATGGAGGAGGATGG + Intergenic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1080923995 11:36737276-36737298 CAGAGACAAAGGGAGGAGGAGGG - Intergenic
1081029604 11:38062095-38062117 AAGATGAAAAGAGAGGAGGCTGG - Intergenic
1081061671 11:38486332-38486354 CAGAATAAAAAGCAGGGAGCTGG + Intergenic
1081514329 11:43810636-43810658 CTCAATAAAAGAGATGAGGCAGG - Intronic
1082207235 11:49452408-49452430 CAGAAGAAAAGGAAGCAGTCTGG - Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082745451 11:56956237-56956259 AAGAATAAAAGGGAGGAAGAAGG + Intergenic
1082880219 11:58029832-58029854 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1083237736 11:61362332-61362354 CGGAAGTAAATGGAGGAGGCGGG - Exonic
1083293233 11:61701291-61701313 CAGAAGAGCAGAGAGGAGGCTGG + Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1085652861 11:78284289-78284311 CAGGATGAAAGGGTGGAAGCAGG - Intronic
1086035949 11:82414610-82414632 CAGAAACAAAGGTGGGAGGCAGG + Intergenic
1086196444 11:84145774-84145796 CAGAGAAAAATGGAGAAGGCTGG + Intronic
1086648041 11:89249325-89249347 CAGAAGAAAAGGAAGCAGTCTGG + Intronic
1087172648 11:95066858-95066880 TAGAATAATAGGGAGGAGCATGG + Intergenic
1088902617 11:114129515-114129537 AAGAATGAAAGGGAATAGGCAGG - Intronic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089545589 11:119222401-119222423 CAGAAGCAAAGGGAGGAGCTAGG + Intronic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1089810129 11:121124952-121124974 CAGAGGAAAAGGGAGGTGACTGG + Intronic
1089891679 11:121887722-121887744 CAGGACAGAATGGAGGAGGCTGG + Intergenic
1090640457 11:128725294-128725316 CAGGAGAAAGGGGAGGAAGCGGG - Intronic
1090911301 11:131121929-131121951 CAGAATAACAGGGAGGTGGAAGG + Intergenic
1090974446 11:131669691-131669713 CAGCATAGAAGGGAGGCAGCAGG + Intronic
1091025660 11:132138763-132138785 CAGAATGAAAGAGTGGAGGAAGG - Intronic
1091217904 11:133914733-133914755 CAGAACAGGAGGGAGGAAGCAGG + Intronic
1091219529 11:133921732-133921754 CAGCACAAAAGTGAAGAGGCGGG - Intronic
1091647119 12:2282288-2282310 AAGAAGAAGAGGGAGGAAGCAGG - Intronic
1091984471 12:4897270-4897292 CAGAATAAAAGGGATGACAAGGG + Intergenic
1092099077 12:5868615-5868637 TAGGAAAAAAGGGAGGATGCTGG - Intronic
1092136845 12:6155388-6155410 GAGAAAAAAAGGGTGGGGGCCGG + Intergenic
1092171252 12:6375258-6375280 CAGGATTAGAGAGAGGAGGCAGG - Intronic
1092284167 12:7119293-7119315 CAGGAGAAAAGGGATGACGCAGG - Intergenic
1092742322 12:11641715-11641737 TAGAACAAAAGGGTGGAGGAAGG + Intergenic
1093657522 12:21713105-21713127 CAAAAAACAAGGGAGAAGGCAGG + Intronic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1094563141 12:31574604-31574626 AATAATAAAAGGGAGGTGGAGGG + Intronic
1095380959 12:41591413-41591435 CTGAGTAAAAGGGAGTAGGAAGG + Intergenic
1095891292 12:47236591-47236613 GAGAATAGGAGTGAGGAGGCAGG - Exonic
1096079799 12:48825821-48825843 AAAAAGAAAAGGGAGGAGGAAGG - Intronic
1096559473 12:52425165-52425187 CAGAATCCCAGGGTGGAGGCTGG + Intronic
1096704426 12:53410009-53410031 CAAAAAAAAAGGAAGGAGCCAGG + Intronic
1097040988 12:56155792-56155814 CAGAGGAAAAGGGATGAGGCGGG + Intronic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1098008998 12:66030621-66030643 AAGAAAGAAAGGGAGGAGGGAGG - Intergenic
1098020044 12:66145189-66145211 CAGAATAAAAGGGGTGGGGGAGG + Intronic
1098158672 12:67626131-67626153 GAGAACAAAAGGGAGGAGGAAGG + Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1100748047 12:97667256-97667278 CAGAAGAGAAGGGAAGAGGAAGG + Intergenic
1100837452 12:98580164-98580186 CAGAAATAAATGGATGAGGCTGG + Intergenic
1101225692 12:102686146-102686168 AAGACTAAAAGGGAGGAGAATGG + Intergenic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101329711 12:103747696-103747718 CAGAAAAAAAGAGACTAGGCTGG + Intronic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1102230251 12:111257257-111257279 AAGAGGAAAAGGGAGGAGGAGGG - Intronic
1102418384 12:112784319-112784341 CTGAATAAGAGGGGAGAGGCTGG - Intronic
1102712968 12:114944303-114944325 CAGAACATTAGGGAGGAGGAAGG + Intergenic
1103121872 12:118387331-118387353 CAGATCTAAAGTGAGGAGGCAGG - Intronic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1103549103 12:121723533-121723555 CAGCAGAACAGGGAGGAGGCAGG + Intronic
1104192283 12:126493607-126493629 CAGAAAAACAGGGTGGAGGAGGG + Intergenic
1104272137 12:127292177-127292199 TAGAACAAAAGGGTGGAGGAAGG + Intergenic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1105324579 13:19358809-19358831 TAGAATAAAAGGCAGGGGCCGGG + Intergenic
1105981971 13:25526768-25526790 CAGAGACAAAGTGAGGAGGCAGG - Intronic
1106093927 13:26625563-26625585 CAGAACAAAAGAGTGGAGGAAGG - Intronic
1106630135 13:31463185-31463207 AAGAATAAAAGGGAATAGGATGG - Intergenic
1106946865 13:34837890-34837912 GAGAAGAATAGGGAGGGGGCAGG + Intergenic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1108386313 13:49902316-49902338 CAGAATAAAAGATAGGAGAAGGG + Intergenic
1108515055 13:51193443-51193465 CAGAGTGAAAGGGAGTAGGATGG + Intergenic
1108583728 13:51849688-51849710 CTGAGTAAAAGGGTTGAGGCGGG - Intergenic
1108598699 13:51972342-51972364 AAGAATTAGAGGGAGGAGGAGGG - Intronic
1109461335 13:62662645-62662667 AAGAACAAAAGAGAAGAGGCAGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109742356 13:66570931-66570953 ATGCATAAAAGGGAGGAGGGAGG + Intronic
1109932711 13:69235936-69235958 CAGTTTAACAGGGAGGAAGCTGG - Intergenic
1110470864 13:75858442-75858464 CAGAATAATAGGTAGAAGGAAGG - Exonic
1110785295 13:79517327-79517349 CAGCAAAAAAGGGAGGAGAGGGG - Intronic
1110882161 13:80585576-80585598 CAGAGAAACAGGGAGGATGCAGG - Intergenic
1112441368 13:99426971-99426993 GAGAATGAAGGGGAGGAGGGAGG + Intergenic
1114480664 14:23032146-23032168 AAGAAAAAAAGAGAAGAGGCCGG + Intronic
1114654631 14:24308804-24308826 CAGAAAAAAAGTGGGGAAGCTGG - Exonic
1116050898 14:39801830-39801852 AATAATAAAAGGGAGGAGCATGG - Intergenic
1117129083 14:52666632-52666654 GAGAAACAAAGGAAGGAGGCCGG + Intronic
1117458923 14:55925761-55925783 AAGAATAAAGGGGTGGAGGTGGG - Intergenic
1117501009 14:56351305-56351327 GAAAAGAAAAGGGAGAAGGCTGG - Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1117953866 14:61107934-61107956 CAGCAAAACAGGGAGGAAGCAGG - Intergenic
1118547353 14:66906275-66906297 CAGAGACAAAGGGAGGAGGTGGG - Intronic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1118847538 14:69558991-69559013 CAGAAGAAAAGAGAGAAGGAAGG - Intergenic
1120387242 14:83862101-83862123 CAGATTAGAAGGCAGGAGGAGGG - Intergenic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1121532417 14:94664733-94664755 TAAAATAAGAGGGAGGAAGCAGG + Intergenic
1121742022 14:96260638-96260660 GAGCATAATATGGAGGAGGCTGG - Intronic
1121762718 14:96459561-96459583 TAGAAAAAAATGGATGAGGCCGG + Intronic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1122682085 14:103472709-103472731 CACAATAAAAAGGAACAGGCTGG + Intronic
1122863839 14:104594705-104594727 CAGAGTCCAAGGAAGGAGGCAGG - Intronic
1123194896 14:106606687-106606709 CAGGTGAAAAGGGAGGAGGGAGG + Intergenic
1123424871 15:20162839-20162861 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1123534095 15:21169370-21169392 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1124404651 15:29382620-29382642 CAGGACAGTAGGGAGGAGGCAGG - Intronic
1125054926 15:35347446-35347468 AAAAAAAAAAAGGAGGAGGCTGG - Intronic
1125565354 15:40673548-40673570 AAGAAAAAAAGAGAGAAGGCCGG - Intergenic
1125581590 15:40789467-40789489 AAGGTTAAAAGGGAGGAGGTGGG - Intronic
1125670845 15:41471595-41471617 CAGTATAAAAGGGAGAAGGGAGG + Intronic
1126046671 15:44648215-44648237 CAGAATAGTAGGAAGCAGGCTGG + Intronic
1126157492 15:45578915-45578937 CAGAGAAAAAGGGAGGAGAAGGG - Intergenic
1127554526 15:60074438-60074460 AATAATAAAAGAGAGAAGGCTGG - Intergenic
1127667850 15:61166452-61166474 CAGAAGAAAAGGGATGAGGCAGG + Intronic
1127921795 15:63500582-63500604 TATAATAAAAGGGAGGGGCCAGG + Intergenic
1128027204 15:64448057-64448079 GAGAATGAAATGGAGGAGGAAGG - Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1129221791 15:74135452-74135474 AAGAAAGAAAGGGAGGAGGAGGG - Exonic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1129929488 15:79398613-79398635 CAGAAAAAAAGGGTGGAGTAAGG - Intronic
1130048066 15:80461419-80461441 GAGAAGAGAATGGAGGAGGCCGG + Intronic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131401657 15:92130335-92130357 CTGAATAAAAGGCAGGTGTCTGG - Intronic
1131948488 15:97653510-97653532 CAGAATAATAGTGGGGAGGGGGG + Intergenic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132789383 16:1677144-1677166 AAGAAAACAAGGAAGGAGGCCGG + Exonic
1134013642 16:10873521-10873543 TAGACCAAAAGGGAGAAGGCAGG + Intergenic
1135302176 16:21340091-21340113 AAGAACAAAAGGGTGGAGGAAGG - Intergenic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1135810838 16:25585357-25585379 GAGAATAAAGGGGAGGAGCTGGG - Intergenic
1136168467 16:28472542-28472564 TAGAAGAAAATGTAGGAGGCTGG + Intergenic
1136171486 16:28492364-28492386 AAAAAAAAAAGGGAGTAGGCAGG - Intronic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136859987 16:33692895-33692917 CTGAATAAAAGTGATGAGGCTGG - Intergenic
1137306660 16:47207378-47207400 TAGAATATAAGAGAGCAGGCCGG - Intronic
1137310007 16:47245820-47245842 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1137387951 16:48058279-48058301 CAAAAAAAAAGGGGGGGGGCGGG - Intergenic
1137789486 16:51162980-51163002 CAGAAGAAAAGGGAGGGAGAAGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1137919959 16:52477237-52477259 CAGAAGAAAAGGAAGAAAGCTGG + Intronic
1137930549 16:52583401-52583423 TAGAATACAAGGAAGAAGGCTGG - Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138953655 16:61944643-61944665 CACAATAAATAGGAGCAGGCGGG + Intronic
1139293228 16:65876652-65876674 CAGAATAACTGGGAGGAGAGTGG + Intergenic
1139374201 16:66486704-66486726 AAGAAAAGAGGGGAGGAGGCTGG + Intronic
1140872783 16:79122269-79122291 AAAAAGAAAAGGGAGGAGGTGGG + Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1203121492 16_KI270728v1_random:1541060-1541082 CTGAATAAAAGTGATGAGGCTGG - Intergenic
1143138731 17:4728016-4728038 CAAAATAAAAAGGGGGAGGTGGG - Intergenic
1143215275 17:5220282-5220304 CAGAATAGATGAGAGTAGGCTGG + Intronic
1143313516 17:6013528-6013550 CAGAATAGCAGGGAGGCTGCGGG + Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143612691 17:8028765-8028787 CATCATAATAGGCAGGAGGCTGG - Intergenic
1144937983 17:18915585-18915607 GAGAAGAAAAGTGAGCAGGCGGG + Intronic
1146371627 17:32268130-32268152 CAGCAGAGTAGGGAGGAGGCAGG - Intronic
1146819177 17:35970863-35970885 CAGAATGCAAGGGAGGAGCGAGG + Intergenic
1147169834 17:38611508-38611530 CAGAAGAAAAGGGAAGAAGAGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1148809913 17:50283787-50283809 CAGAATGAAAGTGGGGAGGGGGG - Intergenic
1149337179 17:55647936-55647958 CAGAAGAAAAGAGAGGAAGATGG + Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149765861 17:59277832-59277854 CAAAATAAAAAAGAAGAGGCCGG + Intergenic
1149794455 17:59506400-59506422 AAGGATAAAAGAGAGGAGGCCGG + Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150107397 17:62472436-62472458 CAGGATAAAAGCCAGGAGGCTGG + Intronic
1150601223 17:66652827-66652849 TAGAGTAAGAGGGTGGAGGCAGG - Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1151376732 17:73694378-73694400 CATAGTAAAAGGGATGAGGGAGG - Intergenic
1151542948 17:74774348-74774370 GAGAATGAAAGGGAAGAGGATGG + Intronic
1152356556 17:79810384-79810406 GAGAAAGAAAGGGAGGGGGCGGG - Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1155247355 18:23923302-23923324 GAGAAGAAAAGGGCAGAGGCAGG + Intronic
1155658325 18:28217887-28217909 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1155908526 18:31481962-31481984 GAGAAAAAGAGGGAGGATGCGGG - Intergenic
1157327346 18:46678668-46678690 AAGGAGAAAGGGGAGGAGGCAGG + Intronic
1157442525 18:47721686-47721708 CAGAATAAAAGGAAGGAAAGAGG + Intergenic
1157470326 18:47983421-47983443 CAGAAGCAAAGAGAGGAGTCAGG - Intergenic
1158067192 18:53424933-53424955 CGGGATACAAGGGAGCAGGCAGG - Intronic
1158358618 18:56647937-56647959 GAGAGGAAAAGGGAGGAAGCAGG + Intronic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160918039 19:1507001-1507023 CAGGATCAAAGTGGGGAGGCTGG - Intronic
1161120094 19:2520953-2520975 GAGAATGAAAGGGCGAAGGCAGG + Intronic
1161236268 19:3199678-3199700 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161484559 19:4528203-4528225 CAGAAAAGCAGGGAGGCGGCCGG - Intronic
1161522844 19:4735109-4735131 GAGAATGAAAGGGAGGAGAGAGG + Intergenic
1162001062 19:7745314-7745336 CAGAACAGAAGGCAGGAGACTGG + Intronic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1162812544 19:13172892-13172914 AAAAAAAAAAGGGAGAAGGCAGG - Intergenic
1163113058 19:15173042-15173064 AAGAAGAAGAGGGAGGAGGGAGG - Intronic
1163126170 19:15245384-15245406 GAGAAAAAAAAGGAGCAGGCTGG + Intronic
1163214783 19:15868437-15868459 AAGAAAGAAAGGGAGGAGGGAGG + Intergenic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1163588679 19:18177955-18177977 CAGAAAAAAAGGCAGGCAGCCGG - Exonic
1164609829 19:29624377-29624399 CAGGGGAAAAGGGAGCAGGCAGG + Intergenic
1164810501 19:31151138-31151160 GAGGAGAAAAGAGAGGAGGCAGG + Intergenic
1165074225 19:33272001-33272023 CAGAAAAACAGAGAGGAGGCGGG - Intergenic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165941820 19:39418280-39418302 AAGAAAAAAAAGGAGAAGGCTGG + Intronic
1165947314 19:39451988-39452010 CAGGAGAGTAGGGAGGAGGCTGG + Intronic
1166728183 19:45041576-45041598 CAGCAGACCAGGGAGGAGGCTGG - Intronic
1167275512 19:48536327-48536349 TAAAATACACGGGAGGAGGCTGG - Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925256739 2:2496283-2496305 AAGAACTAGAGGGAGGAGGCGGG + Intergenic
925286187 2:2717128-2717150 CAGGAGAAGAGGGAGGATGCCGG + Intergenic
925574487 2:5346939-5346961 CTGAATTAAAGGGATGAGTCAGG + Intergenic
925635744 2:5940370-5940392 GAGAATAGAATGGAGAAGGCTGG - Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
926244654 2:11113752-11113774 AAGAAGAAAGGGGAGGAGGAAGG - Intergenic
926777385 2:16435973-16435995 CAGAAAAACAGGCAGGTGGCTGG - Intergenic
926860743 2:17306150-17306172 CAGAATATAGGGGAGTATGCTGG - Intergenic
927338254 2:21950356-21950378 GATAAAGAAAGGGAGGAGGCTGG - Intergenic
927584105 2:24282964-24282986 GAGAAAAGAAAGGAGGAGGCAGG - Intronic
927740887 2:25568821-25568843 CAGAATGAAGGGGAGGAGAACGG - Intronic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928019394 2:27690306-27690328 GAGACTCAGAGGGAGGAGGCTGG - Intronic
928145357 2:28769722-28769744 TAGAACAAAAGGCTGGAGGCGGG + Intronic
928154811 2:28867092-28867114 CAAAAAAAAAGTGAGGGGGCAGG - Intronic
929045343 2:37783679-37783701 TAGACTATAAGAGAGGAGGCTGG - Intergenic
929727611 2:44446639-44446661 GAGAATATAAGGGAAAAGGCTGG - Intronic
930335377 2:50038807-50038829 AAGAAAGAAAGGGAGGAGGGAGG - Intronic
930478075 2:51910728-51910750 CATTATAAAAGCGAGGAGGCCGG + Intergenic
931220012 2:60280683-60280705 TGCATTAAAAGGGAGGAGGCTGG + Intergenic
931287796 2:60847271-60847293 AACAAAAAAAGGGAGGAGGAGGG - Intergenic
932724589 2:74168275-74168297 CAGAATAAAATGGAAGAGGCAGG + Intronic
932774465 2:74519259-74519281 ATAAATAAAAGGGAAGAGGCAGG + Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
933326545 2:80844936-80844958 CAGGAAACCAGGGAGGAGGCAGG + Intergenic
933616636 2:84488627-84488649 CTACATAAGAGGGAGGAGGCAGG - Intergenic
934029113 2:88025557-88025579 CAGAACAAAAGGGAGGAAGAAGG - Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934458347 2:94194014-94194036 TTGAATAAAAGTGATGAGGCTGG - Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
935960692 2:108423094-108423116 CAGAAAGAATGGAAGGAGGCAGG - Intergenic
936453494 2:112651700-112651722 CCGAAAGAATGGGAGGAGGCTGG - Intronic
936599371 2:113880869-113880891 TGGAATAAAAGGGAGAAGGATGG - Intergenic
937031144 2:118741691-118741713 CAGTACAAAAGGCAGTAGGCTGG - Intergenic
937221417 2:120344937-120344959 CAGAAAAAAGGGGGGGAGGGAGG - Intergenic
937686448 2:124703228-124703250 AAGAAAGAAAGGGAGGAGGAAGG - Intronic
937921761 2:127136385-127136407 CAGAAGAAATGAGATGAGGCGGG + Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
938725699 2:134107155-134107177 GAGATTAAAATAGAGGAGGCTGG - Intergenic
939575903 2:143894096-143894118 GAGAAGAAAAGGGTGGATGCAGG + Intergenic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
941515317 2:166466677-166466699 AAAAAGAAAAGGGAGGAGGGAGG - Intronic
941558658 2:167016686-167016708 AAAAATAAAAGGGAAGAAGCAGG + Intronic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942675882 2:178426629-178426651 CAGAGACAAAGGGAGGAGGCAGG - Intergenic
943033914 2:182716626-182716648 GTGAATAACAGGGAGGAGGAAGG - Intronic
943278253 2:185896814-185896836 AAGAAGAAAAGGGAGGGGGAGGG + Intergenic
943891991 2:193299373-193299395 AAGAGTAAAAGAGAGCAGGCTGG - Intergenic
944398929 2:199303356-199303378 AAGAAGGAAAAGGAGGAGGCAGG + Intronic
944674515 2:202023913-202023935 TAGAATAATAAGGGGGAGGCAGG + Intergenic
944982186 2:205134058-205134080 CATAGTAAAAGGGTGGATGCTGG - Intronic
945075854 2:206038851-206038873 GAGAAAAAAAGAGAGGAGGTAGG + Intronic
945138831 2:206661535-206661557 GAGAAGAAGAGGGAGGAGGAGGG - Intronic
945690530 2:213029191-213029213 CAATAGAAAAGGGAGGAGGGAGG - Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946148571 2:217749013-217749035 CAGAACAAAAGGGAGGGGGGTGG - Intronic
946725764 2:222659835-222659857 GAGAATAAAAAGGGGGAGGAAGG - Intergenic
946801335 2:223419225-223419247 CAGACTAAAAGAGAAGAGTCAGG - Intergenic
946926508 2:224632164-224632186 GAGATAGAAAGGGAGGAGGCTGG + Intergenic
947286757 2:228525329-228525351 AAGAATGAGAGGGAGGAGGGAGG + Intergenic
947314088 2:228836190-228836212 CAGAAGAAAAGATAGAAGGCGGG - Intergenic
947664670 2:231896692-231896714 AAGAAGAAAAGAGAAGAGGCTGG - Intergenic
947693011 2:232157290-232157312 AAGAATGCAAGGGAGGAGTCAGG - Intronic
947700340 2:232229173-232229195 CAAAAAAAAAGAGAAGAGGCAGG - Intronic
948930414 2:241128312-241128334 CCGAAAAAGAGAGAGGAGGCTGG + Intronic
1169009847 20:2241368-2241390 AAGAAAAAGAGGGAGGAGGGAGG - Intergenic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169604546 20:7302144-7302166 TAAAAAAAAAGGGAGGTGGCGGG - Intergenic
1169682769 20:8234319-8234341 AATAATAAAAGGGAGCAGGGTGG + Intronic
1169899009 20:10534265-10534287 CAGAAAGAAAGGAAGGAGGCAGG - Intronic
1169940093 20:10927558-10927580 CAGAGTAAAAGGTAGGCCGCCGG - Intergenic
1170765332 20:19285047-19285069 CAGAGAGAAAGGGAGAAGGCAGG - Intronic
1171116007 20:22525420-22525442 AAGAATGGAAAGGAGGAGGCTGG + Intergenic
1171359213 20:24575048-24575070 CAGAAGTAATGGGATGAGGCTGG - Intronic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172842770 20:37912052-37912074 GGGAGTAAATGGGAGGAGGCAGG - Intronic
1172870849 20:38134703-38134725 GAGCATGAAAGGGTGGAGGCAGG + Intronic
1172914833 20:38435756-38435778 CAGAAAAAAAGGAATGGGGCGGG - Intergenic
1173089005 20:39952445-39952467 CACAAGAAAAGGAAGGAGGGAGG + Intergenic
1173695248 20:45005065-45005087 CAGAAGGAAAGAAAGGAGGCTGG - Intronic
1174380138 20:50150990-50151012 CAGAAAAAAATGGAGCTGGCCGG - Intronic
1174659445 20:52198409-52198431 AAGAATAACAGGGAGGAGTGGGG - Intronic
1174813315 20:53665829-53665851 CAAAAAAAAAAGGAAGAGGCCGG - Intergenic
1175100448 20:56575365-56575387 GAGGATCAGAGGGAGGAGGCAGG - Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175534841 20:59702323-59702345 CAAAAGAACAGGAAGGAGGCTGG - Intronic
1175597190 20:60244547-60244569 GAGAAGAAAAGGTAGAAGGCTGG + Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1177923339 21:27182610-27182632 CAGAACAAAAAGGTGGAGGGAGG - Intergenic
1178829649 21:36045220-36045242 CAGTTTAAAAGGGACGGGGCAGG + Intronic
1178918695 21:36724041-36724063 TAGAAAAGAAGGGAGGAGGATGG + Intronic
1179095172 21:38307896-38307918 CAGAAAAAGAGAGATGAGGCTGG - Intergenic
1179499003 21:41795093-41795115 CAGGATCCAAGGGAGGACGCTGG + Intergenic
1179911122 21:44449551-44449573 CAGAATCCAAGGGAGGACCCCGG + Intergenic
1181357864 22:22312412-22312434 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1181479263 22:23187628-23187650 AAAAAGAAAAAGGAGGAGGCTGG - Intronic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1182083183 22:27543518-27543540 CAGAGAAACAGGGAGGAGGGAGG - Intergenic
1182159802 22:28110198-28110220 CAGCATGCAAGGGAGGAGTCAGG - Intronic
1182378088 22:29863175-29863197 CAAAATAAAAGGGTTGTGGCTGG - Intergenic
1182652565 22:31864064-31864086 CAGCATAGAATGGAGGAGGGAGG + Intronic
1182735753 22:32531367-32531389 CAGAATAAAATGGGGTTGGCAGG - Intronic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1183449663 22:37885892-37885914 CAAAATAAAAAAGACGAGGCTGG + Intronic
1183831812 22:40422192-40422214 CCCAATTAAAGGGAGGAGGAAGG + Intronic
1183866804 22:40710702-40710724 CCAAATAAAACAGAGGAGGCTGG - Intergenic
1184902646 22:47457275-47457297 CAGAACCACAGTGAGGAGGCGGG - Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185214871 22:49592982-49593004 CAGAACAAAAGGGAGGAGTAAGG + Intronic
949782194 3:7702017-7702039 TAGAAGAAAAGGGAGGGAGCAGG + Intronic
949996858 3:9624440-9624462 CAAGATAAAAAAGAGGAGGCAGG - Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950166597 3:10805411-10805433 CAGAATACAAGAGAGGAGCCTGG - Intergenic
950631066 3:14282271-14282293 CAGAAAAACAGGTAGGAGCCAGG - Intergenic
950847771 3:16031461-16031483 CTTAATAAAAAGGAGGAGGTAGG + Intergenic
952449967 3:33422398-33422420 AAGAAAAGAAGGGAGGAGGGAGG + Intronic
952528203 3:34235719-34235741 TGGAATGAAAGGGAGGAGGGTGG - Intergenic
952945721 3:38477020-38477042 CTAAGCAAAAGGGAGGAGGCAGG - Intronic
953056942 3:39395605-39395627 CAGATTATGAGGGAGGAGGAAGG + Intronic
953413241 3:42701805-42701827 CCAAATTAAAGGGAGGAAGCAGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954629701 3:52041179-52041201 GAGAGCAAAAGGGTGGAGGCTGG - Intergenic
954702292 3:52456562-52456584 GGGAACAAAGGGGAGGAGGCAGG - Intronic
954751549 3:52817019-52817041 CAGTATGAGAGGGAGAAGGCTGG - Exonic
954927364 3:54248169-54248191 GAGATTAAAAGGGTGGAGCCTGG + Intronic
955157689 3:56433384-56433406 GAGATTTAAAGGGAGGTGGCAGG + Intronic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
955555706 3:60134966-60134988 CAGGAAAAAAGGGGGGAGGGAGG + Intronic
955701394 3:61685458-61685480 CAGAAGTAAAGGGAAGAAGCAGG + Intronic
956446638 3:69332215-69332237 CAGAAGAGAAGGGAGCAGGCAGG + Intronic
956710020 3:72030775-72030797 AAAAAAAAAAGGGAGGGGGCAGG - Intergenic
957824956 3:85429699-85429721 CATAGTAAAATGGAGGAGGTTGG + Intronic
957883084 3:86247995-86248017 AAAAAAAAAAAGGAGGAGGCCGG + Intergenic
958041550 3:88231888-88231910 CAGATTAAAGGGGAAGAGGAAGG - Intergenic
958812118 3:98872552-98872574 CAGAATAAAACTGAGGAAACTGG + Intronic
959502923 3:107127247-107127269 CAGAATGAAAGGGTGGAGAAAGG - Intergenic
959769586 3:110076653-110076675 GAGAATAAAAGTGAGGAGACAGG - Intergenic
960243300 3:115371180-115371202 AAGAAGAAAAGGAAGGAGGTAGG - Intergenic
961699331 3:128729946-128729968 CAAAAAATAAGGGGGGAGGCGGG - Intronic
962010095 3:131383569-131383591 CATATAAACAGGGAGGAGGCAGG - Intronic
962464343 3:135642744-135642766 GAGAGAGAAAGGGAGGAGGCAGG - Intergenic
962723941 3:138203560-138203582 TAGAGAAAAAGGGAGGGGGCAGG + Intronic
963105318 3:141642108-141642130 AAGCATAAGAGAGAGGAGGCCGG + Intergenic
963445126 3:145395641-145395663 CAGAATAATACGGAGTTGGCTGG + Intergenic
963524308 3:146396988-146397010 CATCATAACAGGAAGGAGGCAGG - Intronic
963834003 3:150037831-150037853 AAGAAAGAAAGGAAGGAGGCAGG + Intronic
963886009 3:150583304-150583326 TATAATAAAAGGGGGAAGGCTGG - Intronic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
964769763 3:160212009-160212031 AAGAATCAAAGGCAGGGGGCAGG + Intergenic
966816355 3:183893088-183893110 CAGGATCAAAGACAGGAGGCTGG + Intergenic
968426441 4:526538-526560 CTGAGTTAATGGGAGGAGGCAGG + Intronic
968441702 4:627693-627715 CAGAAAAGGAGGGAGGAGGGTGG - Intronic
969387779 4:6867312-6867334 CAGAGTAGAAGGACGGAGGCAGG + Intronic
969454890 4:7295146-7295168 GAAAATAAAAGGGAGGAGGAGGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969989938 4:11252099-11252121 CAGAGTAAAAGGGCTGAGGAGGG - Intergenic
971024270 4:22572546-22572568 AAGAATATAAAGTAGGAGGCCGG - Intergenic
971136547 4:23874814-23874836 GAGAAAGAAAGGGAGGAGGTAGG - Intronic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
972337906 4:38124296-38124318 CAGAATAAGAGGGAGGGCACCGG - Intronic
972687462 4:41364869-41364891 AATAATAAAAGGGAGGAAGAGGG - Intronic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
974137067 4:57832223-57832245 AATAGTAAAAAGGAGGAGGCAGG - Intergenic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
975639757 4:76488580-76488602 AAGAATTAAATGGAGGATGCTGG - Intronic
975691480 4:76968414-76968436 CCGAAAAGAAGGGAGGATGCTGG - Intronic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
976810180 4:89092046-89092068 CAAAAAAAAAGGAAGGAGCCGGG + Intronic
977034245 4:91929473-91929495 GAGAATAAAAGGGCGGGGGGGGG - Intergenic
977135284 4:93296140-93296162 CACAATAAACTGGAAGAGGCAGG - Intronic
978318137 4:107463075-107463097 CAAAATCAAAGTGAGGATGCTGG + Intergenic
978393070 4:108247912-108247934 CAGAGTCAAAGGAAGGGGGCAGG + Intergenic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
981117104 4:141004439-141004461 CAGAAGAAAAATGAAGAGGCAGG + Intronic
982448167 4:155519125-155519147 AAGAAACAAAGGGAGGAGGGGGG + Intergenic
982501308 4:156159707-156159729 CAGAAACAAAGGGAAAAGGCAGG + Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983574992 4:169251433-169251455 TATAATAAAAGGGATGAGGATGG - Intronic
984616442 4:181903872-181903894 CAGAATGAAAAAGAAGAGGCAGG - Intergenic
985572720 5:658343-658365 CAGCAGCAAGGGGAGGAGGCCGG - Intronic
987619992 5:20328392-20328414 GAGAGTAAAAGAGAGGAGTCTGG + Intronic
988146577 5:27316521-27316543 GAAAATAAAAAGGAGGAAGCAGG + Intergenic
989325190 5:40184909-40184931 AAGAAAAAAAGGAAGGAGGGAGG + Intergenic
989482440 5:41947635-41947657 AAGCATTAATGGGAGGAGGCAGG + Intergenic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990435215 5:55783610-55783632 CAGACCAAAAGGAAGGAGGGAGG + Intronic
990582772 5:57181345-57181367 AAGAATTAAAGAGATGAGGCCGG + Intronic
990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG + Exonic
991000029 5:61773333-61773355 CAGAACAAAAGGGTGAAAGCAGG - Intergenic
992381672 5:76243632-76243654 CAGAATCAAAGAGAGCAGGCAGG - Intronic
992956525 5:81915158-81915180 CATAAGACAAGAGAGGAGGCAGG + Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993378900 5:87183170-87183192 CAGAGTAAAGGGGATGAGGAGGG + Intergenic
994815394 5:104580211-104580233 CAGAATAAAGGGGAAGATGTAGG - Intergenic
994987150 5:106950787-106950809 CAGAATAAAAGGAGAAAGGCGGG - Intergenic
995261744 5:110112242-110112264 AAGAAGAAAAGGGATGAGGGTGG + Intergenic
995470602 5:112498088-112498110 CAGAAGAAAGGGGAGAAGGAAGG - Intergenic
995579154 5:113575799-113575821 AAGAATAGAAGAGTGGAGGCAGG + Intronic
996647567 5:125834878-125834900 CAGAAGAAAAGGGAGCAGCCAGG + Intergenic
996855505 5:128001649-128001671 AAAAATAAAAAGGAGGAGGAAGG + Intergenic
998506227 5:142674864-142674886 CAGAATAAGAGGGAGAGGCCTGG + Intronic
998534117 5:142913421-142913443 GAGAAGGAAAGGAAGGAGGCAGG - Intronic
998662755 5:144258960-144258982 CATAAAAAAAGGGATGAGGCCGG + Intronic
999146720 5:149400905-149400927 TAGAACAAAAGGGTGGAGGAGGG - Intronic
999243040 5:150138553-150138575 CAGTCTGAAAGGGAGGAGGGAGG - Intronic
999429153 5:151511093-151511115 CTGGAGAACAGGGAGGAGGCTGG + Intronic
999513695 5:152279300-152279322 CAGAATAAAAGGAAGTAAGCAGG - Intergenic
999665332 5:153906829-153906851 CAGAAAAAAAGAGAGGAAGCAGG - Intergenic
1000410205 5:160929548-160929570 CAGAAGCCAAGGGAGGAGGGTGG - Intergenic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1000543538 5:162570331-162570353 CAGGATAAAAGGAAGAAGCCAGG + Intergenic
1001013211 5:168117259-168117281 AAAAAGAAAAGGGAGCAGGCAGG - Intronic
1001079411 5:168656115-168656137 AAAAATAAAAAGGAGGAGGAGGG - Intergenic
1001563114 5:172683133-172683155 AAGAAGAGAAAGGAGGAGGCAGG + Intronic
1002370740 5:178752053-178752075 AAGAAGAAAAGGAAGGAAGCAGG - Intergenic
1002537447 5:179885095-179885117 AAGAATAGAAGCAAGGAGGCCGG - Intronic
1002833455 6:845239-845261 CAGAGTAAGAGGGAGGATGCAGG + Intergenic
1003590855 6:7435490-7435512 CAGAGACAAAGGGAGGAGGCAGG + Intergenic
1003669612 6:8144465-8144487 GAGAAAGAAAGAGAGGAGGCCGG + Intergenic
1003938699 6:11002503-11002525 CACAATCAAAGAGAGGAGACTGG + Intronic
1004021704 6:11781552-11781574 AAGAATAAAAGGGACTCGGCCGG - Intronic
1004161834 6:13221164-13221186 CAGGAGCAGAGGGAGGAGGCAGG + Intronic
1004490466 6:16110188-16110210 CAGAATAAAAGCCAGAAAGCTGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005890804 6:30136264-30136286 CAGTATCTAAGGGAGGTGGCAGG + Intronic
1006209423 6:32382659-32382681 CAGAATAAAGGTGAGGGGGTAGG + Intergenic
1006997343 6:38273818-38273840 CAGAATAAAGGAGAAGAGTCAGG + Intronic
1007370794 6:41425949-41425971 CAGACTAAGAGGGAGAAGGGAGG + Intergenic
1008496518 6:52139460-52139482 CAGAATAAAATGGTGGGGGTGGG + Intergenic
1008637565 6:53425983-53426005 CCACATAAAAGGAAGGAGGCTGG + Intergenic
1009284349 6:61797019-61797041 CAGAATAAAACGAAGTAGTCTGG + Intronic
1009323483 6:62320047-62320069 CAGAATAAAAAAGGTGAGGCAGG - Intergenic
1009798182 6:68498842-68498864 CAGAAAACAATGGAGGAGGAAGG - Intergenic
1011497931 6:87954538-87954560 CAGAATACAAGGGAGTGGGATGG + Intergenic
1011775431 6:90725325-90725347 GGGAAGAAAAGGGAGAAGGCTGG + Intergenic
1012254639 6:97017486-97017508 CAGAACAAAGGTGAGGAGTCAGG + Intronic
1012817228 6:104039445-104039467 CTAGATAAAAGGGAGGAGGGAGG + Intergenic
1013048612 6:106511404-106511426 AAAAATAAAAGGGATGAGGAGGG - Intergenic
1013350528 6:109301795-109301817 CTGAAGAAAAGGCAAGAGGCAGG + Intergenic
1013649273 6:112177635-112177657 CAGAAGAAAAGGAAGGAGCGGGG - Intronic
1014130780 6:117829771-117829793 CAGAGACAAAGGGAGGAGGTGGG + Intergenic
1014262290 6:119232823-119232845 CAGAGTAAAAGAGAAGAGGCAGG - Intronic
1014809227 6:125866714-125866736 CATTATAAATGAGAGGAGGCTGG - Intronic
1015475321 6:133653896-133653918 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1015893714 6:137995893-137995915 CAGATTGAAAAGGAAGAGGCAGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017029712 6:150210483-150210505 CGGGATAACAGGGAGGAGGCAGG - Intronic
1017064940 6:150519840-150519862 ACGATTAAAAGGGAGGATGCAGG + Intergenic
1017089162 6:150743221-150743243 AAAAATAAAAAGGAAGAGGCTGG + Intronic
1017100753 6:150847924-150847946 CAGAATAAAAGACAGGAAGTGGG - Intergenic
1017923558 6:158891516-158891538 AAAAATAAAAGGATGGAGGCTGG - Intronic
1018290960 6:162292258-162292280 CAGAATAACTTGGAAGAGGCCGG - Intronic
1019083631 6:169454152-169454174 AGAAATAAAAGAGAGGAGGCAGG + Intergenic
1019797591 7:3063305-3063327 GAGGAGAAAGGGGAGGAGGCTGG - Intergenic
1021159267 7:17251559-17251581 AAGAATAAAAGAGAGGGGGCAGG - Intergenic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1022038336 7:26555161-26555183 CAGAAGTAAAGTGAGGATGCCGG - Intergenic
1022887495 7:34661579-34661601 CAGAATTCAAGGGTGGAGGTGGG - Intronic
1023108428 7:36786006-36786028 CAGAATACAGGAGAGGAGACAGG + Intergenic
1023633888 7:42189653-42189675 AAGAATAAAGGGGAGGAAACAGG + Intronic
1023805072 7:43867091-43867113 CAGAAGAAAAGAGAAGAGGCTGG - Intronic
1024278872 7:47701507-47701529 AAGAAGAAAAGGAAGGAGGGAGG + Intronic
1025955499 7:66179603-66179625 AAGAATAAGAGTGAGTAGGCCGG + Intergenic
1025975223 7:66364331-66364353 CAAAATAAAAAGGAGGAAGATGG + Intronic
1026285041 7:68955400-68955422 CAGAGAAAAGGGGAAGAGGCAGG + Intergenic
1028285177 7:88987901-88987923 GGGAAGAAAAGGGAGGAGGAGGG - Intronic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1028484291 7:91341195-91341217 CAGAATCTAAGGGAGGAGCATGG + Intergenic
1028650023 7:93140678-93140700 CAGAAGAAAAGTGAAGACGCAGG - Intronic
1028650325 7:93143599-93143621 CAGAAGAAAAGTGAAGAAGCAGG - Intronic
1029161858 7:98558216-98558238 CAGAAAAAAAGGGAGGGAGGAGG - Intergenic
1029273547 7:99391340-99391362 AAGAAAAAAAGGAGGGAGGCAGG - Intronic
1031370596 7:120960263-120960285 CAGCATGAAAGGAAGCAGGCAGG + Intronic
1032036443 7:128524972-128524994 CAGGATAAAAGCCAGGAGGCCGG + Intergenic
1032248456 7:130232629-130232651 GAAAAGAAAAGGGAGGAGACAGG - Intergenic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1032748791 7:134815013-134815035 GAGAATAAAGGGTAGGAAGCAGG - Intronic
1034436635 7:151065725-151065747 CAGGATGGCAGGGAGGAGGCTGG + Intronic
1035370768 7:158377535-158377557 CAGAGTGCTAGGGAGGAGGCAGG + Intronic
1035474776 7:159135524-159135546 GTTAATAAATGGGAGGAGGCCGG + Intronic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036570941 8:9979450-9979472 GAGAATAGAACAGAGGAGGCTGG - Intergenic
1037136513 8:15469047-15469069 CAGAATAAAAACGAGAAGGCTGG + Intronic
1037247741 8:16855896-16855918 CAGAAGAAAATGGAAGAGGATGG - Intergenic
1037542460 8:19885583-19885605 AAGAAGGAAAGGGAGGAGGGAGG - Intergenic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1037857722 8:22383710-22383732 CAGGAGAGAAGGGCGGAGGCAGG - Intronic
1037917202 8:22779805-22779827 AAGAATAAATGGGAGGAAACAGG + Intronic
1038332074 8:26616864-26616886 TGGAATAGAAGGGAGGAGGGAGG - Intronic
1038421457 8:27436612-27436634 GAGAATACAAAGGGGGAGGCGGG + Intronic
1038486892 8:27942255-27942277 CACAATCATAGGGAGGAGGTGGG - Intronic
1038542070 8:28398256-28398278 CAGTATAAGAGGGAGAAGGCTGG - Intronic
1039442806 8:37607076-37607098 CAGAGTGAAAGGGAGGGGCCAGG + Intergenic
1041006315 8:53499814-53499836 TAGAATATAGTGGAGGAGGCCGG - Intergenic
1041071711 8:54131782-54131804 GAAAATAAAAGGGAATAGGCTGG - Intergenic
1041334991 8:56772121-56772143 GAGAATTAAAGGGTGGAAGCAGG + Intergenic
1041350340 8:56942039-56942061 CAGAGTAAAATGGAGTAGGTTGG + Intergenic
1041996117 8:64060423-64060445 CAGAGACAAAGGGAGGAGTCAGG + Intergenic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1043789031 8:84439322-84439344 CAGAAAAAAAGGGAGCAAGCTGG - Intronic
1043980970 8:86638932-86638954 GAGAAGGAAAGGGAGGAGGGGGG - Intronic
1044506312 8:93024194-93024216 GAGAATAAAAGTGGGGAAGCAGG + Intergenic
1045135960 8:99218719-99218741 CAGAATGAATGGGAGGTGGGTGG + Intronic
1045832345 8:106478005-106478027 CAGAATAAAAGGGAGTAAAAGGG + Intronic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1046368935 8:113274853-113274875 AAGAAAAAAAGGAAGGAAGCAGG + Intronic
1046780834 8:118213016-118213038 AAGCATAAAAGGGTGGAGGGAGG + Intronic
1047680713 8:127251654-127251676 TAGAAAAAAAGGGAGGAGTCAGG - Intergenic
1047707763 8:127517809-127517831 CAGAAGGCAAAGGAGGAGGCAGG - Intergenic
1047724506 8:127672201-127672223 TCAAATAACAGGGAGGAGGCTGG - Intergenic
1047731669 8:127733964-127733986 AAGAATAACAAGGAGGTGGCTGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048328135 8:133454147-133454169 CAGAGTGACAGGGAGGCGGCAGG + Intergenic
1048976246 8:139674571-139674593 CACAGCAAAAGGGAGGAGCCGGG + Intronic
1049255182 8:141609980-141610002 CAGGAGCAGAGGGAGGAGGCGGG - Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1050084647 9:1951776-1951798 AACAAGAAGAGGGAGGAGGCAGG + Intergenic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1053688854 9:40569829-40569851 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054275183 9:63061245-63061267 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1054300094 9:63370746-63370768 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054399648 9:64703695-64703717 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054433231 9:65187956-65187978 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054497152 9:65833713-65833735 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1055392068 9:75833653-75833675 AAGAATAAAGTGGATGAGGCTGG - Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056313441 9:85366106-85366128 TAGTTTAACAGGGAGGAGGCTGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056688118 9:88783536-88783558 AAGAAGAAAATGGAGGAGGAGGG + Intergenic
1057062585 9:92018865-92018887 AAGAATAAAAGGGAATGGGCTGG + Intergenic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057462098 9:95272237-95272259 CTCAATAAAAAAGAGGAGGCGGG - Intronic
1058545322 9:106054919-106054941 CAGAAGCAAAGGGAAGAGACAGG - Intergenic
1058661198 9:107270940-107270962 AAAAATAGAAGGGAGGAAGCAGG - Intergenic
1059280588 9:113130098-113130120 AAGAACAAAAGGGTGGAGACAGG + Intergenic
1059377500 9:113896810-113896832 CATAATAAAATGTAGCAGGCAGG - Intronic
1060166945 9:121425223-121425245 TAGAAACAAAGAGAGGAGGCAGG + Intergenic
1060236001 9:121863037-121863059 AAGAAAGAAAGGGAGGAGGGAGG - Intronic
1060491852 9:124091011-124091033 CAGAAGAAAGGGGAGGGTGCTGG + Intergenic
1061268793 9:129524453-129524475 AAAAAAAAAAGGGTGGAGGCAGG - Intergenic
1061371361 9:130199391-130199413 CAGATAAAAAGAGAGGAGGCAGG - Intronic
1061486543 9:130923317-130923339 CAGAAGAAAAAGGAGGAGTGTGG - Intronic
1062314978 9:135962582-135962604 CAGAATAAAAGCCTGCAGGCAGG - Intergenic
1203350265 Un_KI270442v1:75813-75835 TAGAATAAAATGGAGTAGACTGG + Intergenic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1185671220 X:1811608-1811630 CAGCAGAAAAGGAAGGTGGCAGG + Intergenic
1185840580 X:3386465-3386487 CAGAAAAAAAGGGGGGCTGCAGG + Intergenic
1186410713 X:9342600-9342622 AAGACTAAGAGGGAGGAGGGAGG - Intergenic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1186833536 X:13415080-13415102 CAGAAGATAACGAAGGAGGCTGG - Intergenic
1187187954 X:17005468-17005490 CAAAATAAAAGGGGGAAGGGAGG - Intronic
1187556705 X:20358752-20358774 TAGAACAAAAGGGTGGAGGAAGG - Intergenic
1188922530 X:35995112-35995134 CAGATTAAAAGGATGGAAGCGGG + Intergenic
1189240954 X:39523983-39524005 TAGAACAAAAGGGTGGAGGGAGG - Intergenic
1189565252 X:42235016-42235038 CAAAATTCAAGGGAGGGGGCCGG - Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1190328788 X:49223140-49223162 CAGCAGAAATGGGAGGGGGCAGG + Intronic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1191871114 X:65746269-65746291 CAGAATGAAAGGCAGGAGATTGG - Intergenic
1192538271 X:71947127-71947149 CAGAATGGAAGGGAGGAGAGGGG - Intergenic
1192597917 X:72431073-72431095 CAGACAAACAGGGAGAAGGCAGG - Intronic
1192861756 X:75080918-75080940 TAGAATAAAAGGCAGTAGACTGG - Intronic
1195914281 X:109920707-109920729 CAGAATAAACTGGAGAAGGGGGG - Intergenic
1196200207 X:112878231-112878253 CAGAATAAAAGGTTGGCTGCAGG - Intergenic
1196308967 X:114138485-114138507 CAGAATAAAAGCTTGGAGCCAGG + Intergenic
1196361976 X:114872155-114872177 GTGAATAAATGGGAGGAGGAAGG - Intronic
1196938359 X:120751649-120751671 CAGAAGTTCAGGGAGGAGGCAGG - Intergenic
1197221729 X:123921064-123921086 AAGAAAAAAAGAAAGGAGGCCGG - Intergenic
1197860886 X:130969039-130969061 GAGGAAAAAAGGGTGGAGGCAGG - Intergenic
1198031155 X:132754710-132754732 CAAAAAAAAAGGGTGCAGGCCGG - Intronic
1198642204 X:138768820-138768842 CAAAATAAAACGAAGTAGGCTGG - Intronic
1198883884 X:141312174-141312196 CAAAATCAAAGGCAGGAGGAAGG + Intergenic
1199192673 X:144989685-144989707 CAGAATAACAGCTAGGAAGCAGG + Intergenic
1199567611 X:149231707-149231729 CAGAATACAAGGTAGGAGGGAGG + Intergenic
1200691700 Y:6311843-6311865 CAGAAAAAAAGAGAGGGGGCTGG - Intergenic
1201043572 Y:9862880-9862902 CAGAAAAAAAGAGAGGGGGCTGG + Intergenic
1201117879 Y:10848411-10848433 AAGAATAGAATGGAGGGGGCTGG - Intergenic
1201562864 Y:15336088-15336110 AAAAATAAAAGGGAGTAGTCTGG - Intergenic
1201623496 Y:15986781-15986803 CAGAAAACAAGTGGGGAGGCAGG + Intergenic