ID: 1165411338

View in Genome Browser
Species Human (GRCh38)
Location 19:35664056-35664078
Sequence CTAGATTTCCAAGAATATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165411334_1165411338 16 Left 1165411334 19:35664017-35664039 CCTGGGCATGCACACAACCCTAT No data
Right 1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG No data
1165411333_1165411338 28 Left 1165411333 19:35664005-35664027 CCTGCATATACTCCTGGGCATGC No data
Right 1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG No data
1165411336_1165411338 -2 Left 1165411336 19:35664035-35664057 CCTATGCATGCATGTGACCTTCT No data
Right 1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG No data
1165411335_1165411338 -1 Left 1165411335 19:35664034-35664056 CCCTATGCATGCATGTGACCTTC No data
Right 1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165411338 Original CRISPR CTAGATTTCCAAGAATATTT TGG Intergenic
No off target data available for this crispr