ID: 1165412059

View in Genome Browser
Species Human (GRCh38)
Location 19:35668140-35668162
Sequence CACTGTCAAGGGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 337}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165412053_1165412059 -4 Left 1165412053 19:35668121-35668143 CCTCCTCGGGGAATAACAGCACT 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337
1165412046_1165412059 11 Left 1165412046 19:35668106-35668128 CCATGGCCATGTTCCCCTCCTCG 0: 1
1: 1
2: 2
3: 17
4: 219
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337
1165412052_1165412059 -3 Left 1165412052 19:35668120-35668142 CCCTCCTCGGGGAATAACAGCAC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337
1165412054_1165412059 -7 Left 1165412054 19:35668124-35668146 CCTCGGGGAATAACAGCACTGTC 0: 1
1: 0
2: 1
3: 5
4: 190
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337
1165412044_1165412059 30 Left 1165412044 19:35668087-35668109 CCATTTGTAATGTTTATGGCCAT 0: 1
1: 0
2: 1
3: 23
4: 226
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337
1165412050_1165412059 5 Left 1165412050 19:35668112-35668134 CCATGTTCCCCTCCTCGGGGAAT No data
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337
1165412051_1165412059 -2 Left 1165412051 19:35668119-35668141 CCCCTCCTCGGGGAATAACAGCA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165412059 Original CRISPR CACTGTCAAGGGAGGGCAGA TGG Intronic
900417946 1:2543620-2543642 CACAGGCGAGGGAGGGCTGAGGG - Intergenic
900832816 1:4977335-4977357 CACTGCCCAGGGAGTGCTGAAGG - Intergenic
900966837 1:5964656-5964678 CACTGGCCAGGGAGTGGAGAAGG - Intronic
901551051 1:9996666-9996688 CACATTCAAGGTAGGGAAGAGGG - Intergenic
901642252 1:10698690-10698712 CCCTGGCAGGGGAGGGCTGAGGG + Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
902515452 1:16987274-16987296 CACAGGGAAGGGAGGACAGAGGG + Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905879366 1:41453678-41453700 AAGTGTCAAGGTATGGCAGAAGG + Intergenic
905907123 1:41626540-41626562 AACTGTCCAGGGAGTACAGATGG - Intronic
906561474 1:46761150-46761172 CAGTATCAAGGGAGGGTGGAGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
908710590 1:67010099-67010121 CACTTTCAAGTGAGAGCAGGTGG - Intronic
909894518 1:81050502-81050524 CACTTTCAAGAGTGGTCAGAAGG + Intergenic
910486295 1:87718121-87718143 TACTGGCAAGGAAGGGAAGATGG + Intergenic
913110878 1:115656116-115656138 CACTGTCAAGTGAGAGATGAAGG - Intronic
914384420 1:147154023-147154045 AATTGTCAAGGCAGGGGAGAAGG + Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915732456 1:158063706-158063728 AACTGTCCTGGGAAGGCAGAGGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917046565 1:170867040-170867062 CATTGTCAACCGAGGGCACATGG - Intergenic
918789870 1:188812825-188812847 GCCTGTCAGGGGAGGGCAGCTGG + Intergenic
919367636 1:196684430-196684452 CACTGTCAATGTAGATCAGAAGG + Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
921880260 1:220247518-220247540 CACTTACAAGGGAGGACATACGG - Intronic
922320160 1:224479991-224480013 CACTGTTAGGGCAGTGCAGAAGG - Intronic
922847177 1:228695854-228695876 CAATCTCCAGGGAGGGAAGAGGG - Intergenic
922939289 1:229447589-229447611 CAATATCCAGGGAGGGAAGAGGG + Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923330934 1:232923977-232923999 GGCTGTAAAGGGAGGGAAGATGG + Intergenic
923625437 1:235610139-235610161 CAAAGTCAAGGAAGGGCTGAGGG - Intronic
924037346 1:239950661-239950683 CACTGCCGAGGGAGGGAGGAAGG - Intergenic
924258473 1:242205770-242205792 CACTGAGCAGGGATGGCAGATGG + Intronic
924286749 1:242494947-242494969 CACTTTCAAGGGAGGACTTAGGG - Intronic
924574083 1:245263305-245263327 CACTCGGAAGGGAAGGCAGAGGG + Intronic
1062823337 10:550940-550962 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823354 10:551022-551044 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG + Intergenic
1068004177 10:51373592-51373614 GACTGTCAGGGGAGGGTAGGGGG - Intronic
1071078597 10:81783685-81783707 CAATCTCAGGGGAGGGGAGAGGG - Intergenic
1071483376 10:86081014-86081036 CACTGACAAGGGAGAGGAGGAGG + Intronic
1072281972 10:93873881-93873903 CTCAGTCAGGGGAGGTCAGAGGG + Intergenic
1073434537 10:103508226-103508248 TTCTGTCATGGGAGGGGAGAGGG - Intronic
1074242153 10:111650219-111650241 CTCTGCTAAGGCAGGGCAGAAGG + Intergenic
1074933282 10:118151506-118151528 CAATGTTAAAGGAGAGCAGATGG - Intergenic
1076059152 10:127400060-127400082 CAGTGTCCAGGGAGGGTAGGAGG - Intronic
1076492480 10:130872053-130872075 CAACATCAAGGGAGGGGAGAGGG - Intergenic
1076674142 10:132139685-132139707 CCCTGTGAAGGGAGGACACAGGG + Intronic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076852132 10:133098481-133098503 CCCGGTCAGGGGAGAGCAGATGG - Intronic
1077366662 11:2163975-2163997 CAGTGTCAGGGAAGGGCGGAGGG + Exonic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1079239731 11:18714074-18714096 CACTGTGAAGGTAGGCCACACGG - Exonic
1083572242 11:63766973-63766995 CCCTGTAAAGGGATGGCAGGAGG + Intronic
1083588047 11:63874665-63874687 ACCTGTCAAGGGAGGGGAGGGGG - Intronic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084064961 11:66698809-66698831 CATTTCCAAGGGAGGGGAGAGGG + Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085305169 11:75481718-75481740 CCCTGTCTAGGGAGTGCACAGGG - Intronic
1085334644 11:75682314-75682336 GCCTGTCAAGGGAGGGCGGTGGG - Intergenic
1085512317 11:77094599-77094621 CCCTCCCAAGGGATGGCAGAAGG - Intronic
1085562646 11:77486571-77486593 CACTGCCAGGGGATGGAAGAGGG - Intergenic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1088316387 11:108511049-108511071 CACAGCCTAGGGAAGGCAGAGGG - Exonic
1089461092 11:118654229-118654251 CCCTGTCAAGGGAAAGCACAGGG - Intronic
1089996739 11:122915422-122915444 GACTGTCCAGGGAAGTCAGAGGG + Intronic
1091519035 12:1217467-1217489 CACTGTCTAGGAATGGCAGCAGG - Intronic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1092431047 12:8409203-8409225 CACTTTCAAGTGAGTGCTGAGGG - Intergenic
1093317345 12:17667363-17667385 CCCTGTCAAGGGAGATCAGATGG - Intergenic
1094419665 12:30257415-30257437 CACTGTCAGGGGATGGGGGAGGG - Intergenic
1097054458 12:56241420-56241442 CCTTGTCAAGGGTGGGCTGAGGG - Exonic
1097152176 12:56987209-56987231 CCCTGACAGGGGAGGGCAGAGGG - Intergenic
1100290085 12:93205472-93205494 CACTGTTAAGGGAGGGGAACAGG - Intergenic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1103566067 12:121816267-121816289 CACGGTCGAGGGAGGGGAGCAGG - Intronic
1103980900 12:124736369-124736391 CACCTTCATGGCAGGGCAGAGGG - Intergenic
1104931222 12:132340487-132340509 CACTGCCAAGGGAGGGCGGGAGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105899562 13:24743521-24743543 CCATGTCAAGGGTGGGCAGGTGG + Intergenic
1105940760 13:25146024-25146046 CAATCTCCAGGGAGGGGAGAGGG + Intergenic
1106350228 13:28922688-28922710 CACTGTCAAGAGATGGGAGACGG + Intronic
1106631023 13:31473679-31473701 CAATCTCCAGGGAGGGAAGAAGG + Intergenic
1106987902 13:35377298-35377320 CACTGTCTAGGGATTGCAAAGGG + Intronic
1107398771 13:40048138-40048160 CATTCTCAAGGGAGGGGTGAAGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1108074793 13:46668616-46668638 CATTGTCAGGAGAGGGCAGTTGG + Intronic
1108415842 13:50197429-50197451 GAATGTCAAGGGTGAGCAGAAGG + Intronic
1110931852 13:81229044-81229066 CACATTCAAAGGAGGGGAGAGGG + Intergenic
1113898505 13:113782617-113782639 CACTGACAACGGAGGACTGAGGG - Intronic
1113943732 13:114032582-114032604 CGGTGTCAAGTGAGGGCTGAAGG - Intronic
1116062926 14:39947123-39947145 CACTATCAGGGGATGGGAGAGGG + Intergenic
1116312080 14:43340546-43340568 GCCTCTCATGGGAGGGCAGAGGG - Intergenic
1117110251 14:52446201-52446223 CACTGCCAGGGGATGGGAGAAGG - Intronic
1117751249 14:58925700-58925722 CTCTGTCAAGGCAGGGCTGTTGG - Intergenic
1119899201 14:78245400-78245422 CAAGATCAAGGGAGGCCAGATGG + Intronic
1121467870 14:94127681-94127703 CCCTGTCATGGAGGGGCAGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121752055 14:96365207-96365229 CAATGTAAAGGGAGTGGAGATGG + Exonic
1202922885 14_KI270724v1_random:2084-2106 CCCTCTCAAGCGAGGCCAGAGGG - Intergenic
1123904319 15:24906949-24906971 GGCTGGCAGGGGAGGGCAGAGGG + Intronic
1124825046 15:33085334-33085356 CACTGTCCAAAGAGGGGAGAAGG + Intronic
1126197750 15:45950751-45950773 GCCTGTCAGGGGAGGGCAGGAGG - Intergenic
1127405381 15:58638854-58638876 AACTGTCAGGGGAGGGAGGAAGG + Intronic
1127998470 15:64169535-64169557 GCCTCTCAAGAGAGGGCAGAGGG - Exonic
1128474758 15:67987784-67987806 AGCTGTCAAGGGAGGCCAGGAGG + Intergenic
1128599655 15:68985227-68985249 CTATGTCAGAGGAGGGCAGATGG + Intronic
1129803857 15:78438226-78438248 GACTGGCAAGGGAGGAAAGAAGG - Exonic
1130316318 15:82800004-82800026 GAATGTCCAGGGAGGGCAGAGGG - Intronic
1131626073 15:94122189-94122211 GGCTGTCAGGGGAGGGCAGGGGG - Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1131981358 15:97997857-97997879 TGCTGTCAAGGTTGGGCAGAAGG + Intergenic
1132292931 15:100715741-100715763 GACGGTCAAGGGAGGGGTGATGG - Intergenic
1132413054 15:101600083-101600105 CAGTGTCAATGGAGGCCAGAAGG - Intergenic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133814618 16:9187123-9187145 AAGTGTCAAGGGTAGGCAGATGG + Intergenic
1133881170 16:9783895-9783917 CACTTTCAAGGGAGAGCTAAAGG + Intronic
1138229605 16:55327455-55327477 CACTGCCAAGGTAGGGTGGATGG + Intronic
1139852656 16:69960352-69960374 CACTGCCAGGGCAGGGCAGTGGG - Exonic
1139881627 16:70183260-70183282 CACTGCCAGGGCAGGGCAGTGGG - Exonic
1140370881 16:74412245-74412267 CACTGCCAGGGCAGGGCAGTGGG + Exonic
1140733318 16:77875823-77875845 CACTGTAAAGGGAGGTTAGGAGG + Intronic
1140914246 16:79480605-79480627 CACTATGGAGGGAGGGTAGAAGG + Intergenic
1141046462 16:80720018-80720040 CAGTGTCAAGGCATGGGAGAGGG - Intronic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141382687 16:83589953-83589975 AAATGTGCAGGGAGGGCAGAGGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1143027226 17:3948020-3948042 CACTCTCATGGGAAGGCAGCAGG - Intronic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143665993 17:8360975-8360997 CACTGAGAAGGAAGGGCAGTGGG - Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144698764 17:17323099-17323121 CCCTGTGAAGGCAGGGCAGGTGG + Intronic
1144825613 17:18104112-18104134 CACTGTGAGGGGAGGTCAGGAGG - Intronic
1145252216 17:21302853-21302875 CTCTGCCACGGGAGGGGAGATGG + Intronic
1147109622 17:38252407-38252429 CAGTGTAAAGGGAGGGGACAGGG + Intergenic
1147332474 17:39706969-39706991 CACTGGCAGGAGAGAGCAGATGG - Exonic
1148419827 17:47535660-47535682 CAGTGTAAAGGGAGGGGACAGGG - Intronic
1149223963 17:54447041-54447063 CACTGGCAAGGGAAGGTATAAGG - Intergenic
1149307622 17:55364295-55364317 TGATGTCAAGAGAGGGCAGAAGG + Intergenic
1152051395 17:77981325-77981347 CAATCTCCAGGGAGGGTAGAGGG - Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1153045660 18:853599-853621 GCCACTCAAGGGAGGGCAGAGGG + Intergenic
1154074154 18:11182774-11182796 CCCAGCCAAGGGAGGGCAGGTGG + Intergenic
1156286843 18:35705105-35705127 CACAGTAAAGGGAGGAAAGATGG - Intronic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157581100 18:48774618-48774640 CACTGTCAAGGGGGTGCTGGAGG - Intronic
1158658659 18:59364677-59364699 TACTGTCTTGGGAGAGCAGAAGG - Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160888722 19:1365643-1365665 CAGTGCCAAGGGAGGGCGGAGGG - Intronic
1161051710 19:2167407-2167429 CACTGGCCAGGCAGGGCAGCAGG - Intronic
1161294429 19:3512557-3512579 TACTTTCATGGGAGGGCACAAGG + Intronic
1161644220 19:5443408-5443430 CACAGTCCAGCGAGGGAAGAAGG + Intergenic
1161787150 19:6333761-6333783 CACTGTCCAGGCAGGGCAGGGGG + Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1163312178 19:16521237-16521259 CACTGGGAAGGGTGGGCTGAGGG + Exonic
1163644448 19:18480470-18480492 CACGGTCAGGGCAGAGCAGAGGG + Intronic
1164539133 19:29109202-29109224 CACTGTCAGGGGAGGGCCTTTGG + Intergenic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1165749603 19:38251990-38252012 CAGTGACAGGGGAGGACAGAGGG + Intronic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
925313150 2:2902246-2902268 AACTGCCAAGGGAGGGAAGGAGG + Intergenic
925349362 2:3190114-3190136 CACAGTCAAGGGAGGCGAGGTGG - Intronic
925591875 2:5517857-5517879 CATTGTCAAGAGAGGGTAGTGGG - Intergenic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
926389035 2:12368563-12368585 CACAGTCGGGGGAGAGCAGAGGG + Intergenic
926499902 2:13641215-13641237 ATCTGCCAGGGGAGGGCAGAGGG + Intergenic
928955403 2:36861916-36861938 GACTGTGAAGGGTGGGAAGAGGG - Intronic
930895559 2:56441469-56441491 CACTGCCAGGGGATGGGAGAGGG + Intergenic
931542470 2:63344629-63344651 CTCAGTCAAGGGATGGCAAATGG - Intronic
931808950 2:65835311-65835333 GACTGGAAAGGAAGGGCAGATGG + Intergenic
932040595 2:68295107-68295129 CCCTGTCATGGGAGGGGACAGGG + Intronic
932563074 2:72889046-72889068 TCCTGTCAAGGGAGGGAAGGAGG - Intronic
934576822 2:95407169-95407191 CAGTGACTAGGGAGGGCAGTGGG - Intronic
934639042 2:96015337-96015359 CAGTGACTAGGGAGGGCAGTGGG - Intergenic
934794606 2:97090075-97090097 CAGTGACTAGGGAGGGCAGTGGG + Intronic
934818417 2:97350746-97350768 CAGTTTCAAAGGAGGGCACAGGG + Intergenic
935087896 2:99866458-99866480 CACTGTCAAGGGACGCTGGATGG + Intronic
936050186 2:109216660-109216682 CACTGGCTAGAGAGGGCAGGAGG - Intronic
936072631 2:109381502-109381524 CACGCTGAAGGGAGGGCAGGTGG - Intronic
936298749 2:111288466-111288488 CAGTGGCAAGGCAGGGCGGAAGG - Intergenic
937315710 2:120930892-120930914 CACTGGCAAGGGAAGGAAGCAGG - Intronic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937560444 2:123218267-123218289 CACTATCAAGGGATGGGGGAGGG - Intergenic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
938720101 2:134059914-134059936 CCCTGTCAGGGGAGGGCAAGGGG - Intergenic
941589245 2:167398364-167398386 CACTATCAATGAAGGGAAGAAGG - Intergenic
942791419 2:179765695-179765717 CCCTAGCAAGGGTGGGCAGATGG - Intronic
945089941 2:206169205-206169227 CTCTGTCAGGGTAGTGCAGAAGG + Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945313812 2:208348137-208348159 CACTGACAAGTGAGAACAGAGGG - Intronic
947327778 2:228996685-228996707 CACTCACCAAGGAGGGCAGATGG + Intronic
948461919 2:238133977-238133999 CACTGCCCAGGGCTGGCAGAGGG + Intergenic
948510596 2:238461674-238461696 CACTGTCAGGGGTGGGCTGGTGG + Intergenic
1169808275 20:9581761-9581783 CATTGTCAAGGCACGGCTGACGG - Intronic
1170495912 20:16925020-16925042 CACTCTCAAGTGAAGGAAGACGG + Intergenic
1171097595 20:22346731-22346753 CACTGTCAAGGCATGGGAGTGGG - Intergenic
1171327702 20:24310304-24310326 CACTCTCAAGGCACTGCAGATGG - Intergenic
1173431362 20:42989687-42989709 TGCTGTCAAGGGAGGGAGGAGGG - Intronic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1177785762 21:25669524-25669546 CAATGTGAAGTGAGGGGAGAGGG + Intronic
1178958698 21:37044764-37044786 CAGTGACAAAGGAGGGCATATGG - Intergenic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1180092135 21:45538610-45538632 CACAGTGAGGGAAGGGCAGAGGG + Intronic
1181083124 22:20426995-20427017 CACAGTCAAGGGAGGAGACAGGG + Intronic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1182027780 22:27134088-27134110 CAGTCACCAGGGAGGGCAGAGGG + Intergenic
1183236377 22:36621724-36621746 CACTGGCAGGGGAGGACACAGGG - Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184837050 22:47029924-47029946 CACTGCCAATGGTGGGCAGAGGG - Intronic
952136095 3:30422310-30422332 CTATGTCAAGAGAGGGCAGCTGG + Intergenic
953472237 3:43177289-43177311 CACTGGCAATGCTGGGCAGAAGG + Intergenic
954249710 3:49358320-49358342 CACTGTAAGGGGAGGCCAGCAGG + Exonic
954393189 3:50278231-50278253 CACTGGGAAGGAAGGGCACAGGG + Intergenic
954619795 3:51989027-51989049 CACTGGCAAGGGCAGGCAGCAGG - Exonic
955031281 3:55222411-55222433 CAATGTCAGTGGAGGGCACATGG - Intergenic
955221453 3:57026628-57026650 CCCTGTCCAGGTAGGGTAGATGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956938574 3:74131785-74131807 CTCTGTTAGGGCAGGGCAGAGGG - Intergenic
958611477 3:96432031-96432053 CAATCTCCAGGGAGGGGAGAGGG + Intergenic
959851827 3:111096887-111096909 CTCTGTTAAGGCAGTGCAGAAGG + Intronic
960840919 3:121957859-121957881 CACTGCCAGGGGATGGGAGAAGG - Intergenic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961617433 3:128193869-128193891 CTCTGGCATGGGAGGACAGAAGG + Intronic
964233834 3:154501476-154501498 GACTGTCAAGGGAAAGCACAAGG + Intergenic
964727001 3:159823735-159823757 GCCTGTCAAAGGTGGGCAGATGG - Intronic
965145126 3:164890875-164890897 CACTGCCAAGGGATGGGGGAGGG + Intergenic
966626773 3:182025377-182025399 CACTCTCAGGGTAGGGCAAAAGG - Intergenic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
968521717 4:1037283-1037305 CCCTGCCCAGGGAGGGCAAAGGG + Intergenic
968819411 4:2838237-2838259 CACTGTGAGGGGAGGGCACTTGG - Exonic
969660887 4:8526761-8526783 CACTCCCCAGTGAGGGCAGAGGG - Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
970642321 4:18080814-18080836 CTCTGTCAAGTGAGGACACAAGG - Intergenic
970738559 4:19204230-19204252 CACTTTCAAGTGAGAGCAGGTGG - Intergenic
971060056 4:22957836-22957858 CACTGTCTGGGGATGGCAGTAGG + Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
975129230 4:70816067-70816089 GACTGCCAGGGGAGGGAAGAAGG + Exonic
975592915 4:76017916-76017938 CACTGCCAGGGGAAGGGAGAGGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
979464287 4:121018461-121018483 AATTGTAAAGGGAGGACAGAGGG + Intergenic
979666201 4:123313484-123313506 AACGGTCAAGGGAGGGCAGAGGG - Intronic
981674062 4:147320678-147320700 CACTGTCACAGGAAGGAAGAAGG - Intergenic
982064113 4:151637479-151637501 CACTGTTAAGGGTGAGCAGCAGG - Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983208833 4:164938141-164938163 GCTTGTCCAGGGAGGGCAGAAGG + Intergenic
983802701 4:171954784-171954806 CACTGTCAAGAGAGAAGAGAGGG - Intronic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984150472 4:176123818-176123840 CAATGTCCAGGGAGGGAAGAGGG - Intronic
985139297 4:186822277-186822299 CAATCTCCAGGGAGGGGAGAGGG - Intergenic
986101137 5:4612831-4612853 CACTGTTAAGGGGGCGCAGGTGG + Intergenic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
988078301 5:26382080-26382102 CACTACCAAGGGAGGGCCCAGGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989998511 5:50864139-50864161 CACTCTCAAGGGAGGGTGGGTGG + Intergenic
993036750 5:82767558-82767580 CACAATCAAGGAAGAGCAGAGGG - Intergenic
994089898 5:95800669-95800691 AAATGTGAAGGGAGGGCACAGGG - Intronic
994104095 5:95926315-95926337 TACTGACAGGGAAGGGCAGAGGG + Intronic
995662627 5:114501795-114501817 CACTCTGAAGGGATGGTAGATGG - Intergenic
995697922 5:114900442-114900464 CACTGCCAGGGGAAGGGAGAGGG + Intergenic
998374578 5:141682253-141682275 GCCCGTCGAGGGAGGGCAGAGGG - Intergenic
998393282 5:141801647-141801669 GACTGAAGAGGGAGGGCAGAGGG - Intergenic
998690251 5:144580208-144580230 GACTGACAATGAAGGGCAGATGG + Intergenic
998971107 5:147593418-147593440 CACTGTCAAAGGAGCTGAGAGGG + Intronic
1000185055 5:158851346-158851368 CGCTGTCAAGAAAGGGAAGAAGG + Intronic
1000674607 5:164105547-164105569 CTCTACTAAGGGAGGGCAGAGGG + Intergenic
1002040840 5:176513017-176513039 GACAGGCAGGGGAGGGCAGAAGG - Intergenic
1002405164 5:179024703-179024725 CCCTGTTAAGGCACGGCAGATGG + Intronic
1003348662 6:5294950-5294972 TACAGTCAAAGGAGGGCAGGAGG + Intronic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1007189196 6:39998869-39998891 CACTGTCAGGGAAGGGCACCGGG + Intergenic
1008957671 6:57233654-57233676 CCCTGTCAAGGGAGGGAGGGAGG - Intergenic
1008965549 6:57310807-57310829 CACTTTCCAGGCAGGGCAGCCGG + Intergenic
1012286444 6:97395448-97395470 CATTGTCAAGGAAGGGCAGATGG - Intergenic
1012822382 6:104102383-104102405 ACCTCTCAGGGGAGGGCAGAGGG + Intergenic
1013865449 6:114690884-114690906 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1014799309 6:125759693-125759715 TACTGACAAGGGCGGGCTGATGG - Exonic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1014974469 6:127862066-127862088 CACAGTCAAGGCAGGGAACAAGG + Intronic
1015063154 6:128992801-128992823 CAATGTCAAGGGAAGACAGAAGG - Intronic
1015101851 6:129490844-129490866 CACTGTTAAGGGGGTGAAGAAGG - Intronic
1015386763 6:132633536-132633558 CACTGTCCAGTGAGGGCAGAGGG + Intergenic
1016352148 6:143179134-143179156 CACTGTCAGGAGAGGGCTAATGG + Intronic
1017247291 6:152240127-152240149 CCAGGACAAGGGAGGGCAGAGGG + Intronic
1018062053 6:160097815-160097837 CACTGTTAAGGGTGGGCAGGGGG - Intronic
1018874104 6:167804664-167804686 ATCAGTCAAAGGAGGGCAGAAGG + Intergenic
1019415121 7:923573-923595 CACCCGCAGGGGAGGGCAGAGGG - Intronic
1019607126 7:1915570-1915592 CACAGTCAAGGAAGGACCGATGG + Intronic
1019621258 7:1993282-1993304 CACAGTGCAGGGAGGGCACAGGG + Intronic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1021852889 7:24825895-24825917 CACTGTCAAGGGTATGCAGGTGG + Intronic
1022045050 7:26616132-26616154 CACGGCCAAGGACGGGCAGAGGG + Intergenic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1023255693 7:38310416-38310438 AAATGACAAGGGAGGGAAGAGGG - Intergenic
1024814517 7:53253259-53253281 CACTGATGTGGGAGGGCAGAAGG + Intergenic
1028249681 7:88526192-88526214 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1028726656 7:94095704-94095726 CATTGACAAGGAGGGGCAGAGGG + Intergenic
1028920337 7:96303727-96303749 CACTGACATGGGAGGGCAGGAGG - Intronic
1029818534 7:103122429-103122451 CACAGACAAAAGAGGGCAGATGG + Intronic
1029887577 7:103889345-103889367 CACTGACAACAGAGGACAGAAGG + Intronic
1030222155 7:107108543-107108565 CAATGTCAAGGGGGAACAGAGGG + Intronic
1030712109 7:112761411-112761433 CACTGTCAGTGGAGTGCCGAGGG + Intergenic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031495330 7:122440213-122440235 ACCTGTCAATGGAGGGCAGGAGG + Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033315567 7:140294518-140294540 CACCGTCAAGGTAGGCCATATGG - Intronic
1035529822 8:342502-342524 CACTGTCATGGATGGGCAGTCGG - Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036686035 8:10910921-10910943 CACTCTCCAGGGAAAGCAGACGG - Intronic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1037319513 8:17630079-17630101 CACTCCCATGGGAGGGTAGAGGG + Intronic
1037581630 8:20249091-20249113 CACAGCCAGAGGAGGGCAGAGGG - Exonic
1037706012 8:21315863-21315885 CCCTGGCAAGGGCGGGCAGGAGG - Intergenic
1037710746 8:21353513-21353535 CACTGTCTGGGTAGGGCACATGG - Intergenic
1038767037 8:30438331-30438353 CATTGTACAGGGAGGACAGAAGG - Intronic
1039411693 8:37360277-37360299 AACTGTCAAGTGAGGGCACTTGG - Intergenic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1040466807 8:47702918-47702940 CAGTCTCAAGGGAGGGCAGGAGG + Intronic
1041636031 8:60145913-60145935 CACAGCCAAGGGAGAGCAGGTGG - Intergenic
1042114352 8:65414791-65414813 GACTGTCACAGGAGGGGAGAAGG - Intergenic
1042573924 8:70197395-70197417 CACCCTCAAGGGAGGCCAGTGGG - Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1045007120 8:97926231-97926253 CCCTGTCATGAGAGGCCAGAAGG + Intronic
1046351783 8:113024872-113024894 AAAGGTCAAGGGATGGCAGAGGG - Intronic
1046998936 8:120554316-120554338 CAGAGTCAAGGGTGGCCAGACGG - Intronic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1048001056 8:130379990-130380012 CACTGTCAGGGGTGGGGAGTAGG - Intronic
1051916622 9:22216728-22216750 CACTGCCAAGGAAGGGGGGAGGG - Intergenic
1052264802 9:26559579-26559601 CAATGTCAAGGGATGGGAAATGG - Intergenic
1053199144 9:36140976-36140998 CAATGTAAAGGCAGGGCAGGAGG + Intronic
1055979536 9:81988605-81988627 GAGTGGCAAGGTAGGGCAGAGGG + Intergenic
1056087071 9:83161060-83161082 CTCTGTCAGGGGAGTGCAGAAGG + Intergenic
1056840419 9:89994375-89994397 CACTGTCGGGGAGGGGCAGAGGG + Intergenic
1057788503 9:98106471-98106493 CACTCTCATGTGGGGGCAGATGG - Intronic
1058091380 9:100809624-100809646 GTCTGTCAGGGGAGGGCAGGGGG - Intergenic
1058868154 9:109180334-109180356 CACTGCCAAGGCTGGGCAGAAGG + Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060902633 9:127274128-127274150 ACCTGTCAATGGAGGACAGAAGG - Intronic
1061089536 9:128419300-128419322 CACTGCAAGGGGAGGGCTGAAGG - Intronic
1061796046 9:133086520-133086542 CACTGGCAAGTGAGGGAACAAGG - Intronic
1061858321 9:133455264-133455286 CACTGCCAAGAGAGGGGAGGAGG - Exonic
1062235164 9:135504438-135504460 CACGGTGAAGGGAGGGCTGCTGG - Exonic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1185633811 X:1536863-1536885 CACTGTCAAGGGAGAAGACAGGG - Intronic
1185636019 X:1552620-1552642 CACGGTAAAGTGAGTGCAGACGG + Intergenic
1185953103 X:4458192-4458214 AACTCTCGAGGGAGAGCAGAGGG - Intergenic
1187474896 X:19602071-19602093 CACTTTCAGGGTGGGGCAGATGG - Intronic
1187518350 X:19991750-19991772 CAGTGACAAGGGAGGGCAAAAGG - Intergenic
1188082876 X:25866100-25866122 CTCTGTCAAGCCATGGCAGAAGG + Intergenic
1190699779 X:52979161-52979183 CACCGTAAGGGTAGGGCAGAGGG + Intronic
1190983517 X:55479993-55480015 CACGGGTAAGGCAGGGCAGATGG + Intergenic
1190985182 X:55493190-55493212 CACGGGTAAGGCAGGGCAGATGG - Intergenic
1191760095 X:64637097-64637119 CACTGTCAAGGGATGAGGGATGG + Intergenic
1195910881 X:109887399-109887421 CAGTGTCAAGGGAGAGAAAAAGG - Intergenic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1198939043 X:141932320-141932342 CACTGTCAAGGTATGGGGGAGGG + Intergenic
1199615129 X:149649981-149650003 CACTGTCAGAGGAGAGGAGAAGG + Intergenic
1199880150 X:151967909-151967931 CCCTGTCAAGGGATTACAGAAGG - Intronic
1201739512 Y:17308417-17308439 AACTCTCAAGGGAGAGCAGAGGG - Intergenic