ID: 1165412877

View in Genome Browser
Species Human (GRCh38)
Location 19:35673209-35673231
Sequence CTGGGGAGACAGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2643
Summary {0: 1, 1: 0, 2: 25, 3: 258, 4: 2359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165412877 Original CRISPR CTGGGGAGACAGAGGGAGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr