ID: 1165412890

View in Genome Browser
Species Human (GRCh38)
Location 19:35673294-35673316
Sequence CCGGGCTCACGTAGTCACGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165412890_1165412903 8 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412903 19:35673325-35673347 GGGGAGGGGCCTGACCTGCATGG 0: 1
1: 0
2: 4
3: 42
4: 422
1165412890_1165412898 -7 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412898 19:35673310-35673332 AGCCCGGCGAGGCCTGGGGAGGG 0: 1
1: 0
2: 1
3: 35
4: 395
1165412890_1165412907 14 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412907 19:35673331-35673353 GGGCCTGACCTGCATGGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 265
1165412890_1165412905 12 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412905 19:35673329-35673351 AGGGGCCTGACCTGCATGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 205
1165412890_1165412906 13 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412906 19:35673330-35673352 GGGGCCTGACCTGCATGGGAGGG 0: 1
1: 0
2: 3
3: 13
4: 289
1165412890_1165412899 -6 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412899 19:35673311-35673333 GCCCGGCGAGGCCTGGGGAGGGG 0: 1
1: 0
2: 4
3: 44
4: 540
1165412890_1165412912 26 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412912 19:35673343-35673365 CATGGGAGGGGCGAGGGTCCCGG 0: 1
1: 0
2: 3
3: 24
4: 374
1165412890_1165412904 9 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412904 19:35673326-35673348 GGGAGGGGCCTGACCTGCATGGG 0: 1
1: 0
2: 1
3: 30
4: 228
1165412890_1165412909 19 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412909 19:35673336-35673358 TGACCTGCATGGGAGGGGCGAGG 0: 1
1: 0
2: 2
3: 14
4: 227
1165412890_1165412897 -8 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412897 19:35673309-35673331 GAGCCCGGCGAGGCCTGGGGAGG 0: 1
1: 0
2: 4
3: 56
4: 841
1165412890_1165412910 20 Left 1165412890 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165412910 19:35673337-35673359 GACCTGCATGGGAGGGGCGAGGG 0: 1
1: 0
2: 2
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165412890 Original CRISPR CCGGGCTCACGTAGTCACGG TGG (reversed) Exonic
924323131 1:242869472-242869494 CCGGGCCCACGAAGTCACAAGGG - Intergenic
1084779117 11:71397137-71397159 CCTGGCTCACACAGTGACGGAGG - Intergenic
1104447506 12:128845711-128845733 CCGGGCTCGCGGTGTCACAGAGG - Intergenic
1104447583 12:128846038-128846060 CCGGGCTCGCGGTGTCACAGAGG - Intergenic
1104447597 12:128846092-128846114 CCGGGCTCGCGGTGTCACAGAGG - Intergenic
1104447667 12:128846421-128846443 CCGGGCTCGCGGTGTCACAGAGG - Intergenic
1104447706 12:128846584-128846606 CCGGGCTCGCGGTGTCACAGAGG - Intergenic
1104447720 12:128846638-128846660 CCGGGCTCGCGGTGTCACAGAGG - Intergenic
1104820036 12:131671899-131671921 CAGGGCTCAGGTGGTCATGGGGG - Intergenic
1109841678 13:67924714-67924736 CTGTGCTCAGGTAGTCATGGTGG - Intergenic
1119601400 14:75979410-75979432 CTGGGCTGAGGTAGTCAGGGCGG + Intronic
1137439813 16:48488773-48488795 CCGGGCTCAGGCAGGCACAGTGG + Intergenic
1144959289 17:19035854-19035876 ACGGGCTCACGGAGTGAGGGTGG - Intronic
1144975870 17:19138670-19138692 ACGGGCTCACGGAGTGAGGGTGG + Intronic
1147657640 17:42099677-42099699 GTGGGCTCAGGTAGGCACGGGGG - Intergenic
1157799424 18:50606940-50606962 CTCGGCTCACGTAGTCACTTGGG - Intronic
1165412890 19:35673294-35673316 CCGGGCTCACGTAGTCACGGTGG - Exonic
942745705 2:179229481-179229503 ACTGGCTCATGTAATCACGGAGG - Intronic
945449727 2:209979544-209979566 CTGGGCTGACCTAGTCACTGGGG - Intronic
1176146273 20:63566834-63566856 CCGGGCTCACCTGGGCACCGTGG + Exonic
1180995460 22:19963177-19963199 CCGGGCTCACGGAGTGACTCAGG + Intronic
1183372040 22:37438314-37438336 CAGGGCTCAGGTGGTCACTGAGG - Intergenic
950486736 3:13278363-13278385 CAGGGCTCACGGTGTCACGTGGG - Intergenic
981494415 4:145375527-145375549 CCTCGCTCACGTAGCCATGGCGG + Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
983142734 4:164172832-164172854 CCGGGCCCACGTGGTGGCGGGGG + Intronic
1002213235 5:177610578-177610600 CCGGCCTCACTGAGACACGGAGG + Intergenic
1018870565 6:167779317-167779339 CCGGGGTCACAAAGACACGGGGG - Intergenic
1049290423 8:141798660-141798682 CAGGGCTCAAGGACTCACGGGGG + Intergenic
1060547371 9:124469262-124469284 CGGGGGCCACGTAGTCATGGGGG - Exonic
1061798577 9:133102389-133102411 CTGGGCTCAGGGAGTCAGGGAGG - Intronic