ID: 1165413367

View in Genome Browser
Species Human (GRCh38)
Location 19:35676033-35676055
Sequence ATGGATAGACAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 577}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165413367_1165413370 -5 Left 1165413367 19:35676033-35676055 CCCTGCTCCATCTGTCTATCCAT 0: 1
1: 0
2: 4
3: 72
4: 577
Right 1165413370 19:35676051-35676073 TCCATCTGTCTGTCTTCCTCTGG 0: 1
1: 1
2: 5
3: 49
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165413367 Original CRISPR ATGGATAGACAGATGGAGCA GGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
900930857 1:5736461-5736483 ATGGATAGATAGATAGACAAAGG + Intergenic
900931032 1:5737726-5737748 ATGGATAGATGGATGGATAATGG + Intergenic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901928808 1:12583816-12583838 ATGGTTGGATAGATGGAGTAGGG - Intronic
902088703 1:13884747-13884769 ATGGTTAGGGAAATGGAGCAAGG - Intergenic
902721214 1:18305417-18305439 ATGGATAGATGGATGGATTATGG + Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
902873459 1:19327504-19327526 ATGGATGGACGGATGGATGAAGG - Intronic
903250349 1:22048861-22048883 ATGGATTGAGAGTTGGGGCAGGG + Intergenic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
904605219 1:31694500-31694522 CTGGATTGAAAGAGGGAGCAGGG + Intronic
904701471 1:32361048-32361070 AGGGTTAGAGAGATGGACCAGGG + Intronic
905252434 1:36658361-36658383 ATGGACAGGCAGATGGACCAGGG - Intergenic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905891252 1:41519845-41519867 ATGGAAGGATAGATGGAGAATGG + Intronic
906071828 1:43022358-43022380 ATGCACAGACCCATGGAGCATGG + Intergenic
906705462 1:47891706-47891728 ATGGAAAGACTGCTTGAGCATGG + Intronic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907501504 1:54884929-54884951 AGGGATGGACAGATGGAGATGGG + Intronic
907647914 1:56262725-56262747 AATGAAAGACACATGGAGCAGGG + Intergenic
908119397 1:60971476-60971498 ACAGATAGACAGATGGATGATGG + Intronic
908790212 1:67773590-67773612 AAGGAGAGAGACATGGAGCAAGG + Intronic
909745885 1:79096518-79096540 ATGGATAGATAGATAGAGATAGG - Intergenic
912327983 1:108786632-108786654 AAGGATAGACAAATTGACCATGG - Intronic
914351393 1:146843115-146843137 ATGGATAGATAGATGATGGATGG + Intergenic
915538334 1:156551328-156551350 ATGAATTGACAAATGGGGCAGGG - Intronic
916953948 1:169811877-169811899 ATAGATAGATAGATAGAGCTTGG + Intronic
917304165 1:173609734-173609756 ATGGAATGACACTTGGAGCAAGG - Exonic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919002261 1:191847731-191847753 ATGAACAGACACATAGAGCAAGG + Intergenic
919377412 1:196811316-196811338 ATGCATAGACAGACGGACCACGG + Intergenic
919382318 1:196874466-196874488 ATGGGTAGACAAATGCAGCCAGG + Intronic
919389710 1:196967240-196967262 ATGCATAGACAGACGGACCATGG + Intergenic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
920806118 1:209235516-209235538 ATGTTTAGACAGATTGAACATGG + Intergenic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921638980 1:217529034-217529056 TTGGACAGACAGATGATGCATGG + Intronic
922466164 1:225846626-225846648 ATGGAGAGAGAGATGTAACAAGG - Exonic
922617162 1:226967680-226967702 ATGGGTAGCCAGAGGGAGCCTGG + Intronic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
923178200 1:231489704-231489726 ATGGAAATAAAGAGGGAGCAGGG + Intergenic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
1062928762 10:1338727-1338749 GTGGATAGAGAGGTGGAGGAAGG + Intronic
1062940150 10:1414883-1414905 ATGGTTAGATAGATGGATAAAGG + Intronic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065860674 10:29870310-29870332 ATGGTTAGACAGATGGTGGTTGG - Intergenic
1066517522 10:36179683-36179705 ATGGATAGAGGGATGGATAATGG + Intergenic
1067051505 10:43024176-43024198 ATAGATGGACAGATGGATGATGG + Intergenic
1067377751 10:45743297-45743319 TGGGATAGTCAGATGGAACAGGG + Intronic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1067885451 10:50083979-50084001 TGGGATAGTCAGATGGAACAGGG + Intronic
1068128906 10:52873071-52873093 ATTGATAGACAGGAGGAGCAGGG + Intergenic
1068221103 10:54047083-54047105 ATAGCTAGATAGATGTAGCAGGG + Intronic
1068344074 10:55747975-55747997 ATGGAAAAACAGATAGGGCACGG - Intergenic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1069479073 10:68764200-68764222 ATTGAAACCCAGATGGAGCAAGG - Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070317480 10:75329035-75329057 ATGGAAAGACAGGCCGAGCACGG - Intergenic
1070439964 10:76433478-76433500 TTGGACAGGCAGGTGGAGCACGG + Intronic
1071002830 10:80850184-80850206 ATTGTTAGACAGAAGGAGTAAGG + Intergenic
1071016238 10:81000264-81000286 ATAGATATACAGATGTAGCCTGG - Intergenic
1072618412 10:97064465-97064487 TAGGATAGGGAGATGGAGCAGGG + Intronic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074633388 10:115284978-115285000 ATGGATAGGCAGAGAGATCAGGG - Intronic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076825118 10:132963339-132963361 GTTGATAGACAGATGGATGAAGG - Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1076943168 10:133623356-133623378 AGGGAAAGACAGAGGGAGAAAGG - Intergenic
1077236732 11:1485520-1485542 ATGAAGAGAAAGATGGAGCCGGG + Intronic
1077248758 11:1551477-1551499 ATGGATAGGCAGATGATGAATGG - Intergenic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280599 11:1743396-1743418 ATGGATAGACGGATGGATGGAGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078332412 11:10436146-10436168 ATTGAAAGACAGAGGGAGCAGGG + Intronic
1078870946 11:15344049-15344071 AAGGAGAGACAAATGAAGCAAGG + Intergenic
1080754697 11:35185581-35185603 ATGGATAGATGGATGGAGAGAGG - Intronic
1080781502 11:35433884-35433906 ATGGATAGACAGATGGGTGGGGG + Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1081189574 11:40086751-40086773 ATGGAGAGGCACATGTAGCAAGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082268852 11:50148086-50148108 ATAGCTAGATACATGGAGCATGG - Intergenic
1082287276 11:50330981-50331003 ATAGCTAGATACATGGAGCATGG + Intergenic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1084684656 11:70686492-70686514 ATGGATAGACAGATGATGGATGG - Intronic
1084718988 11:70892142-70892164 ATGGATGGACTGATGGACTAAGG - Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084987395 11:72888003-72888025 ATGGATACACAGTAGTAGCAAGG + Intronic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1087433841 11:98088042-98088064 TTGGAGAGAGAGATGCAGCATGG - Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1092002052 12:5040922-5040944 ATGGATAGACAGATATAGTGTGG + Intergenic
1092631970 12:10390506-10390528 ATAGATAGACAAATTGAGAAGGG + Intronic
1093640549 12:21522823-21522845 ATGGCTAGACAGAAATAGCAGGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1095954625 12:47798975-47798997 AGGGACAGAGAGAGGGAGCAGGG + Intronic
1096527413 12:52219417-52219439 ATGGATAGATAGATAGATGATGG - Intergenic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1097727513 12:63091733-63091755 ATTGACAGAAAGATGGAGGAAGG + Intergenic
1098196860 12:68011511-68011533 ATGAATAGAAAGAAGGACCATGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1101577734 12:106013637-106013659 AGCGAGAGACAGCTGGAGCAAGG - Intergenic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1103156114 12:118686361-118686383 AGGGATAGACAGCTGGAGTGAGG + Intergenic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104034761 12:125090630-125090652 ATGGATGGAGAGATGGATGATGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104968031 12:132518239-132518261 ATGGACAGACAGGTGGATGATGG - Intronic
1105249011 13:18679293-18679315 ATGGATAGTTAGATGGATAAGGG + Intergenic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1106914934 13:34503244-34503266 ATGGATTGACAGCTGGATCTTGG - Intergenic
1107422545 13:40262136-40262158 ATAGATAGATAGATGAAGGAAGG + Intergenic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1110523788 13:76512069-76512091 ATAGATAGATAGATAGATCATGG + Intergenic
1110905336 13:80880391-80880413 ACAGATAGAAAGCTGGAGCAAGG + Intergenic
1111025754 13:82520388-82520410 ATAGATAGAGAGAGGTAGCATGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111256331 13:85673994-85674016 AGGGAGAGAGGGATGGAGCAAGG + Intergenic
1112216929 13:97440787-97440809 ATGGATAGATAAATAAAGCAGGG - Intronic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113064418 13:106358980-106359002 AGGGAGAGAGAGAAGGAGCATGG - Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1113684811 13:112275647-112275669 ATAGATAGATAGATGGAAAAAGG + Intergenic
1113901007 13:113798081-113798103 ATGGATAGAAGGATGGATAATGG + Intronic
1113901024 13:113798166-113798188 ATGGATAGAAGGATGGATGATGG + Intronic
1113901038 13:113798236-113798258 ATGGATAGAAGGATGGATGATGG + Intronic
1113901092 13:113798543-113798565 ATGGATAGAAGGATGGATGATGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114873853 14:26691005-26691027 ATGGATAGAGAGATTGAGGTGGG - Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115500075 14:34041813-34041835 ATGTAGAGGCATATGGAGCATGG + Intronic
1115974577 14:38982180-38982202 ATGGATGGACATTTGGAGAAAGG - Intergenic
1116043370 14:39713455-39713477 ATTGTTAGAGAGATGGGGCATGG + Intergenic
1117238809 14:53807149-53807171 ATGGACAGACAGCTGGATGAGGG + Intergenic
1118001551 14:61527851-61527873 ATGGACAGGCGGATGGGGCAGGG - Intronic
1119514034 14:75233947-75233969 ATGGAAAGAGAGATGGGGCCGGG + Intergenic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1120671936 14:87372624-87372646 ATGGATAGATAGATAGATAAAGG - Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1122011124 14:98749078-98749100 ATGGATAGATAGATAGATGATGG + Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1122958447 14:105083551-105083573 GTGGATAGAGAGATGGTGGATGG - Intergenic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1123890559 15:24774198-24774220 ATGGATAGAGTGATGAAGTAAGG - Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125840120 15:42792593-42792615 ATCGAAAGACAGCTGGAGTATGG + Intronic
1125854827 15:42938821-42938843 ATGGTGAGAGAGAAGGAGCAGGG - Intergenic
1126168863 15:45677236-45677258 ATGGATAGATAGATAGACAAAGG - Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128507944 15:68290815-68290837 ATTGACAGCCAGATGCAGCAAGG - Exonic
1128518919 15:68362553-68362575 ATGGATAGACAGATGATAGATGG + Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1128869224 15:71139855-71139877 AGGGAAAGACAAATGAAGCAAGG - Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1132030842 15:98437664-98437686 ATGGATGGACGGATGGATGACGG + Exonic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1134632283 16:15765457-15765479 ATGGATGGACAGATGATGGATGG + Intronic
1134766805 16:16766343-16766365 ATGTATAGAGAGAGGCAGCAAGG + Intergenic
1136071410 16:27789795-27789817 ATGGATGGACAGATGATGGATGG + Exonic
1136296901 16:29309002-29309024 AGGGATGGGCAGAGGGAGCACGG - Intergenic
1136565053 16:31064780-31064802 ATGGTGAGACAGATGGAACCTGG - Exonic
1137569445 16:49555764-49555786 ATGGATGGAGGGATGGTGCATGG + Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1138131289 16:54482203-54482225 AGGGAAAGGCACATGGAGCAAGG - Intergenic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1140833054 16:78769277-78769299 ATGGACAGACGGATGGACGATGG - Intronic
1141042919 16:80687578-80687600 ATGGATGGACAGATGTGGGATGG + Intronic
1141115133 16:81302031-81302053 ATGGATGGATGGATGGAGCTGGG - Intergenic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1142058476 16:88015189-88015211 AGGGATGGGCAGAAGGAGCACGG - Intronic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142138938 16:88464055-88464077 AAGGATTGACCGATGGACCACGG - Intronic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1142960561 17:3549928-3549950 ATGGATGGACAGATGATGTATGG + Intronic
1143137488 17:4719971-4719993 ATGGAGAGCCAGACGGTGCAAGG + Intronic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1144582920 17:16470039-16470061 ACTGCTAGACACATGGAGCAGGG - Intronic
1146547779 17:33754113-33754135 AGGGATAGAGAGGTGGTGCAGGG - Intronic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147791120 17:43014877-43014899 ATGGGTGGGGAGATGGAGCAGGG - Exonic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1149441034 17:56674005-56674027 ATGGTAAGAAAGATGGAGCACGG + Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1150773064 17:68057987-68058009 ATAGATAGATAGATGGATCTTGG + Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152006655 17:77686339-77686361 TGGGATAGATAGATGGAGGAAGG - Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1152296203 17:79468378-79468400 ATGCATAGACAGATGATGGATGG + Intronic
1154439870 18:14379936-14379958 ATGGATAGTTAGATGGATAAGGG - Intergenic
1156173133 18:34510480-34510502 ATGGAATGACTGATGGAACAGGG - Intronic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1156509223 18:37621504-37621526 ATGGATACATAGACGGAGAATGG - Intergenic
1156610853 18:38722521-38722543 ATGGATAGACTGATGGACAGAGG - Intergenic
1157024603 18:43828146-43828168 AGGGATGAAGAGATGGAGCACGG - Intergenic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1160960241 19:1717713-1717735 ATGGATGGATGGATGGAACATGG + Intergenic
1161105279 19:2440752-2440774 ATGGATAGATAGATGATGGATGG - Intronic
1161218519 19:3106848-3106870 ATGGATACACTGATGGGGGAGGG - Intronic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161287624 19:3477108-3477130 ATGGATGGATGGATGGATCATGG + Intronic
1161489390 19:4553609-4553631 ATGGATGGATAGATGAAGGATGG + Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162085816 19:8248562-8248584 ATGGGTGGACAGATGGATGATGG + Intronic
1162339642 19:10084778-10084800 ATTGATAGATAAATGGAGCTGGG - Intergenic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163383676 19:16985828-16985850 ATGGAGAGAGAGATGGAGGGTGG + Intronic
1163664039 19:18594766-18594788 AGAGATAGACAGACAGAGCAGGG + Intronic
1164210609 19:23094351-23094373 ATAGATAGATAGATAGAGCCAGG - Intronic
1164465219 19:28482115-28482137 ATGCCTAGACAGATAGAGAAGGG + Intergenic
1164631871 19:29767348-29767370 ATGGATAGACAGATGACTGATGG + Intergenic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164797438 19:31045301-31045323 ATGGATGGATAGATGGAGACTGG + Intergenic
1165098359 19:33422781-33422803 ATGGATAGATAGAGGGAGGGAGG - Intronic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1166201413 19:41239962-41239984 ATGGATAGATATATGGAGGGTGG + Intronic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1167144159 19:47672101-47672123 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144166 19:47672132-47672154 ATGGATGGAAGGATGGAGCATGG + Intronic
1167144174 19:47672163-47672185 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144182 19:47672194-47672216 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144213 19:47672316-47672338 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144221 19:47672347-47672369 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144229 19:47672378-47672400 ATGGATGGAAGGATGGAGGATGG + Intronic
1167583643 19:50360980-50361002 ATGGATGTACTGGTGGAGCAGGG - Exonic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925260202 2:2522066-2522088 ATGGATGGGCAGATGGGGGATGG - Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925711962 2:6750007-6750029 GAGGACGGACAGATGGAGCATGG - Intergenic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
925745375 2:7039237-7039259 ATGGATGGAGAGATGGATGATGG + Intronic
925745392 2:7039334-7039356 ATGGATAGAGAGATGTATGATGG + Intronic
925925667 2:8668328-8668350 ATGGATGGACGGATGGATGAAGG + Intergenic
925925686 2:8668416-8668438 ATGGATGGACGGATGGATGAAGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
928794828 2:35005417-35005439 ATGGATAGAAAGAATGAACATGG + Intergenic
929555455 2:42922884-42922906 CTGGATAGAAAGTTTGAGCATGG - Intergenic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
931072063 2:58663068-58663090 ATGGATAGAAAGATGGATCTTGG + Intergenic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
932336128 2:70932464-70932486 ATGGATCGACAGACAGAGAATGG - Intronic
932802516 2:74754064-74754086 TTTGATAGACTCATGGAGCATGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
935848600 2:107194581-107194603 ATAGATAGACAGATGTACCAAGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937169722 2:119853967-119853989 ATAGAGAGACAGAGGGAGCGGGG + Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
940155044 2:150646998-150647020 ATAGAATGCCAGATGGAGCATGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940980523 2:159997298-159997320 ATGGCTAGAGAGCTGGAGCGGGG + Intronic
941358426 2:164521158-164521180 ATAGATAGACAGACAGACCACGG + Intronic
941520674 2:166537944-166537966 ATGGAGAGAGAGAGAGAGCATGG - Intergenic
942831373 2:180240083-180240105 GTGGATTGATAGAAGGAGCATGG + Intergenic
943720086 2:191194814-191194836 ATGGATAGATAAATGGAAGAAGG - Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
947381187 2:229546829-229546851 ACAGATAGATAGATAGAGCAAGG + Intronic
948859310 2:240745225-240745247 ATGGATTTACAGCTGGGGCATGG - Intronic
1169773338 20:9225082-9225104 ATGGATAGACCGATGAATGAAGG + Intronic
1171008600 20:21492725-21492747 ATGGATTGACAGATGGTGTCTGG + Intergenic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172849031 20:37947358-37947380 ATGGATAGATAGATGATGGATGG + Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173475670 20:43357578-43357600 ATGGCCAGAGAGAGGGAGCAAGG + Intergenic
1173871520 20:46344999-46345021 ATGGATGGAGAGATGGATAATGG - Intergenic
1173902336 20:46600235-46600257 AGGGAGAGAGAGATGGAGGAAGG + Intronic
1174174050 20:48633964-48633986 ATGGATGGACGGATGGATGATGG + Intronic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1174862535 20:54104463-54104485 ATGGATAGTACGATGAAGCAAGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175600294 20:60267342-60267364 GTGGAAAGTGAGATGGAGCAGGG + Intergenic
1175745775 20:61455995-61456017 ATGGATAGATATATGGAGGGAGG + Intronic
1175745797 20:61456104-61456126 ATGGATAGATGGATGGAGAGTGG + Intronic
1175762831 20:61572889-61572911 ATGGACAGACGGATGGATGATGG + Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175780280 20:61677782-61677804 ATGGATAGATACATGGATGATGG + Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1176455875 21:6909835-6909857 ATGGATAGTTAGATGGATAAGGG + Intergenic
1176834049 21:13774883-13774905 ATGGATAGTTAGATGGATAAGGG + Intergenic
1177521164 21:22228097-22228119 ATGGATGGACGGATGGATGATGG - Intergenic
1178259472 21:31085571-31085593 AGGGATAGACAGAGGGAGGGAGG + Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1180606825 22:17065216-17065238 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1181002406 22:19994082-19994104 ATGGACAGACAGATGGATACAGG + Intronic
1181609584 22:24003719-24003741 AAGCAGAGACAGATGGTGCAAGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182380350 22:29882959-29882981 ATGGCTAGACAGATGGGAAATGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1183106507 22:35618866-35618888 ATGGATAGATGGATGGAGGGAGG - Intronic
1183106537 22:35618994-35619016 ATGGATAGATGGATGGAGGGGGG - Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183262319 22:36803617-36803639 ATGGATAGAGGGATGGATAAAGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304095 22:37072825-37072847 ATGGATAGACGGATGATGGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183304143 22:37073079-37073101 ATGGATAGACGGATGATGGATGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293109 22:43508711-43508733 ATGGATAGAGAGAGGGAGGGAGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184293293 22:43509322-43509344 ATGGATGGACAGTTGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184780000 22:46643224-46643246 ATGGATAGATGGATGGATCCAGG - Intronic
1184863541 22:47190413-47190435 AGGGACAGACAGATGGGGCGGGG - Intergenic
1185018792 22:48361149-48361171 ATGGATAGATAGATGATGGATGG + Intergenic
1185053519 22:48566102-48566124 ATGGATAGATAGATGATGGATGG + Intronic
1185076692 22:48687024-48687046 ATGGATGGATTGATGGAGGATGG + Intronic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
1185193499 22:49453471-49453493 AAGGATGGATGGATGGAGCATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
949431868 3:3985442-3985464 ATCGATAAACTGAAGGAGCATGG - Intronic
949880886 3:8659702-8659724 ATGGACAGACGGATGATGCATGG - Intronic
950474216 3:13205575-13205597 AGGGATAGAAGGATGAAGCATGG - Intergenic
950657651 3:14446987-14447009 ATGGATAGATGGATGGAAAATGG - Intronic
951828301 3:26894060-26894082 ATGGGTAGACAGAATAAGCATGG - Intergenic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954281892 3:49586321-49586343 ATAGATAGATAGATAGAGCTGGG - Intronic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
954794030 3:53152379-53152401 ATGGACTGACTGATGGAGCAAGG - Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955176368 3:56618142-56618164 ATGGATAGATAAATGCAGAAAGG - Intronic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957957346 3:87205180-87205202 ATGGATAGCAAGATAGAGCTGGG + Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
960195929 3:114768037-114768059 ATGGATAATTAGATGGTGCAGGG - Intronic
960284460 3:115811268-115811290 ATGGATAGGAAGCTGGAGAAGGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960840856 3:121957195-121957217 ATGGATAGATAGATAGAGAGAGG + Intergenic
961661012 3:128468805-128468827 ATGGACAGACAGACGGGCCAAGG + Intergenic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
963678409 3:148343918-148343940 ATGTACAGACAGAGGGTGCATGG - Intergenic
965726424 3:171721303-171721325 AAGGATAGAAAGAAAGAGCAAGG + Intronic
966129578 3:176622151-176622173 ATGGCCAGACAGTTGGAGCCAGG + Intergenic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
969166263 4:5318360-5318382 AGTGATAGGAAGATGGAGCAGGG + Intronic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
976278403 4:83302058-83302080 ATGTATAGACACATGCAACAGGG + Intronic
976604162 4:86967074-86967096 AGGGATGGACTGATGAAGCAGGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977297344 4:95225447-95225469 ATGGATTGTCAAATGGAGCAAGG + Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
980420619 4:132555319-132555341 ATAGATAGACAGATAGATAATGG - Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
980964169 4:139504365-139504387 ACAGATAGACAGATAGATCATGG - Intronic
983770262 4:171540140-171540162 ATGGATAGATAGATGATGGATGG - Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986140201 5:5022697-5022719 AAAGATAGACTGATAGAGCAAGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986770786 5:10971028-10971050 ATGGATAGGTAGATGGAGGTAGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990516060 5:56531845-56531867 AGTGACAGAAAGATGGAGCATGG - Intronic
991087455 5:62661053-62661075 ATGGATGGGCAGCTGGATCAGGG - Intergenic
992453186 5:76891748-76891770 GTAGATAGACAGAGGGTGCAGGG + Intronic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
994493835 5:100484566-100484588 ATGGATAGTCAGATAGAAGATGG - Intergenic
995500068 5:112794906-112794928 ATGAAGAGACATATGGGGCAAGG + Intronic
995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG + Intergenic
997543823 5:134688595-134688617 GAGGATAGACATATAGAGCAAGG + Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998916982 5:147024148-147024170 ATAGATAGATAGATAGAGGAGGG - Intronic
999191368 5:149749947-149749969 ACAGATGGACAGATGGAGCTAGG + Intronic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999903563 5:156114003-156114025 AGGGATAAATAGATGGAGCCAGG + Intronic
1000427151 5:161104851-161104873 ATCTATAGATAAATGGAGCAAGG + Intergenic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001254220 5:170171347-170171369 ATGGATAGATGGATGGAGAGTGG + Intergenic
1001278400 5:170367518-170367540 ATGGATGGATTGATGGAGGATGG + Intronic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001759131 5:174193041-174193063 GTCCATAGACAGATGGAGTACGG - Intronic
1002100210 5:176853849-176853871 ATGGACAGAGGGATGGACCAAGG + Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003016084 6:2468522-2468544 AGGGAGAGAGAGAGGGAGCAAGG + Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003941777 6:11035434-11035456 AAGGATGGATAGAAGGAGCATGG - Intronic
1004344514 6:14836389-14836411 ATGGATTGATGGATGGATCAAGG - Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006653965 6:35574442-35574464 ACGGGTAAACAGATTGAGCATGG - Exonic
1007116727 6:39348312-39348334 ATGGAGAGATGGATGGGGCAGGG + Intronic
1008299682 6:49820332-49820354 ATGCATTGGCAGATGAAGCATGG - Intergenic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1008483859 6:52014482-52014504 CTGGATAGATGGATGGATCATGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008483911 6:52014771-52014793 CTGGATAGATGGATGGATCATGG + Intronic
1008826636 6:55702432-55702454 ATAGATAGATAGATAGAGAAAGG - Intergenic
1009593005 6:65698704-65698726 ATGTATAGACACCTGCAGCATGG - Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010571701 6:77481038-77481060 AAGGAAAGAGGGATGGAGCATGG + Intergenic
1012456594 6:99413442-99413464 ATGGATGGATGGATGGATCATGG - Intronic
1012642832 6:101642387-101642409 ATGGAAAGAGAAATGGAGAATGG - Intronic
1014400828 6:120987596-120987618 ATCAGGAGACAGATGGAGCAGGG - Intergenic
1016039767 6:139420979-139421001 ATGGATAGGTAGGTAGAGCAAGG + Intergenic
1016451971 6:144192607-144192629 TAAGATAGACAGAAGGAGCAGGG - Intergenic
1016737227 6:147492569-147492591 AGGGCTAGATAAATGGAGCAGGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1018524818 6:164697689-164697711 ATGGATAGACAATTAGAACAGGG + Intergenic
1018753950 6:166831889-166831911 ATGGATAGATAGATGATGGATGG + Intronic
1018757966 6:166865908-166865930 AAGGAAAGACGGATGGAGAAGGG + Intronic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019345576 7:528580-528602 ATGAATAGACAGATGATGGATGG + Intergenic
1019345607 7:528802-528824 ATGAATAGACAGATGATGGATGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022410911 7:30137551-30137573 ATAGATAGAAAGATAGAGGATGG + Intronic
1023677197 7:42643013-42643035 ATGCCTAGACAGATGGGGCTGGG + Intergenic
1024143376 7:46484960-46484982 ATGGATTGAGAGGTGGAACATGG - Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026080139 7:67210663-67210685 ATGGATAGACAGATGACGGATGG - Intronic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026494114 7:70888023-70888045 AGGGATAGAGAGATGGGGAAAGG + Intergenic
1026696941 7:72603305-72603327 ATGGATGGACAGATAGATGATGG + Intronic
1026696952 7:72603364-72603386 ACGGATAGACAGATGATGGATGG + Intronic
1027112883 7:75454768-75454790 ATGGATAAAGAGATGGCACACGG + Intronic
1027285129 7:76639379-76639401 ATGGATAAAGAGATGGCACACGG + Intergenic
1028788386 7:94823717-94823739 TTGGATAGCCATATGGAGAAAGG + Intergenic
1028888648 7:95962224-95962246 ATGGGCAGTCAGATGGAGCTGGG - Intronic
1029067782 7:97869479-97869501 ATGCAGAGACAGATGTGGCATGG - Intronic
1029583482 7:101453991-101454013 ATGTATAGACATATGTAGAAAGG - Intronic
1030384340 7:108849331-108849353 ATGGATTGCCAGATGTAGAAAGG - Intergenic
1031702843 7:124945996-124946018 ATGGATAGGAACATGGATCATGG + Intergenic
1031922623 7:127612918-127612940 ATGGATGGACGAATGGAGGATGG + Intronic
1033175320 7:139118480-139118502 ATGGTCAGACAAATGGAGGAAGG + Intergenic
1033514040 7:142088553-142088575 ATAGATAGATAGATAGAGGATGG - Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034352152 7:150423675-150423697 AGGGATAAATAGGTGGAGCACGG - Intergenic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1034893510 7:154860278-154860300 ATGGAGAGACATCAGGAGCATGG + Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036496505 8:9274806-9274828 ATGGATAGACAGAAGGTTAAAGG + Intergenic
1036768306 8:11562886-11562908 ATGGAAGGACAGCAGGAGCAGGG + Intronic
1037669733 8:21004051-21004073 ATAGATGGATAGATGGAGGATGG + Intergenic
1038325079 8:26566971-26566993 ATGGATAGACAGATGACGGGTGG - Intronic
1039040211 8:33400501-33400523 GTGGATAGACGGATGAAGGAAGG + Intronic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1040584391 8:48726252-48726274 ATGGATAGATAGATGATGGATGG - Intronic
1042109215 8:65361558-65361580 ATGGAGAGACCCATAGAGCAAGG + Intergenic
1043200009 8:77355315-77355337 AAGGATAGACATACAGAGCAAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044506709 8:93028847-93028869 GGGGATAGAGTGATGGAGCAGGG - Intergenic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046553384 8:115745330-115745352 ATGCTTAGAAAGATGCAGCATGG - Intronic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1048065697 8:130966253-130966275 ATGCATAGACATAAGGTGCAAGG - Intronic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048988731 8:139749133-139749155 AGGGAGGGACAGATGGAGCAGGG - Intronic
1049155314 8:141062628-141062650 GTAGATAGACAGATGGGGGAGGG + Intergenic
1049350705 8:142163038-142163060 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350736 8:142163213-142163235 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350770 8:142163401-142163423 ATGGATTGACGGATGGAGGATGG + Intergenic
1049350840 8:142163774-142163796 ATGGATTGACAGATGGATGGAGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050984286 9:12062318-12062340 ATGGGTAGACAGATGAAGAGAGG - Intergenic
1051656227 9:19384557-19384579 AAGGATAGGCACATGGACCATGG - Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1053276681 9:36788458-36788480 ATGGATAGACAGATGTGTGAAGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057028218 9:91752858-91752880 ATTGATGGACAGATGGAGGCTGG + Intronic
1057241983 9:93419531-93419553 ATGCATAGACATTTGTAGCAAGG - Intergenic
1057829475 9:98395778-98395800 GTGGTTAGAAGGATGGAGCAAGG + Intronic
1057977138 9:99617933-99617955 ATGGATAGATAGATAGAACATGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058075344 9:100644917-100644939 AGGGAGGGACAGAGGGAGCAAGG - Intergenic
1058218562 9:102266323-102266345 ATAGATAGATAGATGGTGCTGGG + Intergenic
1058390699 9:104492010-104492032 AGGGAGGGAGAGATGGAGCAAGG + Intergenic
1058877033 9:109253198-109253220 ATGGAAAGAAATATGGAGAAAGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1060034640 9:120244242-120244264 ATGGACAGCCAGAAGGTGCATGG - Intergenic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1061244988 9:129397005-129397027 ATGGATGGAAGGATGGAGGATGG + Intergenic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061911797 9:133728956-133728978 ATAGATGGAGAGATGGAGGACGG + Intronic
1061950588 9:133933778-133933800 ATGGATGGACGGATGGTGGATGG + Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062201271 9:135304094-135304116 ATGGATAGACAGATGATGGAGGG + Intergenic
1062281326 9:135753106-135753128 ATGGATGGAGAGATGGATGATGG + Intronic
1062649818 9:137569715-137569737 ATGGATGGATGGATGGATCATGG - Intronic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185695786 X:2193432-2193454 ATGGATAGACAGATACATGATGG - Intergenic
1185780559 X:2840942-2840964 ATGGATAGATAGATGATGGATGG + Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1185883876 X:3764536-3764558 ATGGATAGATAAATGAATCATGG - Intergenic
1185958693 X:4521730-4521752 ATAGATACATAGATGGATCATGG + Intergenic
1187281213 X:17860104-17860126 ATGGAGAGAGGGATGGGGCACGG - Intronic
1189951321 X:46234190-46234212 ATGGACAGATGGACGGAGCATGG + Intergenic
1190187449 X:48248166-48248188 AAGGATAGACACATAGATCACGG - Intronic
1190191944 X:48284331-48284353 AAGGATAGACACATAGATCACGG - Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1190715023 X:53095913-53095935 ATGGGTAGATAGAGTGAGCAAGG - Intergenic
1190732064 X:53233030-53233052 ATAGACAGACAGATGGACCCTGG - Exonic
1190936910 X:55005981-55006003 ATGGATGGACTGATGGATGATGG + Intronic
1194515807 X:94852749-94852771 ATAGATAGATAGATAGAGCCTGG - Intergenic
1194527396 X:94994224-94994246 AAGGACAGACATATGGACCAGGG - Intergenic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1194587405 X:95752913-95752935 AAGAATAGACAGATAGATCAAGG - Intergenic
1196414652 X:115458012-115458034 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1197764985 X:130054429-130054451 AAGGAGAGAAGGATGGAGCAAGG + Intronic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199669364 X:150130012-150130034 AAGGATAGACAAATGTATCATGG - Intergenic
1199895704 X:152125784-152125806 ATAGATAGATAGATAGAGTATGG + Intergenic
1200781544 Y:7220755-7220777 ATGGATAGATAAATGAATCATGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201289494 Y:12408923-12408945 ATGGATAGATAGATGATGGATGG - Intergenic
1201289501 Y:12409055-12409077 ATGGATAGATAGATGATGGATGG - Intergenic