ID: 1165416828

View in Genome Browser
Species Human (GRCh38)
Location 19:35699600-35699622
Sequence GACCCAGATCTGCCTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165416828_1165416832 6 Left 1165416828 19:35699600-35699622 CCTGGGTCAGGCAGATCTGGGTC No data
Right 1165416832 19:35699629-35699651 CCAGCTTCGGTTACTCCTCAGGG No data
1165416828_1165416829 -7 Left 1165416828 19:35699600-35699622 CCTGGGTCAGGCAGATCTGGGTC No data
Right 1165416829 19:35699616-35699638 CTGGGTCTGAATTCCAGCTTCGG No data
1165416828_1165416834 21 Left 1165416828 19:35699600-35699622 CCTGGGTCAGGCAGATCTGGGTC No data
Right 1165416834 19:35699644-35699666 CCTCAGGGAGTAACCGAAGCTGG No data
1165416828_1165416830 5 Left 1165416828 19:35699600-35699622 CCTGGGTCAGGCAGATCTGGGTC No data
Right 1165416830 19:35699628-35699650 TCCAGCTTCGGTTACTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165416828 Original CRISPR GACCCAGATCTGCCTGACCC AGG (reversed) Intergenic
No off target data available for this crispr