ID: 1165419960

View in Genome Browser
Species Human (GRCh38)
Location 19:35717818-35717840
Sequence CCGCGGCCGGCCGGCGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165419960_1165419971 11 Left 1165419960 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 254
Right 1165419971 19:35717852-35717874 CGTGGTGCCCTGCGCGTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 127
1165419960_1165419972 16 Left 1165419960 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 254
Right 1165419972 19:35717857-35717879 TGCCCTGCGCGTGGCCGGCCCGG 0: 1
1: 0
2: 2
3: 11
4: 162
1165419960_1165419975 23 Left 1165419960 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 254
Right 1165419975 19:35717864-35717886 CGCGTGGCCGGCCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 37
4: 330
1165419960_1165419964 -7 Left 1165419960 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 254
Right 1165419964 19:35717834-35717856 GCCGCGGACTCCCTCTCCCGTGG 0: 1
1: 0
2: 1
3: 9
4: 90
1165419960_1165419968 7 Left 1165419960 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 254
Right 1165419968 19:35717848-35717870 CTCCCGTGGTGCCCTGCGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165419960 Original CRISPR CCGCGGCCGGCCGGCGCCCT CGG (reversed) Intergenic
900138856 1:1130696-1130718 CCGGGGCTGGTCGGCTCCCTCGG + Intergenic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900191870 1:1355492-1355514 CCGCGGCCGCCTGGAGCTCTCGG - Exonic
900269277 1:1778749-1778771 CCGCGTCCGGAGGGCGCCCCCGG + Intronic
900349562 1:2228203-2228225 ACGCGGCCGGCCAGCGCCGCCGG + Intergenic
901068551 1:6506179-6506201 CCCCGCCTGGCCCGCGCCCTCGG + Intronic
902315763 1:15617406-15617428 CGCCGGGCGGCCGGCGCGCTTGG + Intergenic
903044243 1:20553698-20553720 CGGCGGCCGGTAGGCGCACTTGG - Exonic
904199873 1:28812617-28812639 CCGCTGCGGGCCGGCGCCGCAGG + Intronic
906532831 1:46533236-46533258 CCGCGGCCGCCGAGCGCCCACGG + Intergenic
907053493 1:51345040-51345062 CCGAGCCCGGCCCGCGCCCATGG - Exonic
915344128 1:155190309-155190331 CCGGGGCCGGCCTGCTCTCTGGG + Intronic
915469143 1:156115318-156115340 GGGCGGCGGGCCGGCGCCCCTGG + Intronic
915740260 1:158113695-158113717 CGGCGGCCGCCCGGAGCCCGAGG + Intergenic
917919918 1:179743049-179743071 ACGCGGGAGGCGGGCGCCCTGGG - Intergenic
917974392 1:180229913-180229935 CCGTGGCGGGCTCGCGCCCTGGG - Intergenic
919464154 1:197911317-197911339 CCGCGGCCTGACTGCGCCCCGGG + Intergenic
919892086 1:201982881-201982903 CCGCAGCTCGGCGGCGCCCTCGG - Exonic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
921472721 1:215567713-215567735 CCGCTGCCGGCCGCCGCCGCGGG - Exonic
923698915 1:236281801-236281823 CCGCGGCCAGCCGGACCCCTCGG + Exonic
1062774532 10:134984-135006 CCGCGGCCGGGCCGCGCACTGGG - Intronic
1063660965 10:8034901-8034923 GCGCGGCCGGGCGGCGCCTCGGG + Intergenic
1064244337 10:13657208-13657230 CAGCGGGCGGCGGGCGCACTGGG - Exonic
1065161567 10:22927989-22928011 CCGCGCCGCGCCTGCGCCCTGGG - Intergenic
1066402605 10:35090349-35090371 CCCCGGCCGGCCGCCGCCACCGG + Exonic
1070570726 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG + Intronic
1071086721 10:81874904-81874926 CCGCGCCCAGCCCGCTCCCTGGG - Intergenic
1072169982 10:92849093-92849115 CCGCGGCAGCCCGGCGCGCCAGG - Intronic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1074399057 10:113126787-113126809 CCGCGGCCGGCGCGGGCCCTGGG + Intronic
1075129542 10:119726226-119726248 CCGCGGGCCGCCGCCTCCCTGGG + Exonic
1075645056 10:124091893-124091915 CCGGGGCCGGCCGGCGCGGCTGG - Intronic
1075999839 10:126905724-126905746 CCCCGGCCGCCCCGCGCCCCCGG + Intronic
1078594478 11:12674664-12674686 CCGGGGCCGGCTGGCGCGCTGGG - Exonic
1080540353 11:33258176-33258198 CCGCGCCTGGCCGGGGCCCGGGG + Intronic
1081528560 11:43943020-43943042 CCGCAGCCGGCCCCGGCCCTTGG - Exonic
1084888488 11:72225006-72225028 CCGGGCCCGGGGGGCGCCCTGGG + Exonic
1087138111 11:94740504-94740526 CCGCCGCCGCCGCGCGCCCTCGG + Intronic
1088172812 11:107017752-107017774 CAGCCGCCTGACGGCGCCCTCGG - Exonic
1091259572 11:134223930-134223952 CGGCGGCGAGCCGGTGCCCTGGG - Exonic
1092219121 12:6700756-6700778 CCGCCGCCGCCCCGCGCCCCAGG - Intronic
1094040253 12:26114406-26114428 CCGCCGCCCGCCAGCGCCCCGGG + Intergenic
1096491370 12:52014915-52014937 CCGCCCCCGGCCCGCGCCTTCGG + Exonic
1096647710 12:53047514-53047536 CCGCGGCCAGCCAGAGCCCCCGG - Intronic
1103534652 12:121626464-121626486 CCGCGATTGGCCGCCGCCCTGGG - Intergenic
1104399100 12:128460920-128460942 CCGTGGCAGGCCTGAGCCCTGGG - Intronic
1104744564 12:131202838-131202860 CCGCCTCCGCCCGGCTCCCTGGG + Intergenic
1104929255 12:132329483-132329505 CCGCCGCCCCCCGGCGCCCCCGG - Intergenic
1104961525 12:132490430-132490452 CCGCCGCCCGCCGCCGCCCAGGG + Exonic
1104979054 12:132564914-132564936 CCGCGGCCGGCCGCCCTCCTAGG + Intronic
1105779618 13:23695369-23695391 CCCCAGCCGGCGGGCGCCCAGGG + Intergenic
1108407952 13:50124135-50124157 CCGCGCGCGGACGGCGCTCTGGG + Intronic
1108541986 13:51453348-51453370 CCGCGGCCGCCCCGCGCGCGCGG - Intronic
1108689377 13:52847765-52847787 CGGCGGGCGGCCGCCGTCCTGGG + Exonic
1112091666 13:96090358-96090380 CCGCGGCCGGCCGGGGCGGCGGG + Intergenic
1112344209 13:98576883-98576905 GCGGGGCCGGCCGGAGCCCGAGG + Intronic
1113338689 13:109401423-109401445 CCCCAACCGGCCTGCGCCCTGGG + Intergenic
1113669512 13:112166060-112166082 GCGGGGCCTGCCTGCGCCCTGGG - Intergenic
1113861583 13:113490740-113490762 CCTCGGACGGCCGCGGCCCTCGG + Exonic
1114194043 14:20461432-20461454 GCGCGGCGCGCAGGCGCCCTGGG - Exonic
1114627932 14:24141477-24141499 CCGCCGGCTCCCGGCGCCCTGGG + Exonic
1115985944 14:39103440-39103462 CCTCGGCCGTCCGGCTGCCTGGG - Exonic
1118288944 14:64503576-64503598 CAGCTGCAGGCCGCCGCCCTGGG + Intronic
1119326082 14:73760239-73760261 CAGCGGCCGGCCGGCGCGCGCGG + Exonic
1119357497 14:74019268-74019290 GCGCGGCAGCCCGCCGCCCTCGG + Exonic
1122145130 14:99684353-99684375 TCGCGGCCTCCCGGCCCCCTCGG + Exonic
1122960975 14:105093518-105093540 CCGCCCCCGGCCCGCGCCCCGGG + Intergenic
1123691129 15:22838899-22838921 GCGCGGCCGGCCGGCCGACTAGG + Exonic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1125503357 15:40252861-40252883 CCGCGCCGGGCGGGCGCCCGCGG - Exonic
1125535880 15:40441085-40441107 CCGCGGCCGGGCGGGGCCGTCGG - Intronic
1127103091 15:55587700-55587722 CCGCGTCCCGCCGGCACCCCGGG - Intronic
1128119178 15:65133381-65133403 CCGCCGCCGGCCGACGTGCTCGG - Exonic
1128987349 15:72231027-72231049 CCGGGGCCGGCCGGCGCGCCGGG + Exonic
1129791207 15:78341630-78341652 CCGCGCCCGCCCGGGTCCCTGGG + Intronic
1130411692 15:83653710-83653732 CCGCCGCCGGCAGGCGCACTGGG - Intergenic
1132365081 15:101251430-101251452 CCGCGCGCGGCCGGCGCGCCTGG - Exonic
1132843538 16:1989947-1989969 CCGCGGCCGGCGCGCGCTCCCGG + Exonic
1133232105 16:4371793-4371815 CCGCGGCGGGCCCGCCCCCCGGG + Intronic
1134070469 16:11256749-11256771 CCGCGGCCGGCCGGGGCTTCGGG - Intronic
1136627636 16:31471961-31471983 CCGCGGCAGGCCGGCGGGCTGGG + Intronic
1136778994 16:32885594-32885616 CCCCGGCCGGCCCGCGCCCTCGG - Intergenic
1136891624 16:33975924-33975946 CCCCGGCCGGCCCGCGCCCTCGG + Intergenic
1137591957 16:49699232-49699254 CAGCGGCTGGCCGGCTCCCCCGG + Intronic
1139505084 16:67394626-67394648 TCCCGGCCGCCCGGCGCCCTGGG + Exonic
1140442500 16:74998878-74998900 CCCCGGCCGGCCTGTGACCTGGG - Intronic
1203081405 16_KI270728v1_random:1147683-1147705 CCCCGGCCGGCCCGCGCCCTCGG - Intergenic
1142670670 17:1486076-1486098 CCGCGGCGGGCCTGGGCGCTGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142868872 17:2807939-2807961 CCTCCGCTGGCCTGCGCCCTGGG + Intronic
1143127996 17:4656777-4656799 GAGCGGCTGGCCGGCGCCCCCGG - Intergenic
1143635708 17:8162821-8162843 CCTGCGCCGGCCGCCGCCCTTGG - Intronic
1144004605 17:11088767-11088789 CCGCTGCCCCCCGGCCCCCTCGG + Intergenic
1144021067 17:11240758-11240780 CCGCCGCAGGCTGGCTCCCTGGG - Intergenic
1144828827 17:18120891-18120913 CCGCCGCCACCCGCCGCCCTGGG + Exonic
1145765543 17:27456333-27456355 CTGCCGCCGGCCTCCGCCCTCGG - Intergenic
1145867690 17:28251282-28251304 CTGCCGCCGGAGGGCGCCCTGGG - Intergenic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1146059686 17:29597948-29597970 CAGCGGCCTGCCAGCTCCCTAGG + Intronic
1147139655 17:38453954-38453976 CCGCGGCCGGCGGGGGCTCCCGG - Intronic
1147705338 17:42421936-42421958 CCGCGGCGCGCTGGCACCCTGGG - Intronic
1148132003 17:45267619-45267641 CCTCAGCTGGCCGGGGCCCTGGG + Exonic
1148323700 17:46771690-46771712 CCGCGGCCGGGCCGCGCCCCCGG + Intronic
1148555849 17:48578104-48578126 ACGCGGCCTGCCGGGACCCTGGG - Exonic
1148733448 17:49851424-49851446 CTGCGCCCACCCGGCGCCCTGGG - Intergenic
1150060505 17:62065110-62065132 CCGGGGCCGGCGGGCGCCGAGGG - Intronic
1151678147 17:75610417-75610439 CCGGGGTAGGCCGGGGCCCTTGG + Intergenic
1152468005 17:80476529-80476551 CCGCGAGCGGCCCGCGCTCTGGG + Exonic
1152528670 17:80904121-80904143 CCTGGGCCGGCCGGAGCCGTGGG - Intronic
1152927711 17:83095195-83095217 CCGAGGCAGGGTGGCGCCCTGGG - Intergenic
1153805492 18:8705935-8705957 CCGCGCCCGGCCGCCTCTCTCGG + Intronic
1153900660 18:9614628-9614650 CCGCGGCAGGCCCGGGCCCTCGG - Intronic
1154161233 18:11981851-11981873 GCGCAGCCGGCGGGCGCCCAGGG + Intronic
1155152909 18:23136268-23136290 CGACGCCCGGCCGGCGCCCAGGG - Exonic
1155657737 18:28210867-28210889 CAGCGGCCGGAAGGAGCCCTGGG + Intergenic
1156495811 18:37524645-37524667 CCGCGGGCGGACGGCGCCAGAGG - Intronic
1157464203 18:47930530-47930552 CCGGGCCCGGCCGGCGGCCCGGG + Exonic
1158976763 18:62716625-62716647 CCGCGCCAGCCCAGCGCCCTCGG + Exonic
1159798223 18:72868195-72868217 CTGCGCGCGGCCGGCGCCCCGGG + Intergenic
1160464894 18:79068743-79068765 CCGCTTCCTGCCCGCGCCCTTGG - Intergenic
1160662736 19:308611-308633 GCGCGGACGGCCGGGGCCATCGG + Exonic
1160719125 19:589882-589904 CCGCCGCCGGCCGGAGCCCGAGG - Exonic
1160813006 19:1021033-1021055 TGGCGGCCGGGAGGCGCCCTCGG - Exonic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1161087298 19:2341029-2341051 CCGCTGCCCGCCGGGGCCCGGGG - Exonic
1161101720 19:2424908-2424930 CAGCGGCCGGCTGGCACCCTGGG - Intronic
1161721336 19:5904325-5904347 CCGCGGCTGTCCCACGCCCTAGG + Intergenic
1161752289 19:6107003-6107025 CCGCGCCCGGCCGGCACCTGTGG - Intronic
1162312386 19:9914668-9914690 CCGCTCCCGGCCCGCTCCCTCGG + Intronic
1162445133 19:10718225-10718247 CCGGGGGCCGCCGGCGCCATGGG + Exonic
1162738128 19:12757909-12757931 CCCCGGCCTGCCGGAGCCCGAGG + Exonic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1162909863 19:13842877-13842899 GCGCGGCCGGCGGCCGCCCCCGG - Intergenic
1165058632 19:33194452-33194474 CCGCGGCCGGCCTGGGCCCGGGG - Intronic
1165419960 19:35717818-35717840 CCGCGGCCGGCCGGCGCCCTCGG - Intergenic
1165445785 19:35856275-35856297 ACTCGGCCGGCCGGGCCCCTCGG - Intronic
1166373147 19:42313518-42313540 CTGCGGCCCGCCGGCCCCCGGGG + Intronic
1167258029 19:48442763-48442785 CCCCGGCGGCCCCGCGCCCTTGG - Exonic
1168445011 19:56404237-56404259 CTGCGGCCGCCCGGGGCCCTCGG + Intronic
925984733 2:9206734-9206756 GCCCGGCCGGCCGCCGCCCCCGG + Intergenic
925984961 2:9207553-9207575 CCGCCGCCCGCCGCCGCCCGGGG + Intronic
926162340 2:10497932-10497954 CCGTGGCCGGCTGGCACCTTGGG - Intergenic
929075499 2:38076280-38076302 CCGAGGCCGGCCGGTGCGCCTGG - Intronic
929313597 2:40452245-40452267 CCGCGGCTGCCGGGCGCCCCGGG + Intronic
930338774 2:50084476-50084498 CAGCGGCCGGCCGGCCCTGTGGG - Intronic
931515451 2:63048426-63048448 TCGCGGGAGGCCGGCGCTCTCGG - Intergenic
931671795 2:64654059-64654081 CCGCGGCCGGCCGCGGCCGCAGG + Intronic
934011597 2:87825508-87825530 CCTCGGCCGGGCGGCGGCCTCGG - Intronic
934636348 2:95992569-95992591 CTGCGGCCGGCCAGCGCCCAAGG + Intergenic
934686446 2:96325332-96325354 CTGCGGCGCGCGGGCGCCCTCGG + Intronic
935622760 2:105143919-105143941 CCGCGGCCGGCCACCCTCCTGGG - Intergenic
936607770 2:113975217-113975239 CTGCGGCTGGCCGGGACCCTAGG + Intergenic
937325649 2:120988433-120988455 GTGCGGGCGGCCGGCGCCCAGGG - Exonic
941934785 2:170974036-170974058 CCCTGGCCGGCCGCTGCCCTTGG + Intergenic
942276383 2:174326729-174326751 GCGCGCCTGGCCCGCGCCCTCGG - Intergenic
944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG + Exonic
946309335 2:218874026-218874048 TCGGGGCCGTCTGGCGCCCTGGG - Exonic
947611934 2:231530171-231530193 CCGCAGCCCCCCGGCGCCCCTGG + Intronic
947748707 2:232522266-232522288 CCGGGGCCGGCCGCCGCCAGGGG - Intronic
948116031 2:235494628-235494650 CCGCCGCCGCCCCGCGCCCCGGG - Exonic
948801558 2:240435633-240435655 CCGCCGCCGGCCCGGCCCCTAGG - Intergenic
1169914747 20:10673920-10673942 CTGCGGCCGGCCCGCGAGCTAGG - Exonic
1170150509 20:13221729-13221751 CCGCCGCCGGCCGCCGCGCCGGG + Intergenic
1170756901 20:19212816-19212838 GGGCGGCCGGGCGGCGGCCTCGG - Exonic
1172118531 20:32584911-32584933 CGGCGGCCGGCCCGCCCCCGAGG - Intronic
1172284637 20:33732128-33732150 CCGCGGCCGCTGCGCGCCCTAGG - Intronic
1174054032 20:47785755-47785777 CCGCGGACGGCTGGGGCCCGGGG + Intronic
1175349858 20:58309944-58309966 CGGCGGCGGGCCCGCGCCCCTGG + Exonic
1176068913 20:63216001-63216023 CGCCGCCCGGCCGGCGCCCGGGG - Exonic
1176129041 20:63488481-63488503 CCCCGCCCGGCCAGAGCCCTGGG - Intronic
1176145302 20:63562747-63562769 CCACGGCCAGCCCACGCCCTGGG - Exonic
1176162095 20:63653239-63653261 CCGCTGCCGGCCGCTGCCCCAGG + Intronic
1176555783 21:8253474-8253496 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176574720 21:8436508-8436530 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176611334 21:8987801-8987823 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1178950326 21:36980610-36980632 GCGCGGCCGCCCGGGGCTCTGGG - Intronic
1179810097 21:43864953-43864975 CCCGGCCCCGCCGGCGCCCTCGG + Intergenic
1180959679 22:19756932-19756954 GCGCGGCGGGGCGGTGCCCTAGG + Intronic
1181811366 22:25405484-25405506 CGGCCGCCGGCCGGCTCCCTGGG - Intergenic
1182667597 22:31970873-31970895 CCGCGGCCGCCAGGCTCCGTGGG + Intergenic
1184106301 22:42369221-42369243 CCGCGGCCGGCCGCTGGCCACGG + Intergenic
1184361956 22:44024251-44024273 CGGCGGCGGGGCCGCGCCCTCGG + Intronic
1184663452 22:45976056-45976078 CCCCGCCCGCCCGGGGCCCTGGG - Intronic
1184786323 22:46673700-46673722 CCCAGGCCGGCCGGTGCGCTGGG - Exonic
1185330752 22:50251136-50251158 CCGCCGCCCGCCTGCGCCCCAGG - Exonic
1185349496 22:50327126-50327148 CAGCGGCCGGGCGCCGCCCAGGG + Intergenic
1203252768 22_KI270733v1_random:125559-125581 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203260824 22_KI270733v1_random:170645-170667 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
950012250 3:9731920-9731942 CCTGGTCCCGCCGGCGCCCTGGG - Exonic
953326201 3:42014006-42014028 CCCCGGCCGCCCGGCGGCTTCGG - Intronic
954393678 3:50280881-50280903 CCGCGCCCGGCCAGCCACCTTGG + Intronic
956414719 3:69013726-69013748 CCTTGGCCAGCCGGCGCCGTGGG + Exonic
956678246 3:71754572-71754594 CAGCGGCCCGACGGCGCCCCCGG + Exonic
956716835 3:72086920-72086942 CCAGGACCCGCCGGCGCCCTGGG - Intergenic
961081687 3:124033476-124033498 CAGCAGGCGGCCAGCGCCCTGGG + Intergenic
961340339 3:126213156-126213178 CCGCGTCCGCCCTGCGCCCTCGG + Intergenic
961599871 3:128052335-128052357 CGGCGGCCGGCGGGCGCGCGTGG + Intronic
962583538 3:136819224-136819246 CCGCCGCCGACCGGCTCCCGGGG - Exonic
964736755 3:159925985-159926007 GCTGGGCCGGCCGGCTCCCTGGG + Intergenic
965763854 3:172109453-172109475 CCGCGCCCGGCCGAAGGCCTTGG + Intronic
966874538 3:184314797-184314819 CCCTGGCGGGCCGGGGCCCTGGG - Intronic
968479169 4:826231-826253 CCGCCCCCGCCCGGCGCCCGCGG - Intergenic
968541860 4:1172040-1172062 CCCAGCCCGGCCGCCGCCCTGGG - Exonic
969361008 4:6663995-6664017 CCGGGGACGGACGGCGCCGTGGG - Intergenic
986402802 5:7396091-7396113 CGGGGGCCGGGCGGCGGCCTCGG - Intergenic
987783379 5:22467073-22467095 CCGTGCCCGGCCTGCTCCCTGGG + Intronic
992400028 5:76403452-76403474 CTGCGCCCCGCCGGCGCGCTCGG - Exonic
997585221 5:135039792-135039814 CCGCCGCCGCCCGTCGCCCGCGG + Intronic
998117526 5:139549437-139549459 GAGCGGCCGGCTGGCGCCGTGGG + Intronic
1001381644 5:171309907-171309929 CCACGGCTGCCCGGGGCCCTGGG - Intronic
1001680774 5:173555391-173555413 CCGCAGCCCGCGGGCGCCATCGG + Intergenic
1002324225 5:178394913-178394935 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324248 5:178395001-178395023 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324271 5:178395089-178395111 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324294 5:178395177-178395199 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324317 5:178395265-178395287 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324339 5:178395353-178395375 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324361 5:178395441-178395463 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324383 5:178395529-178395551 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324405 5:178395617-178395639 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324427 5:178395705-178395727 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324449 5:178395793-178395815 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324471 5:178395881-178395903 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324514 5:178396057-178396079 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324536 5:178396145-178396167 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324558 5:178396233-178396255 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324580 5:178396321-178396343 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324603 5:178396409-178396431 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324626 5:178396497-178396519 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324649 5:178396585-178396607 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324672 5:178396673-178396695 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324694 5:178396761-178396783 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002324716 5:178396849-178396871 CCCCGGCGGGCAGGCGCTCTGGG + Intronic
1002643671 5:180642510-180642532 CCGAGGCCGGCTGGGGACCTGGG - Intronic
1003995815 6:11538227-11538249 CCGCCGCCGCCCGGCACCCGAGG + Intergenic
1006932801 6:37697751-37697773 CCGCCCCCGCCCGGCGGCCTTGG + Exonic
1007656859 6:43455684-43455706 CCGCGGAGGGCCGGGGCCCCGGG - Intronic
1014535778 6:122611119-122611141 CTGCGGCCTGCCGGGGTCCTAGG - Intronic
1015024878 6:128520537-128520559 CCGCGGCCGGCCGGCGACGCTGG - Exonic
1015994830 6:138987494-138987516 CCGGGGCCGGCGGGCGGCTTAGG - Intronic
1017497744 6:154995917-154995939 CCACGCCCGCCCGGCGACCTCGG + Intronic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1017793619 6:157823024-157823046 CCGCCGCCCCCGGGCGCCCTTGG - Intronic
1019343628 7:519643-519665 CCGGGGCCGGGCAGCGCCCGCGG + Intronic
1019588915 7:1819355-1819377 CTGTGGCTGGCGGGCGCCCTGGG + Intronic
1019719316 7:2558951-2558973 GGTCGGCCGGCCGGCGCCCGCGG + Intergenic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1023955652 7:44885001-44885023 CCGCGGCCCGCCGCCCTCCTCGG + Exonic
1027001516 7:74657790-74657812 CCGCGGCAGGCGGGCGGCCGCGG - Intronic
1029424339 7:100486859-100486881 CCGCGGCCGGCCAGGGGCCTGGG + Exonic
1029424846 7:100488956-100488978 CCGGGGCTGGCCAGAGCCCTGGG - Exonic
1032119325 7:129144993-129145015 CCGGAGGCGGCCGGCGCCCGGGG - Exonic
1032710831 7:134458878-134458900 CCGCGGACGCCCGGCGTGCTGGG - Intronic
1034446070 7:151114969-151114991 CCGCCGCCCACCGGCGCCCGCGG + Intronic
1042858883 8:73294455-73294477 CCGCGGACGGCTGGCGGGCTGGG + Intronic
1043464040 8:80487227-80487249 CCGCGGCCGCCCCGAGACCTCGG + Exonic
1045368008 8:101493871-101493893 CCCTGGCCGGCCCCCGCCCTCGG + Intronic
1049668347 8:143858801-143858823 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049668763 8:143860400-143860422 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049669178 8:143862002-143862024 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049669593 8:143863604-143863626 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049670003 8:143865197-143865219 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049798922 8:144508907-144508929 CCGCTGCCTCCCGGGGCCCTCGG - Intergenic
1051513669 9:17906721-17906743 CGGCGGCCGGCAGGCGGGCTCGG - Intergenic
1053003774 9:34591459-34591481 CCGAGGCCGGTCAGCCCCCTGGG - Intergenic
1053129167 9:35605556-35605578 GCGCGGCCTGCCCGGGCCCTGGG + Exonic
1054695678 9:68357182-68357204 CAGCGGCCGGCCGGCGGCGGGGG + Exonic
1057259930 9:93577446-93577468 CCGTGGCCGGCGAGCTCCCTTGG + Intronic
1060139976 9:121201525-121201547 CCGCAGGCGGGCGGCGCCCCGGG - Intronic
1060583113 9:124770204-124770226 CCGGGGCGGGCTGGAGCCCTCGG + Intronic
1061274031 9:129559144-129559166 CCTGGGCTGGCCGGGGCCCTCGG - Intergenic
1062230596 9:135479796-135479818 CCGCGCCCGGGCCGCGCCGTGGG - Exonic
1062268497 9:135698351-135698373 CTGCGGCTTGCCAGCGCCCTGGG - Exonic
1062416794 9:136455263-136455285 CCGTGTCTGGGCGGCGCCCTCGG - Intronic
1062497955 9:136840476-136840498 CCCCGGGCGGCCGCCACCCTGGG + Exonic
1062504016 9:136863683-136863705 CCGGTGCTGGCCGGAGCCCTGGG - Intronic
1203469171 Un_GL000220v1:108710-108732 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203476992 Un_GL000220v1:152682-152704 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1186410760 X:9342766-9342788 GCGCGGGCGGCCGGCGGCGTGGG - Intergenic
1187116730 X:16360005-16360027 CCTCGGCCGGCCAGAGCGCTGGG + Intergenic
1190324858 X:49200100-49200122 CCGCCGCCGCCCGGCTGCCTAGG - Intronic
1190862426 X:54357655-54357677 CCCGGGCCGGCCGGGGCGCTAGG - Intronic
1199724748 X:150568897-150568919 CCGCCGCCGGCCGGCCACCTTGG - Intronic
1200100811 X:153688460-153688482 CCCCGGCCGGCCCGCGCCCTCGG + Exonic
1200147620 X:153934792-153934814 CCGGGCTCGGCCGGGGCCCTCGG + Intronic