ID: 1165419983

View in Genome Browser
Species Human (GRCh38)
Location 19:35717882-35717904
Sequence CAGCGCCGCCGCGGGAGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165419983_1165419988 -3 Left 1165419983 19:35717882-35717904 CCCGGTCTCCCGCGGCGGCGCTG 0: 1
1: 0
2: 0
3: 18
4: 116
Right 1165419988 19:35717902-35717924 CTGGTTGTTGTCGTGCGCCGCGG 0: 1
1: 0
2: 1
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165419983 Original CRISPR CAGCGCCGCCGCGGGAGACC GGG (reversed) Intergenic
900503548 1:3018160-3018182 CAGCGTCGCCCCGGGTGTCCAGG + Intergenic
903153269 1:21428165-21428187 CCGCGCCGCTGCGGGCGGCCTGG + Intergenic
903184706 1:21622524-21622546 CAGCGCCGCCGCCGGGAGCCGGG - Intronic
904334562 1:29788175-29788197 CAGGGCAGCCACGGGAGGCCAGG - Intergenic
904942847 1:34177171-34177193 CAGAGCAGCAGCGGGAGACCGGG + Intronic
905803870 1:40862199-40862221 CTGCTCTGCGGCGGGAGACCCGG + Exonic
906202673 1:43970207-43970229 CGGCGCTGCAGCGAGAGACCGGG + Exonic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
910237009 1:85047438-85047460 GAGCGCCGGCGCGGGAGGCAGGG + Intronic
910251199 1:85200915-85200937 CAGCTTCCCCGCGGGAGCCCGGG - Exonic
912619519 1:111140564-111140586 GAGCGCCGGCGCGGGAGCCGGGG + Intronic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
923913223 1:238472748-238472770 CAGCCCTGCCTTGGGAGACCAGG - Intergenic
924436783 1:244049184-244049206 CGGCGCAGCTGCGGGAGGCCCGG + Intronic
1062813871 10:485102-485124 CAGGGCCACCGCGGGAGGCACGG + Intronic
1063429766 10:5977977-5977999 CAGGGCCGCGGAGGGAGACCAGG - Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1072294177 10:93993821-93993843 TAGCGCCACCGCGGGCGGCCGGG - Intergenic
1072654321 10:97319710-97319732 CAGCGGCACCGCCGGGGACCTGG - Exonic
1075571629 10:123550673-123550695 CAGAGCCGGTGCAGGAGACCCGG - Intergenic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1081484383 11:43516423-43516445 CAGAGCCACTGGGGGAGACCGGG - Intergenic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1084935565 11:72584810-72584832 CAGCGCCGCCGGCGGACTCCCGG + Intronic
1086064841 11:82733580-82733602 CAGCGCACCCGCCGGAGCCCCGG + Exonic
1103779396 12:123389107-123389129 CAGCGCCGCCGCGGCGCCCCGGG - Intronic
1105000646 12:132687830-132687852 CCGCGCCGCTGCGGCCGACCTGG - Intronic
1107372854 13:39771429-39771451 CAGCGCTCCCCAGGGAGACCCGG + Intronic
1107898498 13:44989326-44989348 CTGCCCCGCCGCGGGACAGCTGG - Exonic
1116945397 14:50831028-50831050 CGGCGCCGCCGCGGGAACCATGG + Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122789546 14:104178546-104178568 AGGCGCCGCCGCTGCAGACCTGG - Exonic
1123068011 14:105627890-105627912 CAGAGCCGCCGCAGGTGAGCAGG - Intergenic
1123112552 14:105880096-105880118 CAGCGCCGTCAGGGGGGACCGGG + Intergenic
1125516414 15:40323682-40323704 CCGCGCGGCCACTGGAGACCAGG + Intergenic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1138265475 16:55656849-55656871 ACGCGCAGCCCCGGGAGACCTGG + Exonic
1139446307 16:67000787-67000809 GACCGCGGGCGCGGGAGACCTGG - Intronic
1141132185 16:81444467-81444489 CCGCGCCCCCGCGGGTGCCCGGG - Intergenic
1141741867 16:85898922-85898944 CAGCGCCGCCCCTGGACCCCAGG + Exonic
1141911753 16:87064897-87064919 CAGAGGCGCCGGGGAAGACCGGG + Intergenic
1142412474 16:89923579-89923601 CAGCGCCGCGCCGGGCGGCCGGG + Intronic
1142688856 17:1592858-1592880 CAGGGGAGCAGCGGGAGACCAGG + Intronic
1143155428 17:4833453-4833475 CCGCGCCTCCCCCGGAGACCGGG - Exonic
1144953154 17:19004655-19004677 CGGCGACGCCCCGCGAGACCCGG + Intronic
1147156799 17:38548073-38548095 CAGCTCCAGTGCGGGAGACCTGG - Intronic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1151370702 17:73644764-73644786 CAGCGCCCCCGGAGGAGACCCGG - Intergenic
1151850807 17:76688486-76688508 CAGCGTCGCAGTGGGAGTCCTGG - Intronic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1160329759 18:77980479-77980501 CAGCACCCCTGCGGGACACCAGG - Intergenic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1163282340 19:16325392-16325414 CAGCGCCCCCGCGGGTGGCCTGG + Exonic
1164539407 19:29111765-29111787 CAGCCCCGCCAAGGGAGGCCAGG - Intergenic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
925436975 2:3846929-3846951 CAGAACCGCCGCAGGAAACCTGG - Intronic
932385907 2:71332235-71332257 CAGCGCAGCCTCGGCAGGCCGGG - Intronic
932562743 2:72887407-72887429 CAGCGCCGCCGGCGGAGAACAGG + Exonic
933704801 2:85281716-85281738 CAGGCCTGGCGCGGGAGACCTGG - Intronic
933769609 2:85734691-85734713 CAGGGCTGCTGCGGGAGCCCAGG + Intergenic
934763629 2:96869108-96869130 GAGCCCCGGCGCGGGAGAGCGGG + Intronic
938073112 2:128318678-128318700 CCGCGCCGCTGCGGGCGGCCTGG - Intergenic
948248696 2:236507641-236507663 CTGCGCCACCGCGGGAGGCCTGG + Intergenic
1169143492 20:3238662-3238684 CGGCGCCGCGGTGGGAGCCCCGG - Intronic
1171473561 20:25390614-25390636 CAGCGCCGCGGCGGCCGAGCCGG + Exonic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1179495231 21:41767056-41767078 CAGCGCCGCGGCGGCTGCCCAGG + Exonic
1179549872 21:42137223-42137245 CAGCGCAGCCTGGGGAGGCCTGG - Intronic
1183423726 22:37726320-37726342 CAGCGCCTCCCGGGGAGACCAGG + Exonic
1183531009 22:38353347-38353369 CAGCCCCGCCCCGCGTGACCAGG - Intronic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184676265 22:46045023-46045045 CAGCGCCGCCGGGCGAGGGCGGG - Intergenic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
954004218 3:47578866-47578888 CAGCGGCGGCGCGGGAGGCGGGG - Exonic
954200562 3:49021133-49021155 CAGAGCAGCCGCGGGACCCCCGG + Exonic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
961144770 3:124584723-124584745 CAGCGCCGCCGCCCGAGAGCCGG - Intronic
961346556 3:126267240-126267262 CAGCGCCGCCGGGACACACCGGG - Intergenic
966794130 3:183697964-183697986 CCGCGCTGCAGCCGGAGACCCGG + Exonic
968674491 4:1870604-1870626 CAGCGCCGCTGCGGTAGAGCCGG - Intergenic
969447993 4:7256263-7256285 CAGGGCCGCCACGAGGGACCAGG + Intronic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
973931035 4:55793560-55793582 CAGCCCCACCGCGGGAGACGGGG + Intergenic
985996385 5:3599569-3599591 CAGCGACACCGAGGGCGACCCGG + Exonic
986190751 5:5494571-5494593 CAGTGCAGCCCCGGGAGAACAGG - Intergenic
988547808 5:32174353-32174375 CAGAGTCGGCGCGGGAGAGCTGG + Intergenic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
990308799 5:54518558-54518580 CCGAGCCGCCGCGGGAACCCAGG - Exonic
991436085 5:66597584-66597606 CAGCGCCACCGAGGGAGCGCGGG - Intronic
993519593 5:88884126-88884148 GCGCGCCGCAGCGGGAGACTAGG - Intronic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
994175117 5:96702719-96702741 CGGCCCCGCCCCGGGAGCCCGGG - Intronic
1005470253 6:26156316-26156338 CAGCGCCGCGGCTCGAGTCCCGG + Intergenic
1007347130 6:41239694-41239716 CTGCGCCCCCGCGGGAGCCCGGG - Intergenic
1008941110 6:57046737-57046759 CAGCGCGGCCGTCGGAGACATGG + Exonic
1008945298 6:57090235-57090257 CAGCGCGGCCGTCGGAGACATGG + Exonic
1009622440 6:66094799-66094821 CTGCCCCGCCGCGGGACAGCTGG - Intergenic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1013099167 6:106973712-106973734 CCGCGCCGGCGAGAGAGACCGGG - Exonic
1015964268 6:138682764-138682786 CAGCGCAGCCGGGTGAGGCCAGG - Intronic
1016982188 6:149863886-149863908 CAGCGGCGCCGCGGGCGGCAAGG + Exonic
1017954829 6:159169306-159169328 CAGGGCCGGCGGGGGCGACCCGG - Intergenic
1019198372 6:170295640-170295662 CGGCTGCGCCGCTGGAGACCCGG + Intronic
1019536878 7:1533862-1533884 CAGGGCGGCCGGGGGAGAACAGG + Intronic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1025017227 7:55449329-55449351 CAGTGGCGCCGCGGGAGACTGGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1031025237 7:116672380-116672402 CAGCCCGGCCGCAGGTGACCCGG + Intronic
1031966800 7:128032590-128032612 CAGCCCCGCCGCGGGCCGCCGGG - Intronic
1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG + Intronic
1035314586 7:157990215-157990237 GAGCGCCACCGGGGAAGACCGGG + Intronic
1043148066 8:76681054-76681076 CAGCGCTGCGGCTGGAGCCCCGG - Intergenic
1044257518 8:90082790-90082812 CAGGGCTGCGGAGGGAGACCTGG + Exonic
1044569386 8:93700514-93700536 TCGCGCCGCCGCGGCAGGCCGGG - Exonic
1049098008 8:140560236-140560258 CAGCGCCGCTGCGTGACACCTGG - Intronic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049647000 8:143739966-143739988 CCGCGCCGCTGTGGGTGACCGGG + Intergenic
1051079689 9:13279656-13279678 CACCGCCTCCGCGGCAGCCCCGG - Intergenic
1057277557 9:93684071-93684093 CAGCGCTGCCTTGGGCGACCAGG + Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1060114379 9:120928924-120928946 CAGCCCAGCCGCGGGCGCCCCGG - Intronic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1186823362 X:13313824-13313846 CAGAGCCTCCGAGGGATACCTGG - Intergenic
1190101135 X:47523822-47523844 CAGCGCTGCGGCGGGAGAGGGGG + Intergenic
1190618436 X:52262201-52262223 CAGCGCCCCCGGGGCTGACCAGG + Intergenic
1190952626 X:55161526-55161548 CAGCGCCCCCGGGGCTGACCAGG + Intronic
1192817980 X:74614284-74614306 CAGCGCCGCCTCCGGACCCCAGG - Intronic
1195711017 X:107774065-107774087 CATCGCCACTGTGGGAGACCTGG - Intronic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic