ID: 1165420047

View in Genome Browser
Species Human (GRCh38)
Location 19:35718049-35718071
Sequence CCCCGCGCGGAGCCAGGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 382}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165420047_1165420074 28 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420074 19:35718100-35718122 GGCGGGGGCGGGGGCCGCGGCGG 0: 1
1: 11
2: 237
3: 2230
4: 5690
1165420047_1165420062 10 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420062 19:35718082-35718104 GGCCGGCCGCGGGGCGCCGGCGG 0: 1
1: 0
2: 14
3: 77
4: 598
1165420047_1165420054 -7 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420054 19:35718065-35718087 CGCGGGGCCGCTTCCCGGGCCGG 0: 1
1: 0
2: 1
3: 28
4: 271
1165420047_1165420072 25 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420072 19:35718097-35718119 GCCGGCGGGGGCGGGGGCCGCGG 0: 1
1: 2
2: 60
3: 668
4: 4242
1165420047_1165420063 11 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420063 19:35718083-35718105 GCCGGCCGCGGGGCGCCGGCGGG 0: 1
1: 0
2: 5
3: 67
4: 514
1165420047_1165420068 16 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420068 19:35718088-35718110 CCGCGGGGCGCCGGCGGGGGCGG 0: 1
1: 0
2: 12
3: 134
4: 1112
1165420047_1165420057 0 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420057 19:35718072-35718094 CCGCTTCCCGGGCCGGCCGCGGG 0: 1
1: 0
2: 1
3: 26
4: 205
1165420047_1165420071 19 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420071 19:35718091-35718113 CGGGGCGCCGGCGGGGGCGGGGG 0: 1
1: 1
2: 86
3: 716
4: 4010
1165420047_1165420070 18 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420070 19:35718090-35718112 GCGGGGCGCCGGCGGGGGCGGGG 0: 1
1: 4
2: 65
3: 373
4: 2006
1165420047_1165420069 17 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420069 19:35718089-35718111 CGCGGGGCGCCGGCGGGGGCGGG 0: 1
1: 1
2: 25
3: 215
4: 1259
1165420047_1165420065 12 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420065 19:35718084-35718106 CCGGCCGCGGGGCGCCGGCGGGG 0: 1
1: 0
2: 6
3: 62
4: 506
1165420047_1165420066 13 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420066 19:35718085-35718107 CGGCCGCGGGGCGCCGGCGGGGG 0: 1
1: 0
2: 15
3: 128
4: 882
1165420047_1165420061 7 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420061 19:35718079-35718101 CCGGGCCGGCCGCGGGGCGCCGG 0: 1
1: 2
2: 19
3: 104
4: 712
1165420047_1165420055 -1 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420055 19:35718071-35718093 GCCGCTTCCCGGGCCGGCCGCGG 0: 1
1: 0
2: 3
3: 76
4: 395
1165420047_1165420058 1 Left 1165420047 19:35718049-35718071 CCCGGGCCTGGCTCCGCGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1165420058 19:35718073-35718095 CGCTTCCCGGGCCGGCCGCGGGG 0: 1
1: 0
2: 1
3: 25
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165420047 Original CRISPR CCCCGCGCGGAGCCAGGCCC GGG (reversed) Exonic
900100803 1:961193-961215 GCCCGCGGGGACCCAGCCCCTGG - Intronic
900157032 1:1207232-1207254 CCCCGCGGGCACCCAGGGCCCGG + Intergenic
900191886 1:1355566-1355588 CGCCGCGCGGGGCCACCCCCGGG + Exonic
900291044 1:1923721-1923743 CCCTGCGTGGGGCCAGGGCCGGG + Intronic
900396462 1:2455099-2455121 CCCCCAGCGGAGCCGGGACCTGG + Intronic
900663190 1:3796259-3796281 CCCTGCGCCAGGCCAGGCCCCGG + Exonic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
901086490 1:6614599-6614621 CCCCGCGCGGAGTCAGGGGGCGG - Intronic
901577365 1:10211126-10211148 TCCCCCGCGCTGCCAGGCCCCGG + Intronic
901805622 1:11736605-11736627 CCCCGCGCGGGGTCAGGGACTGG + Intronic
903283523 1:22263512-22263534 CCCCGCTAGATGCCAGGCCCTGG + Intergenic
903670373 1:25031753-25031775 CCCTGCTTGGAGCCAGGCACTGG + Intergenic
903760435 1:25694329-25694351 CCCTGCTCTGAGCCAGCCCCAGG + Intronic
903953907 1:27012141-27012163 CCCCTCTCCCAGCCAGGCCCTGG + Intronic
903986819 1:27234782-27234804 CCCCGCCCGGCGCCTGGCCGGGG - Exonic
904306224 1:29592066-29592088 CCCGGCTCAGAGCCAGGCACAGG - Intergenic
904500075 1:30908390-30908412 CCCCGCGCGGGGGGCGGCCCCGG + Intronic
904831107 1:33307325-33307347 CCCCGCGTGGCGCTGGGCCCGGG - Exonic
905037786 1:34929256-34929278 GCCCGCGGGCAGCCAGGCCGGGG + Intronic
905202148 1:36322594-36322616 CCCGGCGCTGAGCCGGGCCCCGG + Exonic
905442780 1:38005561-38005583 CCCCGCCCGGACCCCGCCCCCGG + Intronic
905626346 1:39492389-39492411 CCGCGGGCGGTGCCGGGCCCTGG + Intronic
907241106 1:53081565-53081587 GCCAGCGCTGAGCCAGGCCAGGG - Intronic
908293153 1:62688093-62688115 CCCCGCCGCGAGCCAGGCCGCGG + Intronic
908534623 1:65066662-65066684 CCCCGCGCGGCGCCGGGGACCGG - Intergenic
908842928 1:68296627-68296649 GCCCTCAGGGAGCCAGGCCCAGG - Intergenic
910288139 1:85576863-85576885 TCCCGCGCGGAGGGAGGCCTGGG + Intronic
910388079 1:86705487-86705509 CCCCGCGGGCTGCCAAGCCCAGG - Intronic
915322619 1:155064027-155064049 CCCGGCGCGCGGCCAGGCTCAGG - Intronic
915937838 1:160099112-160099134 CCTCGGGCGGAGCCAGGGCCAGG - Intergenic
916694509 1:167221635-167221657 CCCCGCGCGGGGCTGAGCCCGGG + Intronic
916717193 1:167455733-167455755 CCCGGCGCAGATCCACGCCCTGG - Intronic
917920040 1:179743499-179743521 CCCCGCGCGGAGCCCGAGCCCGG - Intronic
920095378 1:203483279-203483301 CCGGGCGCAGACCCAGGCCCAGG + Exonic
920385616 1:205568840-205568862 CCCCGTGCGGTGCCAGGCGCCGG - Intergenic
921219112 1:212960814-212960836 CCCCCCACCGAGCCTGGCCCAGG - Intronic
922472934 1:225887851-225887873 CCCCGCGCAGCGCCCGGGCCCGG - Exonic
922739362 1:228006867-228006889 CCCCGCCCGGGCCCCGGCCCCGG + Intergenic
922765261 1:228153060-228153082 GCCCCCAGGGAGCCAGGCCCGGG - Intronic
923295862 1:232594430-232594452 CACCGAGCGGAGCCAGGGCGGGG + Intergenic
923622231 1:235588349-235588371 CCCCGCTGGGGGCCAGGTCCAGG - Intronic
924415380 1:243850966-243850988 ACGCGCGCGCCGCCAGGCCCCGG + Intronic
924624812 1:245689010-245689032 CCCCGCGGGGTGCCGGGCCGTGG - Intronic
1062874452 10:932529-932551 CCCACCGGGGACCCAGGCCCCGG + Intergenic
1063249647 10:4259941-4259963 CCCAGCCCAGAGACAGGCCCTGG - Intergenic
1063593120 10:7410881-7410903 CTCGGCGTGGACCCAGGCCCCGG + Intronic
1065092940 10:22252821-22252843 CCCGCCGCGGCGCCTGGCCCAGG + Intergenic
1069819279 10:71217559-71217581 CCCCGCGGGCAGACAAGCCCGGG + Intronic
1070147549 10:73785828-73785850 CCCCCCGCGGATCCGGGGCCTGG - Exonic
1070160891 10:73866109-73866131 CCCAGGCCAGAGCCAGGCCCTGG + Intronic
1071695067 10:87862456-87862478 GGGCGCGCGGAGCCTGGCCCCGG + Exonic
1072619978 10:97073459-97073481 CCCCGGGCTGGGACAGGCCCTGG - Intronic
1076639007 10:131901336-131901358 CCCCGCGCCGCGCCCCGCCCCGG + Intronic
1076674788 10:132142263-132142285 CCCAGAGCGGTGCCAGGCACAGG + Intronic
1076750003 10:132537762-132537784 CGCCCCGCGGAGCCGAGCCCGGG - Intergenic
1076793276 10:132787571-132787593 GCCCCCGCGGAGCCTGGCCCGGG + Intergenic
1076885176 10:133258857-133258879 CCCCTCTCGAAGCCAGGCCAGGG - Intergenic
1076915930 10:133423208-133423230 CCCCGAGCCCAGCCAGGCCTAGG + Exonic
1077021057 11:417337-417359 CCCCGCCCGGCGCGAGCCCCAGG - Intronic
1077063227 11:626741-626763 ACCCGCGCTGAGCCTGGTCCAGG + Exonic
1077121560 11:911108-911130 CCCCGCGCGGCCCCACGCCAAGG - Intronic
1077367317 11:2166424-2166446 CCCGGCGCCAAGCCAGCCCCTGG + Intronic
1077900158 11:6481250-6481272 CCCCTCAGGGCGCCAGGCCCGGG + Exonic
1078570301 11:12452179-12452201 CCCTGCCTGGAGGCAGGCCCTGG - Intronic
1079240959 11:18721762-18721784 CCCTGCCCGGGGCCAGGCCCAGG - Intronic
1082783462 11:57303641-57303663 TCCGGCGCGTAGCCAGGCTCTGG - Intronic
1083273036 11:61581405-61581427 CCCTGCCCGGTGCCAGGCCGCGG - Intergenic
1083307842 11:61770132-61770154 CCCCGTCCTGAGCCAAGCCCGGG - Intronic
1083309652 11:61777713-61777735 ACCTGCGGGGAGCCAGGCCCGGG - Exonic
1083329658 11:61891609-61891631 CCCCGCCCCCGGCCAGGCCCCGG + Intronic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1084212292 11:67629828-67629850 CCGCGCGCGGAGCCGGGCCGTGG + Exonic
1084296182 11:68214320-68214342 GCCCGCGGGGGGCCAGGCCAAGG - Intergenic
1084310423 11:68313139-68313161 CCCCGCTCGGTGCCCGGCCCGGG - Intronic
1084598797 11:70132844-70132866 CCCGGCGTGGGGCCAGGCCTGGG - Intronic
1085280418 11:75326281-75326303 ACCCACGCTGTGCCAGGCCCTGG - Intronic
1085300501 11:75455675-75455697 GCCCACGGGGAGCCAGGCTCTGG + Intronic
1085485637 11:76860853-76860875 CCCCTCGGGGAGGCAGGGCCGGG + Exonic
1085531921 11:77197053-77197075 CAGCGTGCGGAGCCAGGTCCTGG - Intronic
1086818604 11:91406128-91406150 CCCAGAGCTGAGCAAGGCCCAGG - Intergenic
1087014436 11:93542653-93542675 CCCAGCTCGGAGCCTGCCCCGGG + Intronic
1089046111 11:115503564-115503586 CCCCCCGCGGGGCCGGGCCGGGG + Intronic
1089659710 11:119977961-119977983 CCCAGCACAGAGCCTGGCCCAGG - Intergenic
1089966197 11:122656364-122656386 CCCCGCCCGGAGCCGAGTCCCGG - Intronic
1091154604 11:133361532-133361554 CCCGGCGCGCAGACAGGTCCGGG + Intronic
1091603977 12:1935020-1935042 CCCTGCTGGCAGCCAGGCCCGGG + Intergenic
1091687940 12:2577024-2577046 CCCCTCGTGATGCCAGGCCCTGG + Intronic
1091784112 12:3231891-3231913 CCCCACTGAGAGCCAGGCCCAGG - Intronic
1093195042 12:16120819-16120841 CCAGGTGGGGAGCCAGGCCCGGG - Intergenic
1093894817 12:24563321-24563343 CGCGGCGCGGAGCCTGGCTCTGG - Intergenic
1096469812 12:51869068-51869090 CTCCTCGTGGAGCCAGGCCTTGG - Intergenic
1097195549 12:57240775-57240797 CCCCACGCGGAGGCACACCCGGG + Intergenic
1100565494 12:95790473-95790495 CCCCGCGCGGTCCCGGCCCCTGG - Exonic
1101021884 12:100561106-100561128 CACCGCGCCCAGCCAGGCCAGGG - Intronic
1101593025 12:106139599-106139621 CCCCGCGGGGTGCCAGCCTCGGG - Exonic
1101970730 12:109310104-109310126 CCCCGCCTGGAGCCAGCCGCGGG + Intergenic
1103445778 12:120994315-120994337 CCCCCCCCAGGGCCAGGCCCGGG + Exonic
1103649704 12:122422824-122422846 CCCCGGGAGGACCCTGGCCCCGG + Intergenic
1103916684 12:124379375-124379397 CCCCACGCTGAGCCAGGCAGAGG + Intronic
1104906538 12:132216463-132216485 CCCAGCGAGGAGCCAGGACCTGG + Intronic
1105011912 12:132761836-132761858 CCCCGCGCCGCGCCCGTCCCAGG + Exonic
1105418365 13:20232213-20232235 CCCCGCGCAGAGCCCGCGCCAGG - Exonic
1105578862 13:21675419-21675441 CCCCGCCCGGAACGAGGCCGCGG + Intronic
1106250831 13:27980457-27980479 CTCCGCGCTCACCCAGGCCCAGG + Intronic
1106308284 13:28532458-28532480 CGCAGCGCGGCGCCAGGCTCGGG + Intergenic
1107567227 13:41617643-41617665 CCCCGCCCTGTGACAGGCCCTGG + Intronic
1107604001 13:42040729-42040751 CCCCGCCCGGGGCCAGCCACCGG - Intronic
1108688969 13:52845992-52846014 CCGCCCGGGGAGCCGGGCCCAGG - Exonic
1110208756 13:72948065-72948087 CCCCACCCCGAGACAGGCCCTGG - Intronic
1112290724 13:98142846-98142868 CGCCGCGCGGAGCCCGGCCCTGG + Intronic
1112344128 13:98576617-98576639 GCGCGCGGGGAGCCAGGCTCCGG + Intronic
1113660781 13:112105170-112105192 CCCCGGGCACAACCAGGCCCAGG - Intergenic
1113741850 13:112716599-112716621 CCCAGCCCCGAGCCAGGCTCTGG - Intronic
1113765201 13:112876829-112876851 CACCGCTGGGAGCCAGCCCCCGG - Intronic
1114265287 14:21069970-21069992 TCCCGCGGGGAGCGAGGCCGTGG + Intronic
1115030217 14:28785500-28785522 ACCCGCGTGGCTCCAGGCCCAGG + Intronic
1115399134 14:32938794-32938816 TCCCGCGGGCAGCCCGGCCCAGG - Intronic
1115592293 14:34875265-34875287 CCCCGCGCGGAGTCGGGCAGTGG - Exonic
1118220889 14:63853513-63853535 CCCCTCCCGGGCCCAGGCCCCGG + Intronic
1118888549 14:69887683-69887705 CCCAGAGCAGACCCAGGCCCTGG + Intronic
1121547589 14:94773080-94773102 AGCCGCGCGGAGGCAGGCCCCGG + Intergenic
1122162240 14:99793165-99793187 CCCCGCGGGGAGCGCGGCCCGGG - Intronic
1122226898 14:100285591-100285613 CCCCGCGCGGAGTGAGCCCAGGG + Intergenic
1122415671 14:101548496-101548518 ATGCGTGCGGAGCCAGGCCCTGG + Intergenic
1122624128 14:103075553-103075575 CTCCGCGCGGGCCCCGGCCCTGG + Intergenic
1122834267 14:104423425-104423447 CCCCTCGCTGGGCCAGACCCTGG - Intergenic
1122878877 14:104681084-104681106 CTCCTCCCCGAGCCAGGCCCTGG + Intergenic
1123038304 14:105480245-105480267 CCCCACTAGCAGCCAGGCCCAGG - Intergenic
1124477069 15:30044658-30044680 CCCCGCTCGCCGCCAGGGCCCGG - Intergenic
1126639695 15:50812198-50812220 CTCCCCGCGGGGCCAGGCTCAGG + Intergenic
1128404548 15:67322572-67322594 CCCAGGGCTGAGCAAGGCCCAGG - Intronic
1129116625 15:73368485-73368507 CCCCGCGCCCAGCCGGGCCCGGG - Exonic
1129483379 15:75844425-75844447 AGCAGCGCGCAGCCAGGCCCGGG - Intronic
1130411738 15:83653872-83653894 CGCCGTGTGGGGCCAGGCCCGGG - Intergenic
1130956229 15:88629300-88629322 CCACCCTCGGAGCCAGACCCGGG + Exonic
1131431713 15:92393787-92393809 CTGCGCGCGGAGCCGGGCGCGGG + Intergenic
1132178471 15:99733555-99733577 CCCCGCCCCGAGCCCCGCCCCGG - Intronic
1132466184 16:78312-78334 GCCCGCGCGCAGCGGGGCCCAGG + Exonic
1132498866 16:275961-275983 CCCCGCGCCGCGCCGCGCCCGGG + Intronic
1132508013 16:322184-322206 CCCTGCCCTGAGCCAGGCCTGGG - Intronic
1132567519 16:630277-630299 TCCCACGCGGAGCCACGTCCAGG + Intronic
1132683599 16:1153387-1153409 CCCCGCTCGGCGCCCGGCCCCGG - Exonic
1132728578 16:1349546-1349568 CCGCGCTCGGCGCCAGGCCCTGG + Exonic
1132745933 16:1436303-1436325 CCCGGTGCTGGGCCAGGCCCGGG + Intronic
1132827860 16:1913959-1913981 CACCCCGCAGAACCAGGCCCTGG + Intronic
1132831417 16:1930064-1930086 TGCCGCGCAGAGCCTGGCCCTGG - Intergenic
1132865597 16:2091350-2091372 CCCCTCGCGGGGCCCCGCCCCGG - Intronic
1132915727 16:2342084-2342106 CCCCGCGCCCAGCCAGCCGCCGG + Intergenic
1133097540 16:3457881-3457903 CTCCGTGCGAAGCCAGGCCCAGG - Intronic
1133212924 16:4273123-4273145 CCCCGGGCGGCGCGAGGCCGGGG + Intergenic
1133336071 16:5007478-5007500 CCCCACGAGGTGCCAGGGCCTGG + Exonic
1134077970 16:11305446-11305468 CACCACGCCCAGCCAGGCCCGGG - Intronic
1134849793 16:17470601-17470623 CCCGGCGCGGGGCCGGGGCCGGG + Exonic
1135322605 16:21507319-21507341 CCCCTAGCGGAGCCAGCACCTGG + Intergenic
1135775903 16:25257563-25257585 CCCCGCCCGGCGCCAGGTTCCGG + Exonic
1136115344 16:28091049-28091071 CTCAGCCCGCAGCCAGGCCCAGG + Intergenic
1136267916 16:29131803-29131825 CCCCTCTAGGAGCCTGGCCCTGG - Intergenic
1137475972 16:48810718-48810740 CCCTGCGCCCACCCAGGCCCGGG + Intergenic
1138341732 16:56294133-56294155 CCCCTCGCAGAGCCTGGCCTAGG - Intronic
1139534569 16:67563195-67563217 CCGCGCGCTAAGCCAGGTCCCGG + Intronic
1141110914 16:81270054-81270076 CCCCGCCAGGAGCTAGGCTCAGG - Intronic
1141749315 16:85947651-85947673 CCACGGGTGGAGCCAGGTCCGGG + Intergenic
1141879491 16:86848325-86848347 CTCCCCGAGGAGCCAGGGCCTGG + Intergenic
1141972253 16:87492264-87492286 CCCCGCGCGGTCCCCGGCCCCGG - Intergenic
1142034850 16:87856548-87856570 CCCCTAGCGGAGCCAGCACCTGG + Intronic
1142071223 16:88092141-88092163 CCCCTCTAGGAGCCTGGCCCTGG - Intronic
1142148074 16:88500844-88500866 CCCTGGGCTGAGCCAGGTCCTGG + Intronic
1142420053 16:89964459-89964481 CCCCCAGCGGTGCCAGGCCAAGG + Exonic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1142743965 17:1945917-1945939 GCCTGCTAGGAGCCAGGCCCTGG - Intronic
1142746203 17:1959849-1959871 CACCGCGCCCAGCCAGGCTCAGG + Intronic
1142763829 17:2055399-2055421 CCCGGCGCGGAGCCGCGGCCCGG - Intronic
1143059201 17:4185847-4185869 CCCCGCCCGGACCTAAGCCCCGG + Intronic
1143443902 17:6996146-6996168 CCCGGAGAAGAGCCAGGCCCCGG - Exonic
1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG + Intronic
1144991757 17:19237978-19238000 CCCCGTGCAGAGCCCGGTCCGGG + Intronic
1145991294 17:29080794-29080816 CCCAGGGAGGAGCCATGCCCAGG - Intronic
1146909855 17:36641656-36641678 CCCCGCTCGGAGCCCAGACCCGG + Intergenic
1147210315 17:38869554-38869576 CCCTGCGCGCTGCCGGGCCCGGG - Intergenic
1147425054 17:40342325-40342347 CCCCGCGCTGATCCCGCCCCCGG + Intronic
1147742559 17:42677139-42677161 CCGCGCCCGGCGCCAGGCACAGG - Intergenic
1148553454 17:48564254-48564276 CCCCGCGCGCACCCAGCGCCCGG - Intronic
1151979214 17:77498925-77498947 GCCCTCGGGGAGCCAGGCCTGGG - Exonic
1152049277 17:77959379-77959401 CCGCGTGCGGCGCCAGGCCCCGG + Intergenic
1152077580 17:78168822-78168844 CCCCGCTCGCCGCCAGGCCCCGG - Intronic
1152681887 17:81672716-81672738 CCCAGAGCGTGGCCAGGCCCCGG - Exonic
1154303922 18:13217528-13217550 CCCGGCGCGCGGCCAGGCCGCGG - Intronic
1154491530 18:14925778-14925800 CAGCGCCTGGAGCCAGGCCCCGG + Intergenic
1155053244 18:22165760-22165782 GACCGCGCGGAGCCAGCGCCGGG - Intergenic
1157529271 18:48408415-48408437 CCCCGCGCGGCGACAGGCACCGG + Intronic
1157614780 18:48979843-48979865 CCCAGCACTGAGCCAGGGCCTGG - Intergenic
1157617467 18:48995629-48995651 GCCCGCCTGGAGCCAGGCCGGGG + Intergenic
1158606195 18:58898561-58898583 ACCAGCCCTGAGCCAGGCCCCGG + Intronic
1158629472 18:59099699-59099721 CCCCGCACTGAGTCAGACCCCGG - Intergenic
1159937692 18:74382111-74382133 CCCCGTGCGGATGGAGGCCCTGG - Intergenic
1160543568 18:79638462-79638484 CCCGGCGCGGACCCCGGCGCTGG - Intergenic
1160697386 19:491676-491698 CCCTGGGCGGAGACAGCCCCAGG + Intronic
1160697443 19:491809-491831 CCCTGGGCGGAGACAGCCCCAGG + Intronic
1160697526 19:492008-492030 CCCTGGGCGGAGACAGCCCCAGG + Intronic
1160697593 19:492173-492195 CCCTGGGCGGAGCCAGCCCCAGG + Intronic
1160957241 19:1699376-1699398 CCCCGCTGGGAGGGAGGCCCTGG + Intergenic
1161004844 19:1930018-1930040 CCACGCCCGGACCCAGGCCTGGG + Intergenic
1161065642 19:2236088-2236110 CCCCGCCCAGACCCCGGCCCCGG + Intronic
1161068994 19:2251198-2251220 CTCCGCGCCGCGCCTGGCCCTGG + Exonic
1161295280 19:3516594-3516616 CCCCGGGAGGCCCCAGGCCCGGG + Intronic
1161400636 19:4065307-4065329 CCCGGGGCTGAGTCAGGCCCGGG + Intronic
1161401414 19:4067445-4067467 CCCCCCGCAAGGCCAGGCCCTGG + Intergenic
1161517417 19:4704102-4704124 CCCCGCACACAGCCAGGGCCAGG + Intronic
1161576674 19:5058345-5058367 CCCAGAGCAGTGCCAGGCCCGGG + Intronic
1161608746 19:5229445-5229467 CCCCGCCCGGAGCCCGTCCCCGG + Intronic
1161619973 19:5292815-5292837 CCGGGGGCGGAGCCAGGCGCGGG - Intronic
1161632417 19:5364908-5364930 GCCGGGGCGGAGCCTGGCCCAGG + Intergenic
1161681212 19:5680774-5680796 CCCCTCACGGTGCCAGGGCCGGG - Exonic
1161925260 19:7294525-7294547 TCCCGCGCGGGGCCCGGCACAGG - Intergenic
1161973480 19:7596379-7596401 CCCCGCGCGGAGCTGGGCCGCGG - Intronic
1162079242 19:8209017-8209039 CCCCGCGGCGCGCCTGGCCCGGG - Intronic
1162139743 19:8578631-8578653 CCCCCAGCAGAGCCTGGCCCAGG + Intergenic
1162567345 19:11451676-11451698 CCCCGCAGGGGGCCAGGCCGGGG - Exonic
1163236773 19:16034475-16034497 CCCAGCACAGACCCAGGCCCAGG + Intergenic
1163359486 19:16836925-16836947 CCCTTCTCCGAGCCAGGCCCTGG + Intronic
1163390299 19:17026697-17026719 CCGCGCTCGGACCCTGGCCCTGG - Exonic
1163597060 19:18226363-18226385 CCCCGAGGGGAGCCGGGCCCGGG + Intronic
1164160606 19:22623493-22623515 CCCCGCGGGGAGCCCAGCCCAGG + Intergenic
1164521622 19:28984108-28984130 CCCCCCACAGAGCTAGGCCCAGG + Intergenic
1165175907 19:33929558-33929580 CCCCGTGCGGCCCCTGGCCCAGG - Intergenic
1165246503 19:34500983-34501005 CCCCGTGCGGCTCCAGCCCCGGG + Exonic
1165420047 19:35718049-35718071 CCCCGCGCGGAGCCAGGCCCGGG - Exonic
1165900679 19:39167883-39167905 CCACGCGCTGTGCCAGGCGCGGG + Intronic
1166107741 19:40605679-40605701 CCCCGCGCGGAGGCAAGCTCCGG - Intronic
1166219015 19:41353547-41353569 CCCCGCGAGGAGGCAGGACTTGG - Exonic
1166937994 19:46346663-46346685 CCCTACGCGGAGCCGGACCCGGG - Intergenic
1167308891 19:48724875-48724897 CCCAGCTCCGCGCCAGGCCCCGG + Exonic
1167578456 19:50328871-50328893 CGGCGCGCCGAGCCATGCCCCGG - Exonic
1167793634 19:51695334-51695356 CCCCACGAGGTGCCAGACCCTGG + Intergenic
1168581703 19:57560290-57560312 TCCCGCGTGGAGCCATTCCCGGG + Intergenic
1168649722 19:58085477-58085499 CCCCGCGGGGATCCAGAGCCCGG - Intronic
925942229 2:8831548-8831570 CCCCAAGCTGGGCCAGGCCCTGG + Intronic
926089853 2:10043141-10043163 CCCCGCACCGAGTCCGGCCCCGG + Intronic
926197282 2:10771643-10771665 CCCAGCACAGAGCCTGGCCCTGG + Intronic
926250995 2:11155397-11155419 CTCCGCGCGCCGCCAGGCCCCGG - Exonic
927137992 2:20111420-20111442 GCCCCCTGGGAGCCAGGCCCCGG - Intergenic
927157550 2:20229998-20230020 CCCTACTGGGAGCCAGGCCCAGG + Intergenic
927826619 2:26313787-26313809 CCCTGAGTGGAGCCAGGCCCAGG + Exonic
928089123 2:28363445-28363467 CCCTGAGCGGAGCCAGGCAGCGG - Intergenic
928986957 2:37191367-37191389 CACCAGGCTGAGCCAGGCCCAGG - Intronic
929484334 2:42340752-42340774 CCCAGTGCAGGGCCAGGCCCCGG - Intronic
931784735 2:65608764-65608786 CCCCACGCGGAAGCAGGCCTAGG - Intergenic
932019619 2:68069722-68069744 CCCCGCCCCAAGACAGGCCCCGG - Intronic
932901839 2:75710590-75710612 CCCCGCGCGGACGAAGGCTCAGG - Exonic
934238607 2:90250504-90250526 ACCTGGGCGGAGCCAGGGCCAGG - Intergenic
934846494 2:97664102-97664124 CCCTTCGCGCAGCCAGCCCCGGG - Exonic
934978558 2:98822690-98822712 CCCCCGGTGGAGCCCGGCCCCGG - Exonic
935237491 2:101151068-101151090 CCCGGCGGGGTGCGAGGCCCCGG + Intronic
937081473 2:119143185-119143207 CCCCGCCCTGGCCCAGGCCCCGG - Intergenic
937418527 2:121736711-121736733 CCCCGCTCGCAGCCTGGGCCAGG + Intronic
937986960 2:127642272-127642294 CCCCTCGGGGAGCCGTGCCCTGG - Intronic
939955765 2:148526728-148526750 CCCCGGGGGCAGCCAGACCCAGG + Intergenic
941987633 2:171523628-171523650 GCCCGCGGCGAGCCAGCCCCGGG + Intronic
942448324 2:176092844-176092866 TCCTGCGCGGGGCCAGGGCCAGG + Intergenic
942449624 2:176100761-176100783 CCGCGCGCGTGGCCAGGGCCGGG + Exonic
942458152 2:176151832-176151854 GGCAGCGCCGAGCCAGGCCCGGG - Exonic
945080830 2:206085418-206085440 TCCCGCGGGGCGGCAGGCCCGGG - Intronic
945776694 2:214114599-214114621 CCCTGCCCCGAGCCAGGCACAGG + Intronic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
946354622 2:219177032-219177054 CCGCGCGCCGCGCCAAGCCCGGG - Intronic
947418757 2:229922719-229922741 CCCGGCGCGGAGCCGGGACTGGG - Intronic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
947748644 2:232522046-232522068 CGCCGCCCGGGGCCTGGCCCTGG + Exonic
948208061 2:236173241-236173263 CCCCGGCCGGAGCCAGACCCGGG - Intergenic
948519434 2:238526238-238526260 CCCCGCGTGGACCATGGCCCAGG + Intergenic
948570268 2:238913322-238913344 CCCTGCACCCAGCCAGGCCCTGG + Intergenic
948656354 2:239479074-239479096 CACCGCGCCCAGCCAGGCTCTGG - Intergenic
949004359 2:241637031-241637053 CCAGCCGCGCAGCCAGGCCCCGG + Exonic
1168749810 20:274421-274443 ACCCACGTGGAGCCAGGCCTTGG - Intronic
1168753096 20:297646-297668 CCCCGCGCGGCCCGCGGCCCGGG + Exonic
1168838857 20:895875-895897 CCCTCCCCGGACCCAGGCCCTGG - Intronic
1169191463 20:3661164-3661186 CCCCCTGCGCAGCCCGGCCCAGG + Exonic
1169195984 20:3682169-3682191 CCCCGCTCGGAGCCTGGCCAGGG + Exonic
1169557809 20:6768414-6768436 CCCCGCGCGGGGCCGGCTCCGGG - Exonic
1172117881 20:32583047-32583069 CCCCTCGGGGAGCCCGGTCCCGG + Intronic
1172702930 20:36863684-36863706 CGCCGGGCGGAGCCGGGGCCCGG - Exonic
1172871751 20:38140135-38140157 CCCCGCATGGGGCCAGCCCCAGG + Intronic
1172878592 20:38181814-38181836 CCCAGCTCTGTGCCAGGCCCTGG + Intergenic
1173570050 20:44070185-44070207 CCCCGCTCCCAGCCAGGCTCGGG + Intergenic
1174476887 20:50801971-50801993 CCCCCTGGGGACCCAGGCCCTGG - Intronic
1175108203 20:56629152-56629174 CTCGGCGCTGCGCCAGGCCCGGG + Intergenic
1175218791 20:57405348-57405370 CCTCGCGCGGAGCCAGGCCTGGG - Intronic
1175399744 20:58693353-58693375 CCCCGCCTGGCGACAGGCCCTGG + Intronic
1175981483 20:62741007-62741029 CCCCTCGCTGAGCCTGGCCGGGG - Intronic
1176232274 20:64038563-64038585 CCCCGCGCCCGGCCCGGCCCGGG - Intronic
1176235422 20:64051428-64051450 GCCCAGGCTGAGCCAGGCCCTGG - Intronic
1178929518 21:36805390-36805412 CAGCGCCCGGAGCCGGGCCCGGG - Intronic
1179354750 21:40648983-40649005 CCCGGGGCTGAGCAAGGCCCAGG + Intronic
1179511275 21:41875315-41875337 CCCCTCGCCCTGCCAGGCCCCGG + Intronic
1179511852 21:41878904-41878926 CCCCGCGCTGGGCCTGGCCGCGG + Intronic
1180068031 21:45422523-45422545 CCTCGCGCCGTGCCAGGACCCGG + Intronic
1180791416 22:18577500-18577522 CACCGGGCCGCGCCAGGCCCAGG - Intergenic
1180847275 22:18990773-18990795 TCCCCCTCGGTGCCAGGCCCTGG - Intergenic
1181230323 22:21417811-21417833 CACCGGGCCGCGCCAGGCCCAGG + Intronic
1181236020 22:21448142-21448164 CCCAGCCTGGAGCCAGGCACTGG + Exonic
1181248327 22:21517052-21517074 CACCGGGCCGCGCCAGGCCCAGG - Intergenic
1182904046 22:33921052-33921074 CCCCGCTCGGAACCCAGCCCCGG - Intronic
1183208119 22:36433276-36433298 GGCCACGCTGAGCCAGGCCCTGG - Intergenic
1183284123 22:36952014-36952036 CCCAGCCCAGAACCAGGCCCAGG + Intergenic
1183715663 22:39532254-39532276 CCAGGCGCGGAGCGGGGCCCTGG - Intronic
1184718774 22:46297022-46297044 CCCCGCCAGGAGCCGGGCCTGGG + Intronic
1184733154 22:46381975-46381997 TCCCTCTCGGTGCCAGGCCCCGG + Exonic
1185259514 22:49853814-49853836 CCCCGCGCCGCGCGGGGCCCTGG + Intergenic
1185299154 22:50070469-50070491 CACCGAGCGGGGCCAGGGCCTGG - Intronic
1185374141 22:50474555-50474577 CCCCGCCCGGCCCCCGGCCCCGG + Intronic
1185409457 22:50674480-50674502 CCCCGCGCCGGCCCCGGCCCCGG + Intergenic
950198746 3:11028166-11028188 CCCCATCCGGAGCCAGACCCAGG + Intronic
952888156 3:38024453-38024475 GCCTGCGCGGAGCCGGGTCCGGG + Exonic
953149133 3:40308928-40308950 CCCCACTCGATGCCAGGCCCAGG + Intergenic
954391271 3:50269270-50269292 CCCAGAGCAGGGCCAGGCCCGGG - Exonic
954778858 3:53045315-53045337 CCCCGCCCGGAGCGAGCCCGGGG + Intronic
955281156 3:57596572-57596594 CCCCGGGCGGCTCCAGGCTCCGG + Intronic
956825998 3:72997155-72997177 CCCCACGCCGCGCCCGGCCCCGG - Intronic
959849805 3:111072325-111072347 CCGCGCCCGGGGCGAGGCCCTGG + Intronic
961594646 3:128006784-128006806 GCCCGTTCAGAGCCAGGCCCCGG + Intergenic
962421288 3:135231129-135231151 CCCCTCTCTGAGCCAGGCCAGGG - Intronic
962891721 3:139678025-139678047 CCCTGGGCGGGGCCAGGGCCGGG - Intergenic
963939486 3:151085534-151085556 CCCGGCGCCGAGGCTGGCCCTGG - Intergenic
964848849 3:161072035-161072057 CCCAGCACGATGCCAGGCCCAGG + Exonic
965866964 3:173216431-173216453 GCCCGCCAGGAGCCAGGGCCTGG + Intergenic
966862548 3:184238685-184238707 GCCAGCCCCGAGCCAGGCCCAGG + Exonic
966868536 3:184275969-184275991 CCCCACGCGGAGCCCCGCCCGGG - Intronic
968285142 3:197504175-197504197 CCCCGCGTTGTGCCAGGCGCTGG + Intergenic
968673051 4:1862643-1862665 CCCCGCCCCGTCCCAGGCCCCGG - Intergenic
968879881 4:3293292-3293314 CCCCGCCCCGCGCCGGGCCCGGG - Intronic
968884939 4:3323378-3323400 CCCCGCGCGGAGCGGGGCAGAGG - Intronic
968966904 4:3773405-3773427 CCCAGTGCAGAGCCAGGGCCTGG - Intergenic
969053231 4:4386981-4387003 ACCCGCGCGCACCCAGCCCCCGG + Exonic
969492105 4:7505304-7505326 GCCGGCGGGGAGCCAGGCACGGG + Intronic
979134019 4:117085625-117085647 CCCTACCCGGCGCCAGGCCCGGG + Intergenic
985068466 4:186145054-186145076 CCTAGCGCGGAGCCTGGCGCGGG + Exonic
985577132 5:678678-678700 CCCTGGCCGGGGCCAGGCCCAGG - Intronic
985638454 5:1051893-1051915 CCCTGAGCGGAGCCATGGCCAGG + Exonic
985824390 5:2181774-2181796 CCCCCTGCGGTGCCAGGCCCTGG - Intergenic
992052834 5:72956439-72956461 CCCCGCGCGGAGCGCGGCACCGG - Intronic
992563984 5:77980107-77980129 CCCAGCGGGGAGGCTGGCCCTGG + Intergenic
993898715 5:93570555-93570577 GCCCGCGCGGAACCGGGCCGTGG + Intergenic
995854127 5:116574844-116574866 TCCCGGGCGGAGCCAAGTCCCGG + Exonic
997468874 5:134105579-134105601 CCCTGGGCAGAGCCAGGTCCTGG - Intergenic
997980206 5:138464166-138464188 CTGGGCGCGGAGCCAGGCCGGGG - Intergenic
998463136 5:142324063-142324085 CACCGAGCTGTGCCAGGCCCCGG - Intronic
999322629 5:150624787-150624809 CCCCGCCCCGCGCCAGGCCCAGG - Intronic
1001462129 5:171925077-171925099 CCCAGGGCGGAGCGCGGCCCTGG + Intronic
1001957241 5:175856491-175856513 CTCCGCGCAGAGCCAAGCCGAGG + Intronic
1002093886 5:176819587-176819609 TCCCGTGCGGAGCCTGGGCCTGG - Intronic
1002405011 5:179023883-179023905 CCCCCCGCCGAGGCGGGCCCAGG + Exonic
1002440477 5:179261971-179261993 CCCCACAGGCAGCCAGGCCCTGG - Intronic
1002465797 5:179407801-179407823 CCCCGCCTGGGGCCAGGCCTGGG + Intergenic
1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG + Intronic
1003031322 6:2603868-2603890 CCTGGCGCTAAGCCAGGCCCTGG + Intergenic
1003290488 6:4775721-4775743 CCCCGCGGGGCGCGCGGCCCGGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1006458294 6:34144270-34144292 CCCCGCGCGGGGGCGGGGCCGGG - Intronic
1006827702 6:36948329-36948351 CCCCGGGTGGAACCAGGCACTGG - Intronic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1011128800 6:84033907-84033929 CCCAGGGCGGAGCAAAGCCCGGG + Intronic
1014230203 6:118894582-118894604 CCCAGCGCGAGGCCCGGCCCGGG - Intronic
1016657930 6:146543350-146543372 CCCCACGCCGACCCCGGCCCCGG + Intergenic
1017497534 6:154995211-154995233 CCCCGCCCAGCGTCAGGCCCAGG - Intronic
1018034061 6:159866805-159866827 CCCCAGGCACAGCCAGGCCCCGG - Intergenic
1019343765 7:520063-520085 CCCGGCGCGGAGCCGGGCGCGGG - Intronic
1019392160 7:794719-794741 CCCCGCAGGGATCCAGGTCCGGG + Intergenic
1019421768 7:954178-954200 CCCCCCGCTGCGCCCGGCCCGGG + Intronic
1019624465 7:2009008-2009030 CCCCCAGCGCAGCCACGCCCCGG + Intronic
1019651842 7:2163778-2163800 CTCTGAGAGGAGCCAGGCCCAGG - Intronic
1019716199 7:2540603-2540625 CCCCTCACGGAGCTGGGCCCTGG - Intronic
1019719426 7:2559296-2559318 CCCCGCGCAGGGGCCGGCCCGGG + Intronic
1020118020 7:5487230-5487252 GCCGGCGTGGAGCCAGGCACAGG + Intronic
1020136901 7:5592719-5592741 TCCCGCGCGGAGCCAGGGGCGGG + Intergenic
1020560550 7:9726164-9726186 CCGCGCTCGGACCCTGGCCCTGG + Intergenic
1021717046 7:23469908-23469930 GCCCGGGTGGGGCCAGGCCCGGG + Intronic
1022103724 7:27184138-27184160 CCCCGCTCGGGGCCAGCTCCAGG - Intronic
1027374438 7:77536888-77536910 CCCCGGGCGGGGCCACGCCCCGG + Intergenic
1029495756 7:100894997-100895019 CCCCGCCCCGAGCCAGGAGCCGG + Intronic
1029704671 7:102269987-102270009 CCCCACAGGGGGCCAGGCCCGGG + Intronic
1032295351 7:130632898-130632920 CCCCACCCCGAGACAGGCCCCGG + Intronic
1033361399 7:140640911-140640933 CTCCGCGCGGGGCCGGGCCCTGG - Intronic
1033366001 7:140673048-140673070 ACCCACGCGAAGCCAGGCCCCGG - Intronic
1033657057 7:143381513-143381535 CGCAGCGCGGAGCCGGGCTCAGG - Intronic
1034147423 7:148884828-148884850 CCGCGCGCGGAGCCGAGGCCCGG + Intergenic
1034269332 7:149796110-149796132 CCAGGTGCCGAGCCAGGCCCTGG + Intergenic
1034544831 7:151782923-151782945 GCTCGCGGGGAGCCAGGACCAGG + Intronic
1035168050 7:157003239-157003261 CCTCCAGCAGAGCCAGGCCCCGG - Intronic
1037892382 8:22630125-22630147 CCCTGAGCAAAGCCAGGCCCAGG - Intronic
1039050036 8:33484712-33484734 CCCAGCTCGCAGCCAGGCCCCGG - Intronic
1039903071 8:41766996-41767018 CCCCGAGGGGGGCCGGGCCCTGG - Intronic
1039918360 8:41875989-41876011 GCGCGCGCGGGGCCAGGCGCGGG - Intronic
1040512213 8:48105544-48105566 CCCCGCGAGGCGGCAGCCCCTGG - Intergenic
1044821685 8:96159750-96159772 ACCCGCGCGGCGCCAGGACCAGG + Intronic
1044821899 8:96160773-96160795 CCGCCCGAGGAGCCGGGCCCCGG - Exonic
1049159579 8:141088849-141088871 CCCCGGGCCAGGCCAGGCCCTGG + Intergenic
1049164482 8:141117721-141117743 CTCCGGCCTGAGCCAGGCCCAGG + Intronic
1049237263 8:141518568-141518590 CCGCGCGCGGGGCCCGGGCCCGG + Exonic
1049406212 8:142452830-142452852 CGCCGCGGGGCTCCAGGCCCAGG + Intronic
1049532340 8:143160664-143160686 CCCGGCGCGGCGCCACGCGCAGG + Exonic
1049642360 8:143721432-143721454 GCCCACGCGGAGCACGGCCCGGG + Intronic
1049936388 9:504831-504853 CTCCGCGCGGGGCCAGCCCGAGG - Intronic
1052892769 9:33719674-33719696 CTCCCAGCTGAGCCAGGCCCTGG + Intergenic
1056773347 9:89495499-89495521 CCCAGGGCGGACCCTGGCCCAGG + Intronic
1057488547 9:95505870-95505892 CCCCGCGCTGCGCCCGCCCCCGG + Intronic
1057752406 9:97803488-97803510 CCCCGCGCTGGGCCGGGCCTGGG - Intergenic
1059336754 9:113573812-113573834 CCTAGCACAGAGCCAGGCCCAGG + Intronic
1059375329 9:113876427-113876449 CCCCGCGCGGTGCATGCCCCCGG - Intronic
1059453143 9:114383361-114383383 GCCAGCACTGAGCCAGGCCCAGG + Intronic
1060701021 9:125748268-125748290 CCGCGCGGGGAGCCTCGCCCCGG - Intronic
1060759655 9:126236454-126236476 CCCCCAGCTCAGCCAGGCCCGGG + Intergenic
1061128327 9:128690106-128690128 CCCCGCCCAGAGGCTGGCCCCGG + Intronic
1061262608 9:129488460-129488482 CCCGCCCCGGACCCAGGCCCCGG - Intergenic
1061358251 9:130122679-130122701 CCCAACTCTGAGCCAGGCCCTGG - Intronic
1061961779 9:133992371-133992393 GCCCGCGCGAAGCCCCGCCCCGG - Intronic
1062014004 9:134282269-134282291 GCACGCAGGGAGCCAGGCCCCGG - Intergenic
1062340209 9:136090786-136090808 CCCCGAGGGCAGCCCGGCCCTGG - Intronic
1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG + Intergenic
1062388823 9:136326108-136326130 CTCTGCCCGCAGCCAGGCCCAGG + Intergenic
1062435749 9:136545943-136545965 CCGGGCGCGGAGCCGGGCCCGGG - Intergenic
1062452335 9:136620934-136620956 CCCGGCGCGGAGGGAGGCACTGG - Intergenic
1062477551 9:136736214-136736236 CCCGGGACAGAGCCAGGCCCAGG + Intergenic
1062558693 9:137129481-137129503 CGCCGGGCGGACCGAGGCCCGGG - Intergenic
1062582898 9:137236259-137236281 CCAGACGGGGAGCCAGGCCCAGG - Exonic
1062591497 9:137276712-137276734 CCCCTCCAGGAGCCAGGCCTAGG - Intergenic
1186534640 X:10333780-10333802 GCCAGCCCTGAGCCAGGCCCAGG - Intergenic
1188003788 X:25004195-25004217 CCCAGCGTGAAGCCAGGGCCCGG - Exonic
1188415840 X:29933171-29933193 CCCCACCCTGAGACAGGCCCCGG - Intronic
1190881550 X:54495681-54495703 CCCCGCGCGGGGCCGGGGCCGGG - Exonic
1197722791 X:129756267-129756289 CACCTGGCTGAGCCAGGCCCTGG - Intronic