ID: 1165421160

View in Genome Browser
Species Human (GRCh38)
Location 19:35722647-35722669
Sequence AGGGACATCTTCAGGCACCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421160_1165421166 2 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421166 19:35722672-35722694 CCTCAGTGCCCTCCCTCTCCGGG 0: 1
1: 0
2: 4
3: 65
4: 499
1165421160_1165421174 26 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421174 19:35722696-35722718 TCGGCAGGACCTCGCCACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 78
1165421160_1165421164 1 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421164 19:35722671-35722693 GCCTCAGTGCCCTCCCTCTCCGG 0: 1
1: 2
2: 4
3: 48
4: 369
1165421160_1165421167 7 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106
1165421160_1165421170 11 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421170 19:35722681-35722703 CCTCCCTCTCCGGGATCGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 112
1165421160_1165421175 27 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421175 19:35722697-35722719 CGGCAGGACCTCGCCACAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421160 Original CRISPR AGGGACATCTTCAGGCACCA TGG (reversed) Exonic
900394324 1:2446939-2446961 GGGGCCAGCTTCAGGCAGCACGG + Intronic
900969018 1:5979237-5979259 AGGCACATTTCCAGGCACTAGGG + Intronic
901461532 1:9394794-9394816 AGGGACATTTGCAGACACCGTGG - Intergenic
903774851 1:25786440-25786462 AGGGACCCCTTCAAGAACCAGGG + Intergenic
904646954 1:31974813-31974835 AAGGACCTCTCCAGGCACAAGGG + Intergenic
905388721 1:37622692-37622714 GGAGAGATCTTCAGGGACCAGGG + Intronic
905824932 1:41020314-41020336 AGGGCCGTCTGCAGGCGCCAGGG + Exonic
907017779 1:51034101-51034123 AGTGCCATGTTCAGGCACGATGG + Intergenic
907971149 1:59382909-59382931 GGTGCCATATTCAGGCACCAAGG + Intronic
914687100 1:149990081-149990103 TGGGATATCTCCAGGCCCCATGG - Intronic
915996499 1:160569225-160569247 AGGGACAGTTTCAGGTACCCTGG + Intronic
918070436 1:181130253-181130275 AGGGACATTTTGAGGCAGGATGG - Intergenic
919522742 1:198609418-198609440 AGGGAGAGCTACAGGCACCATGG - Intergenic
920335778 1:205244243-205244265 AGGGACCTCTCCAGCCAGCATGG - Intronic
1065343167 10:24724286-24724308 AGCGACATCTGCAGACTCCAGGG + Intergenic
1067229536 10:44396868-44396890 GGGGCCATCTTCAGGCTCCATGG + Intergenic
1068800574 10:61135712-61135734 AGGGATATCTTTAAGCAACAGGG - Intergenic
1068986725 10:63114512-63114534 AGGGACAGCAGCAGGCAGCATGG + Intergenic
1071119264 10:82259114-82259136 AGGGAGCTTTTCAGTCACCATGG + Intronic
1071185683 10:83041819-83041841 AGGCCCATCTTCTGCCACCAGGG - Intergenic
1071223409 10:83496850-83496872 AGGGACACCTTCTGGGTCCAAGG + Intergenic
1073622522 10:105063981-105064003 GGGGCCATCTGCAGGCACTATGG - Intronic
1075915345 10:126161809-126161831 GGGGAAATCTGCAGGCTCCAAGG - Intronic
1076196225 10:128520223-128520245 AGGGCCAGCTTCGTGCACCAGGG - Intergenic
1079022980 11:16924381-16924403 AAGGAGGTTTTCAGGCACCATGG + Intronic
1079182413 11:18205018-18205040 AGGCCCATCTTCAGGCCCCCAGG - Intronic
1079419439 11:20272408-20272430 AGGGGCATGTTCAGGAACCAGGG - Intergenic
1079432770 11:20410870-20410892 AGTGACATCTGCAGTCACAAAGG + Intronic
1081672176 11:44948651-44948673 AGGGACAGTTTCAGGCACTGGGG - Intronic
1083800776 11:65045174-65045196 AGTGCCCTCTTCTGGCACCAAGG + Exonic
1084583015 11:70036213-70036235 AGGGACACCTGGAGTCACCAGGG - Intergenic
1085708638 11:78809569-78809591 TGGGACAGCTTCAGGAACAATGG + Intronic
1086266848 11:85009921-85009943 AAGGATGTCTTCAGGAACCATGG - Intronic
1089547734 11:119242711-119242733 AGGGCCTTATTCAGTCACCAAGG - Intronic
1089594388 11:119567955-119567977 AGGGACATCTTGACTCACAAGGG + Intergenic
1090234092 11:125133604-125133626 GGGGACATCTTCAAGAATCAGGG - Intergenic
1090375978 11:126289796-126289818 AGGGACATCCTCTGTCACTACGG + Exonic
1091864422 12:3819096-3819118 AGGGACATCTTTAGGGATGATGG - Intronic
1096204479 12:49709199-49709221 AAAGGCAGCTTCAGGCACCAGGG + Intronic
1096505357 12:52089044-52089066 AGGCACTGCTCCAGGCACCAAGG + Intergenic
1096579078 12:52572912-52572934 AAGGACATCTCCTGGGACCAGGG - Intronic
1096806856 12:54146281-54146303 AGGGACAGCTGAAGGCACGAGGG - Intergenic
1097802226 12:63927312-63927334 AGGGACTGCAGCAGGCACCAGGG - Intronic
1099276608 12:80584236-80584258 AGGGATATCTGCAGACACAAAGG + Intronic
1100187562 12:92154104-92154126 AGGGACACCATGAGACACCATGG - Intergenic
1101126375 12:101639369-101639391 AGGGTCATGTGCAGCCACCATGG + Intronic
1102097256 12:110250483-110250505 AGGGACATCTCCAAACTCCAGGG - Intergenic
1105422499 13:20265382-20265404 AGGAACATCTTCAGTTTCCAAGG - Intergenic
1107835732 13:44411130-44411152 AGGAAAATCCTCAGGCCCCATGG - Intergenic
1110098290 13:71560453-71560475 AGTCACATTTTCAGGCATCATGG + Intronic
1110151495 13:72260232-72260254 AGAGACATCATCAAACACCAGGG + Intergenic
1111231775 13:85353845-85353867 AGGGACTTCTTCTGTCACCCAGG - Intergenic
1112574553 13:100623920-100623942 AAAGACAGCTTTAGGCACCAAGG - Intronic
1113639068 13:111944332-111944354 AGACACAGCCTCAGGCACCACGG + Intergenic
1114527578 14:23376424-23376446 CGCGAGATGTTCAGGCACCACGG - Intergenic
1115205499 14:30899325-30899347 AGAGAGATCTTCAGGACCCATGG - Intronic
1118644980 14:67829721-67829743 AGGTACTTTGTCAGGCACCAAGG + Intronic
1121197358 14:92085945-92085967 AGGGATATCATCAGGAACCAAGG + Intronic
1121210639 14:92206026-92206048 AGTGTCCTCTTCAGTCACCATGG + Intergenic
1121496929 14:94398918-94398940 AATGACCTCTTCAGGCACCAGGG - Intergenic
1121670824 14:95709636-95709658 AGGGACAGCTTCAGGCAGGAGGG + Intergenic
1122387843 14:101361146-101361168 AAGGACATCTGTTGGCACCACGG - Intergenic
1126100984 15:45118029-45118051 TCGGACATCCGCAGGCACCAGGG + Exonic
1126652919 15:50944148-50944170 AGTGCCATCTTTGGGCACCAAGG - Intronic
1127182193 15:56433227-56433249 AGGAACATCATCACACACCAGGG + Intronic
1127671206 15:61197062-61197084 AGGGAGCTGTTCAGGCAGCAAGG + Intronic
1128693701 15:69744630-69744652 TTGGACATCTTCATGGACCAAGG + Intergenic
1129360456 15:75020929-75020951 AGGTACCTTTTCAGGTACCAGGG - Exonic
1130026684 15:80276609-80276631 AGGGACAAGCTCAGTCACCAAGG + Intergenic
1131604173 15:93883051-93883073 AGGGAAATGTTCAGCCTCCAGGG + Intergenic
1134669941 16:16047514-16047536 AGGGACATTTTCCCCCACCAGGG + Intronic
1136079873 16:27844908-27844930 AAGAGCAGCTTCAGGCACCAGGG - Intronic
1136287112 16:29250993-29251015 AGGCACGGCTTCAGGCACCAGGG - Intergenic
1140243453 16:73226209-73226231 AGGGAGATTTTGAGGCACCTGGG - Intergenic
1141806311 16:86344026-86344048 AGGGAACTCCTCAGGCACCCTGG - Intergenic
1142092717 16:88223625-88223647 AGGCACGGCTTCAGGCACCAGGG - Intergenic
1142195887 16:88739146-88739168 AGGGACATGGCCAGGCTCCAGGG + Intronic
1142681898 17:1554927-1554949 AGGGACAGCTTGGGGCTCCAGGG - Intronic
1145753288 17:27370749-27370771 AGGGAGTTCTTCAGGCAGAAGGG - Intergenic
1145979674 17:29004319-29004341 AGGGACATCCCCAGGCAGCTAGG + Intronic
1148666962 17:49382236-49382258 GGGGACATCTTCTGGCTTCAAGG - Intronic
1148771775 17:50071529-50071551 AGGGACATCCTCTGGGGCCAGGG + Intronic
1150295277 17:64004032-64004054 AGGGCCATCTCCTGTCACCATGG + Intronic
1151405276 17:73882129-73882151 TGGGACCTTTTCAGGCCCCACGG - Intergenic
1153797077 18:8633705-8633727 TGGGACATCCGCAGGCACCGTGG - Intronic
1154285491 18:13052241-13052263 AGGGACATCTTTCTGAACCAAGG + Intronic
1158174630 18:54640912-54640934 ATGGACATCATCAGGGAACAGGG - Intergenic
1159844342 18:73440504-73440526 GGGGACAACCTCAGGCCCCAAGG - Intergenic
1160242702 18:77134261-77134283 AGGGACATCTGCAGGCAGGAAGG - Intergenic
1161960825 19:7522317-7522339 AGGGTCATCACCAGGCACCAAGG + Intergenic
1162138539 19:8571253-8571275 AGGGCCACCCTCAGGCACCAGGG - Intronic
1162843442 19:13372983-13373005 ATGGACATGTTCAGGAAACAGGG - Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163179436 19:15588434-15588456 AGGGACATCTCCAAGCCCCAAGG - Intergenic
1163908080 19:20164944-20164966 AGTGACATCTCCAGGCACGGCGG + Intergenic
1165421160 19:35722647-35722669 AGGGACATCTTCAGGCACCATGG - Exonic
1167525106 19:49978809-49978831 AGGGGGAGCTTCAGGCACAACGG - Intronic
925307972 2:2863520-2863542 AGTGACATCTTTAGGTAGCAAGG + Intergenic
928202824 2:29261577-29261599 AGGGACATCTCCAATGACCATGG + Intronic
928236367 2:29545064-29545086 AGGAACATCTGCAGGCATCTGGG - Intronic
929327811 2:40638871-40638893 TGGTACATCATCAGGCACCCGGG + Intergenic
929732786 2:44513692-44513714 AAGGACATCTTCAATCACTATGG + Intronic
930097429 2:47576067-47576089 AGGAACCACTTCAGGCACCAAGG - Intergenic
931084475 2:58814189-58814211 ATGGACATATGCAGCCACCATGG + Intergenic
931131083 2:59336739-59336761 AGCGACATCTTCATGTACAAAGG + Intergenic
931192555 2:60019394-60019416 AGGGGCATCTACAGGCACCCTGG - Intergenic
932412090 2:71553579-71553601 AGGCACCTCTTCAGACACTAGGG + Intronic
932840702 2:75079551-75079573 AGTGCTATCTCCAGGCACCATGG + Intronic
933610808 2:84433087-84433109 AGTGATGTTTTCAGGCACCAAGG + Intronic
933743851 2:85555887-85555909 AGCGACAGTATCAGGCACCAAGG + Intronic
935736117 2:106107809-106107831 AGGTTCATCTGCAGGCACCACGG + Intronic
936834202 2:116687279-116687301 AAGGACATCTTCTGGAAGCAGGG + Intergenic
938092088 2:128440816-128440838 AGGGCCTTCTTCACCCACCAGGG - Intergenic
939113715 2:138037383-138037405 TGCAACATCTTCAGGCTCCAAGG - Intergenic
939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG + Intronic
940511194 2:154617258-154617280 AGGGGCATCTTCTGACTCCATGG - Intergenic
941636510 2:167940789-167940811 ACAGACCACTTCAGGCACCATGG - Intergenic
946919799 2:224567241-224567263 AGGGTCTTCTTCTGTCACCAAGG + Intronic
947394675 2:229674914-229674936 AGGGACATCTTCCAGCTCCCTGG - Intronic
1169183463 20:3591819-3591841 GAGGTCTTCTTCAGGCACCAAGG - Intronic
1169957224 20:11117625-11117647 AGGTACATCTTCATGCCTCAAGG + Intergenic
1170723675 20:18906205-18906227 AGGCACATCATCAGTCACCAGGG - Intergenic
1171164337 20:22957192-22957214 AGGGACATTTTCCAGCACCGGGG - Intergenic
1173287669 20:41687870-41687892 AGGGACTGCCTCAGGCTCCAAGG + Intergenic
1174703327 20:52631399-52631421 AGGGATGTCCTCTGGCACCATGG + Intergenic
1175522560 20:59611528-59611550 CAGAACAGCTTCAGGCACCAGGG + Intronic
1175814838 20:61877975-61877997 AGGGTCATCACCAGGAACCACGG + Intronic
1178173746 21:30073304-30073326 AGTGCCATCTTCATACACCATGG + Intergenic
1178676247 21:34634163-34634185 AGGGACAGCCTCAGAAACCACGG + Intergenic
1179959119 21:44758461-44758483 AGCGACACCCTCAGCCACCAAGG + Intergenic
1181079562 22:20405090-20405112 AGGAACAGCTACAAGCACCAAGG - Intronic
1182898833 22:33881293-33881315 AGGGACTTCTGGGGGCACCAGGG - Intronic
1182972607 22:34591917-34591939 AGAGACATGTGCAGGTACCATGG + Intergenic
1184283084 22:43450015-43450037 AGGGACACCAGCAGGTACCATGG + Intronic
1185057245 22:48587490-48587512 AGTCACAGCTCCAGGCACCAAGG + Intronic
949486674 3:4546246-4546268 AGTGTCTTCTCCAGGCACCACGG + Intronic
949893867 3:8754616-8754638 AGCGAAGTCTTCAAGCACCAAGG + Intronic
951045910 3:18038109-18038131 AGGGTCATGTTCAGGCAGCATGG + Intronic
951108772 3:18776446-18776468 AGGGACATCTCCAGAAACAATGG + Intergenic
953093673 3:39754201-39754223 AGGGACATCTTTAGGGATCCAGG - Intergenic
954389474 3:50261079-50261101 TGGGACAGCTCCAGGCAGCAGGG - Intergenic
954928807 3:54261922-54261944 TGGGACATAGTCAGGCACCATGG - Intronic
958984952 3:100769753-100769775 AGGAAAATCTCCAGGAACCATGG + Intronic
959006560 3:101026740-101026762 AGGGACATTTTGAAGCTCCATGG - Intergenic
962277615 3:134028235-134028257 AGGGGCCTCTGCAGGAACCAGGG - Intronic
963136027 3:141905037-141905059 AGGGTCATGTCCAGTCACCAAGG - Intronic
966910128 3:184555004-184555026 AGGGGCAGCTTCAGAAACCAGGG + Intronic
966928342 3:184659884-184659906 AGTGGCCTCTTCAGCCACCACGG - Intronic
968478499 4:823961-823983 AGCGCCATCCTCAGGGACCAGGG - Intronic
968702067 4:2061971-2061993 AGGGAGAGCAGCAGGCACCAAGG - Intronic
969029763 4:4202614-4202636 TGGGAGAGCCTCAGGCACCATGG + Intronic
973019573 4:45185751-45185773 AGGGTCAGCTGCAGGCATCAGGG + Intergenic
973951897 4:56024456-56024478 AGAGATATATTCAAGCACCAGGG - Intronic
974181127 4:58386201-58386223 AGTGACATCTCCAGGCACATGGG - Intergenic
976134373 4:81920165-81920187 AAAGGCAGCTTCAGGCACCAAGG - Intronic
979482319 4:121234259-121234281 AGGGACATCTAGAGGCAGCTTGG - Intergenic
981085696 4:140681162-140681184 AATGACATGTTCAGGCCCCAAGG - Intronic
981537909 4:145819445-145819467 AGGGACAGCTGCAGGTACAATGG + Intronic
982532091 4:156558140-156558162 AGGCCCAACTTCAGGCCCCATGG + Intergenic
984601073 4:181727365-181727387 AGGAACTACTTCAGGAACCAAGG + Intergenic
985298056 4:188456614-188456636 ATTGACAACTTCAGACACCATGG + Intergenic
987082796 5:14440902-14440924 AGGAAATTCTTCAGGCACCCTGG - Intronic
987158019 5:15110607-15110629 AGGGACATTTTCAGGATTCAGGG - Intergenic
996869656 5:128174560-128174582 AGAGAAATCTCCTGGCACCAAGG + Exonic
999596989 5:153215380-153215402 AGTGACATCTCCAGGCACAGAGG + Intergenic
1000027215 5:157369730-157369752 ATGGACATCGCCAAGCACCAGGG + Intronic
1001301885 5:170539531-170539553 AGGGGCTTCTTCAGGCAGAACGG - Intronic
1002896784 6:1384212-1384234 AGTGACCTCTTCAGGCCCCGCGG + Intergenic
1004599386 6:17132956-17132978 AGGCAGATCTTCAGGCATCTGGG + Intergenic
1006095784 6:31655952-31655974 TGGAACATCTTCAGGCAGGAGGG - Exonic
1011386468 6:86803420-86803442 GAGGAGATCTTCACGCACCAGGG - Intergenic
1011718026 6:90127413-90127435 AGGGCAAGCCTCAGGCACCAGGG + Intronic
1011903026 6:92324729-92324751 AGGGAGATTTTCAGTCTCCAAGG - Intergenic
1012574464 6:100775121-100775143 AGGGACTTTTTCAGCCACTAGGG + Intronic
1012974748 6:105768327-105768349 AGGGACATCTTCTAGTCCCATGG + Intergenic
1014038376 6:116794650-116794672 AGGGAGTTTTTCAGGCAACATGG - Intronic
1016363671 6:143293527-143293549 GTGGACATTCTCAGGCACCAAGG - Intronic
1018054756 6:160042179-160042201 AGGGACTTCTTCAAGCAGTAAGG - Intronic
1018381247 6:163260079-163260101 AGTGAGATCTGGAGGCACCAAGG - Intronic
1018420320 6:163635201-163635223 AGGGAAATCTTCAGCCTTCAGGG - Intergenic
1019140003 6:169937058-169937080 AGTGACATCCTGAGGCTCCAGGG + Intergenic
1020613568 7:10430476-10430498 AGGGGCATCTTGAGGGAACAAGG - Intergenic
1022129994 7:27396149-27396171 ACGGACATTTTCAGGCACACAGG + Intergenic
1026335190 7:69388193-69388215 ATGAACTTCTTCTGGCACCAAGG + Intergenic
1026960817 7:74406008-74406030 GGGGCCATCTCCTGGCACCAGGG - Intergenic
1027601843 7:80248994-80249016 GGCCACATCTTCAGGCACAATGG + Intergenic
1028049005 7:86158954-86158976 AGTGACATCTTCAGGCACAGGGG + Intergenic
1028270267 7:88779458-88779480 AGGGAGATATTTAGTCACCATGG - Intronic
1031720351 7:125167788-125167810 AGGGACATCTTAAAGAAACAGGG - Intergenic
1032402176 7:131631033-131631055 ACGGACATCCCCAGGCAGCATGG + Intergenic
1032855791 7:135832565-135832587 AGGCTCCTCTGCAGGCACCAAGG + Intergenic
1035694468 8:1584621-1584643 AGAGACATCGTCAGGGACCTGGG - Intronic
1035767569 8:2119496-2119518 AGGGACAGCTGGAGGCAGCACGG + Intronic
1038093984 8:24287021-24287043 AGGGACATATTTAGGCAGTAGGG - Intergenic
1039918676 8:41877838-41877860 AGGGACAGCTTGAAGCACAAAGG + Intronic
1044172500 8:89072207-89072229 ATGCAGATCTCCAGGCACCAGGG - Intergenic
1045204904 8:100028222-100028244 AGGGACATCACCAGGGACCATGG - Intronic
1047827359 8:128592063-128592085 ATGAACATGTTCAGGCATCAAGG - Intergenic
1050713521 9:8493158-8493180 AGGGGCATCTTCAGGCATCTTGG + Intronic
1052452781 9:28653296-28653318 AGGGGCCTCTTCAGTCACCTTGG + Intronic
1053142229 9:35689441-35689463 AGAGAAAACTTCAGGCCCCAAGG + Intronic
1057186999 9:93062588-93062610 AGGGCCATCTGCAGGCAGCTGGG + Intronic
1060540574 9:124427437-124427459 AAGGAAGTCTGCAGGCACCAAGG + Intergenic
1185664791 X:1757128-1757150 AACAATATCTTCAGGCACCATGG + Intergenic
1185751397 X:2612599-2612621 AGGGACATTTGCAGACACCCTGG - Intergenic
1188439058 X:30196531-30196553 AGTGACATCTACAGGCAGCAAGG + Intergenic
1190726332 X:53193038-53193060 AGGGACCACTTCAGGCCCCTCGG - Exonic
1191259555 X:58300520-58300542 AGGGACATTTTGGGGCACAATGG + Intergenic
1192623105 X:72699767-72699789 AGCCTCATCTTCAGGCCCCATGG + Intronic
1194892148 X:99393937-99393959 ACGGACATCTACAAGCATCAAGG - Intergenic
1196132565 X:112173019-112173041 AGGGACATCATCAGGAAGAATGG + Intergenic
1201482366 Y:14453575-14453597 ATTGTCATCTTCAGTCACCATGG - Intergenic