ID: 1165421167

View in Genome Browser
Species Human (GRCh38)
Location 19:35722677-35722699
Sequence GTGCCCTCCCTCTCCGGGAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421156_1165421167 24 Left 1165421156 19:35722630-35722652 CCTGGGTCAGGCCCGGGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 403
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106
1165421161_1165421167 -1 Left 1165421161 19:35722655-35722677 CCTGAAGATGTCCCTCGCCTCAG 0: 1
1: 0
2: 2
3: 7
4: 103
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106
1165421155_1165421167 25 Left 1165421155 19:35722629-35722651 CCCTGGGTCAGGCCCGGGCCATG 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106
1165421160_1165421167 7 Left 1165421160 19:35722647-35722669 CCATGGTGCCTGAAGATGTCCCT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106
1165421159_1165421167 12 Left 1165421159 19:35722642-35722664 CCGGGCCATGGTGCCTGAAGATG 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106
1165421158_1165421167 13 Left 1165421158 19:35722641-35722663 CCCGGGCCATGGTGCCTGAAGAT 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG 0: 1
1: 1
2: 1
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421167 Original CRISPR GTGCCCTCCCTCTCCGGGAT CGG Exonic