ID: 1165421293

View in Genome Browser
Species Human (GRCh38)
Location 19:35723234-35723256
Sequence GTGTTAGGGCCCCCAAACTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421293_1165421299 8 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421293_1165421298 7 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421293_1165421300 9 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421293_1165421301 28 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421293 Original CRISPR GTGTTAGGGCCCCCAAACTT GGG (reversed) Exonic
902957796 1:19937912-19937934 GTGTTAAGTCACCGAAACTTGGG - Intergenic
1065518922 10:26552891-26552913 GAGTTAGAGCCCCCAAACCAAGG - Intronic
1068260777 10:54578233-54578255 GTTTGAGGGCCCCTAATCTTGGG + Intronic
1068954264 10:62807077-62807099 ATTTTAGGGCACCAAAACTTGGG + Exonic
1082785527 11:57314206-57314228 GTGTTATGGACCCCGAACTGTGG - Intronic
1087389290 11:97513793-97513815 GTATATGGTCCCCCAAACTTAGG - Intergenic
1097892360 12:64790832-64790854 GTTTTAGTGCCACCAAACTCAGG - Intronic
1099116433 12:78631331-78631353 GGGTGTGCGCCCCCAAACTTGGG - Intergenic
1100371560 12:93973442-93973464 GTTTAAGGGCCTCCAAAATTTGG + Intergenic
1100573833 12:95870495-95870517 GTGTTAGGTGCCCCAAACCATGG + Intronic
1106854335 13:33832159-33832181 ATGTTAAGGCCCACTAACTTTGG + Intronic
1114036080 14:18628907-18628929 GTGGTATGGCCGTCAAACTTCGG - Intergenic
1114122558 14:19686124-19686146 GTGGTATGGCCGTCAAACTTCGG + Intergenic
1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG + Intronic
1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG + Intronic
1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG + Intergenic
1124002485 15:25770623-25770645 ATCTCAGGACCCCCAAACTTAGG + Intronic
1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG + Exonic
1142744369 17:1948347-1948369 GTTCTGGGGCCCCCAAACCTGGG - Intronic
1145234839 17:21201198-21201220 GGGTTAGGGTCCCCATGCTTGGG - Intronic
1147920890 17:43916318-43916340 TTGGGAGGGGCCCCAAACTTGGG + Intergenic
1149250269 17:54760184-54760206 GTGTTTGGAACCCCAAATTTAGG - Intergenic
1159367556 18:67488478-67488500 TTGTTAGAACCCCCAAATTTGGG - Intergenic
1161838496 19:6664335-6664357 GTCTGTGGGCCCCCAAACATGGG - Intronic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
932314435 2:70770141-70770163 TGGTTAGGGCCCACAAACTCTGG - Intergenic
941106104 2:161354925-161354947 GCTGTAGGGCCACCAAACTTAGG + Intronic
1179089178 21:38247987-38248009 GTGTTATTGCTTCCAAACTTGGG + Intronic
1180460206 22:15555969-15555991 GTGGTATGGCCGTCAAACTTCGG - Intergenic
1182458741 22:30469669-30469691 CTGTTTGGGCCCCCAAACCCAGG - Intronic
1184751591 22:46489430-46489452 GGTTTGGGGCCCCCAAGCTTGGG - Intronic
965720986 3:171661977-171661999 ATTTCAGGGTCCCCAAACTTAGG - Intronic
975366695 4:73538036-73538058 GTGTGAAGGCACCCAAAGTTAGG - Intergenic
975375504 4:73639332-73639354 GTCATAGTGCCCCCAAAATTTGG - Intergenic
989368849 5:40683758-40683780 GTGTAAGGGCCCTGAATCTTAGG - Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1006123842 6:31824765-31824787 GTGTTGGGACCCCAAATCTTGGG - Intergenic
1006428328 6:33980014-33980036 GTGTTTTGACCCCCAAACTTTGG + Intergenic
1008763191 6:54879044-54879066 GTGTCAGAGGCCCCAAAGTTGGG + Intronic
1017432027 6:154380995-154381017 GTGATAGGGCTCCCTAACTGAGG - Intronic
1026378803 7:69778539-69778561 GTGTCAGGGCCACAGAACTTTGG + Intronic
1032519047 7:132528807-132528829 GTTTTAGAGCCGCCCAACTTGGG + Intronic
1038411417 8:27362370-27362392 GTGTTAGCACCCCCACACTGTGG + Intronic
1041030860 8:53733997-53734019 CTGTTAAGGCCCTCAAACATGGG - Intronic
1043993154 8:86780814-86780836 GGGTCAGAGCCCCCAAACTGGGG + Intergenic
1046852279 8:118988173-118988195 CTATTAGGGACCCCAATCTTAGG + Intergenic
1058693025 9:107535112-107535134 GCACTAGGGCCTCCAAACTTTGG - Intergenic
1060262845 9:122091431-122091453 GTGTCTGGGCCCCCAGCCTTGGG - Intronic
1060661982 9:125409633-125409655 GTGTCTGGGCCCCCAAGCTCTGG - Intergenic
1187205242 X:17175689-17175711 GTGTTAGGCCCCTCAGAATTGGG - Intergenic
1187261521 X:17688888-17688910 GTTTTAGAGCCCCCTAAATTGGG + Intronic
1199202110 X:145103826-145103848 TTATCAGGGCCCCGAAACTTAGG - Intergenic