ID: 1165421293

View in Genome Browser
Species Human (GRCh38)
Location 19:35723234-35723256
Sequence GTGTTAGGGCCCCCAAACTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421293_1165421298 7 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421293_1165421301 28 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421293_1165421299 8 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421293_1165421300 9 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421293 Original CRISPR GTGTTAGGGCCCCCAAACTT GGG (reversed) Exonic