ID: 1165421294

View in Genome Browser
Species Human (GRCh38)
Location 19:35723235-35723257
Sequence GGTGTTAGGGCCCCCAAACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421294_1165421300 8 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421294_1165421301 27 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421294_1165421299 7 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421294_1165421298 6 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421294 Original CRISPR GGTGTTAGGGCCCCCAAACT TGG (reversed) Exonic
900417409 1:2541333-2541355 AGTGATAGGGCCCCCTCACTAGG + Intergenic
903349366 1:22709135-22709157 GGTTTGAGGGACCCCAAGCTTGG - Intergenic
903379995 1:22890130-22890152 TGTGTGAGGGACCCCAAACTTGG + Intronic
913402825 1:118455046-118455068 GGGGTTGGAGCCCCCACACTGGG - Intergenic
913590409 1:120319441-120319463 GGTCTTAGGGCTCCTAATCTAGG + Intergenic
913617777 1:120578922-120578944 GGTCTTAGGGCTCCTAATCTAGG - Intergenic
914572494 1:148932050-148932072 GGTCTTAGGGCTCCTAATCTAGG + Intronic
914600347 1:149198212-149198234 GGTCTTAGGGCTCCTAATCTAGG - Intergenic
918920141 1:190698518-190698540 GGTGTTGGAGCCCCCACACAGGG + Intergenic
923367627 1:233278344-233278366 GGCATCAGGGCCCCCAATCTGGG + Intronic
1064158741 10:12925271-12925293 GCTGTTAAGGTCCCCAAACTGGG + Intronic
1070139440 10:73727379-73727401 GGTGATGGGGCCTCCAAAGTTGG - Intergenic
1072532547 10:96332790-96332812 GGTGTTGGGGACCACACACTGGG - Intronic
1086124509 11:83336427-83336449 GGTGTTATGGCCCACCAGCTTGG - Intergenic
1092161986 12:6320311-6320333 TGTATTAGGTCCCACAAACTTGG + Intronic
1105069511 12:133226205-133226227 GGTGACAGGACCCCCACACTGGG - Intronic
1107056163 13:36106228-36106250 GATGTTAGTGCCTCCAAATTGGG - Intronic
1112893757 13:104271565-104271587 GGTTTGAGGGACCCCAAGCTTGG - Intergenic
1114387582 14:22270789-22270811 TGAGTTGGGGTCCCCAAACTGGG - Intergenic
1118983482 14:70734006-70734028 GGTGTTAAGGCTTTCAAACTGGG + Intronic
1122182538 14:99966767-99966789 GGTGAACGGGCCCCCAAGCTGGG + Intergenic
1122806549 14:104262885-104262907 GGTGTCAGGGCCCCCCACCCTGG + Intergenic
1133680095 16:8113249-8113271 GGTCTTATGGCCCCCAAACCAGG + Intergenic
1134456592 16:14399799-14399821 GGTGTTGGGGCCAGCAGACTAGG + Intergenic
1139379201 16:66519943-66519965 GCTGTTAGGGCCCCAAGACAGGG - Intronic
1142744370 17:1948348-1948370 GGTTCTGGGGCCCCCAAACCTGG - Intronic
1144886560 17:18467110-18467132 GGTGCTAAGGGCCCCACACTTGG - Intergenic
1145145647 17:20477198-20477220 GGTGTTAAGGGCCCCACACTTGG + Intergenic
1145234840 17:21201199-21201221 GGGGTTAGGGTCCCCATGCTTGG - Intronic
1145763704 17:27443542-27443564 GGTGCTAAGGGCCCCACACTTGG - Intergenic
1146644125 17:34565198-34565220 GGTGTTAGGGCCTCCTATCATGG - Intergenic
1152066197 17:78113760-78113782 GGTGAAAGGGCCACCAAACAAGG + Intronic
1152088132 17:78232425-78232447 GCTGTGAGGGGCCCCGAACTGGG - Intronic
1152143148 17:78550399-78550421 GGTGTCAGGGCCCCTACACACGG - Intronic
1159367557 18:67488479-67488501 GTTGTTAGAACCCCCAAATTTGG - Intergenic
1159956175 18:74519859-74519881 GGGCTCAGGGCCCCCAAGCTGGG + Intronic
1160966126 19:1747723-1747745 CCTGTGAGGGCCCCGAAACTGGG + Intergenic
1161838497 19:6664336-6664358 GGTCTGTGGGCCCCCAAACATGG - Intronic
1162343258 19:10105218-10105240 TGGGTTGGGGCCCCCACACTGGG + Intergenic
1165421294 19:35723235-35723257 GGTGTTAGGGCCCCCAAACTTGG - Exonic
1165789905 19:38485147-38485169 TGTGTTTGGGCCCCCAGACTGGG - Intronic
938234618 2:129695803-129695825 GGGGTCAGAGCCCCCAAACACGG + Intergenic
1178746686 21:35258345-35258367 GGTTTTAGGGCCCCAAATCAAGG - Intronic
1179272335 21:39861180-39861202 GGTGTTAGGGCGCTCACCCTGGG - Intergenic
1181107723 22:20584786-20584808 GGTGTGAAGGCCCCCTAAATGGG + Intronic
1183780801 22:39997757-39997779 AGTTTTAGGGTCCCCAAACCAGG - Intronic
1184752672 22:46497599-46497621 GGAGTTAGGGCCCCTAATCCAGG + Intronic
949883538 3:8678705-8678727 GGTCTTAGGACCCCCAACGTGGG + Intronic
983469291 4:168136796-168136818 GGGGTTGGAGCCCCCACACTGGG - Intronic
984959046 4:185076757-185076779 GGTGTAAAGGCCCCTGAACTGGG - Intergenic
999428828 5:151508981-151509003 GGTTTTAGGGCTCCCAAACTTGG - Intronic
1001858637 5:175033951-175033973 AGTGATAGGGGCCCCAAACTTGG + Intergenic
1006123843 6:31824766-31824788 GGTGTTGGGACCCCAAATCTTGG - Intergenic
1008763190 6:54879043-54879065 GGTGTCAGAGGCCCCAAAGTTGG + Intronic
1016611937 6:145999678-145999700 GGGGTTAGAGCCCCCACACAGGG - Intergenic
1026895952 7:74010220-74010242 GCTTTTAGGGACCCCAGACTGGG - Intergenic
1041030861 8:53733998-53734020 GCTGTTAAGGCCCTCAAACATGG - Intronic
1043993153 8:86780813-86780835 GGGGTCAGAGCCCCCAAACTGGG + Intergenic
1046929066 8:119824945-119824967 GGTGTCAGAGCCCCCACACAGGG + Intronic
1053388005 9:37710522-37710544 GGTGTTTGGGCACACAAAGTCGG - Intronic
1058608824 9:106753000-106753022 GGTCTTATGGCCCCCCATCTGGG - Intergenic
1185771137 X:2766508-2766530 GGTCTTAGGACGCCCAAACAAGG + Intronic
1188278007 X:28225320-28225342 GGTGTTAAGGCACGCAAAATTGG - Intergenic
1195929947 X:110064404-110064426 GGTGCAAGGGCCCCCAGCCTTGG - Intronic
1197136119 X:123061397-123061419 GCTGTTAGGTATCCCAAACTAGG - Intergenic