ID: 1165421296

View in Genome Browser
Species Human (GRCh38)
Location 19:35723249-35723271
Sequence CAGCACTGCTTCTTGGTGTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421296_1165421298 -8 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421296_1165421305 29 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421305 19:35723301-35723323 CCCGTGGTTGTTGGTCCCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1165421296_1165421299 -7 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421296_1165421302 20 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421302 19:35723292-35723314 GACCTCATTCCCGTGGTTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1165421296_1165421300 -6 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421296_1165421301 13 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421296 Original CRISPR CAGCACTGCTTCTTGGTGTT AGG (reversed) Exonic
900160169 1:1219608-1219630 CGGCACTGCCTCTGGGTGTGTGG + Intronic
902181310 1:14690618-14690640 CAGCATTCCTTCTTGGTGAATGG - Intronic
905827614 1:41037953-41037975 CAGAAATGCTTCTTGATGCTTGG + Intronic
906779370 1:48558680-48558702 CAGCACTGTTTCTTGGGCATTGG - Intronic
907156061 1:52335351-52335373 TAACACTGCTTCATGATGTTTGG + Intronic
910058221 1:83057320-83057342 CAGCCCTACTTATTGGTGTATGG - Intergenic
910106579 1:83637748-83637770 CAGCACTGCCTTTTGTTGTATGG - Intergenic
916352357 1:163865356-163865378 CAGCACTAATTTTTGGAGTTAGG - Intergenic
916408223 1:164518763-164518785 CAGCACTGCTTGTTGCTGAGGGG - Intergenic
916444550 1:164860138-164860160 CACCACTGCTTCTGGGTGTGAGG - Intronic
916582059 1:166117786-166117808 CAGCAGGGCTTCTGGGTGTCTGG + Intronic
917206340 1:172575263-172575285 CAGTACCACTTCTTGGGGTTTGG - Intronic
918384244 1:183989318-183989340 CAGCACTGCCTCATGGTGCCTGG + Intronic
920556272 1:206907136-206907158 CAGAACTGCCTCTTGTTGCTGGG + Intronic
921588224 1:216973484-216973506 CAGCACTGCTTCTGGGCCCTGGG - Intronic
922623166 1:227006997-227007019 CAGCAATTCTGCTTGGTGGTGGG + Intronic
923884638 1:238140893-238140915 CAGCATAACTTCTTGGTGATTGG + Intergenic
924021912 1:239792270-239792292 CATCACTGCTCCCTGGTGTCTGG - Intronic
924703887 1:246482296-246482318 CAGCAGTGCTCCTTAGTGATAGG + Intronic
1063826617 10:9905747-9905769 TAGCACTTTTTCTTGGAGTTTGG + Intergenic
1064636014 10:17367911-17367933 CAGCTCTGCTTATGTGTGTTCGG - Intronic
1067263201 10:44712710-44712732 CAGCACTGTTGCTTGTGGTTTGG + Intergenic
1071061557 10:81576103-81576125 GAGAAATGTTTCTTGGTGTTTGG + Intergenic
1071725011 10:88189976-88189998 CATGACTCCTTCTTGGGGTTAGG + Intergenic
1072532666 10:96334189-96334211 CTGCACTGCTTCTTACTGTTGGG + Intronic
1074265946 10:111903464-111903486 CAGAACTAATTCTTGGTGCTAGG + Intergenic
1076021501 10:127077447-127077469 CAGCACTGCTTCATGTCGGTTGG + Intronic
1076705813 10:132301065-132301087 CAGGCCTTCTACTTGGTGTTGGG - Intronic
1076705833 10:132301189-132301211 CAGGCCTTCTACTTGGTGTTGGG - Intronic
1076735946 10:132459019-132459041 CAGCACTGCACCTTGGAGGTGGG - Intergenic
1077929444 11:6715246-6715268 CAGCACTGCTTCTGAGTGGTTGG - Intergenic
1078296555 11:10076841-10076863 CAGCACTTGTGCTTGGTGTTGGG + Intronic
1081028703 11:38049763-38049785 CAGAACTGCTTCTAGGCCTTAGG + Intergenic
1087619794 11:100528461-100528483 CAGGAATGCTTCCTGGTGTGTGG - Intergenic
1088569987 11:111213520-111213542 AAGGACTGCTTCTTGTGGTTTGG + Intergenic
1090355993 11:126140677-126140699 CAACACTGCTTATTGGAGCTGGG - Intergenic
1093120524 12:15266056-15266078 CAGCAATGCTTATTGGGATTTGG - Intronic
1093450395 12:19306923-19306945 CAGGTCTTCTGCTTGGTGTTGGG + Intronic
1095532078 12:43200508-43200530 CAGCAATGCTTATTAGAGTTTGG + Intergenic
1098601814 12:72340563-72340585 CTGTAGTGCTTCATGGTGTTAGG + Intronic
1101755650 12:107618826-107618848 CAGCACTGCTTCGTGGAGTTGGG - Intronic
1102285856 12:111655973-111655995 CAGGACTGCTTCATGGGGTCAGG - Intronic
1102768209 12:115451425-115451447 CAGAACAGCTTCTATGTGTTGGG + Intergenic
1107630463 13:42337444-42337466 CATGAATGCTTCTTGGTATTTGG - Intergenic
1109421884 13:62123816-62123838 CATTACCGCTTCTTTGTGTTAGG - Intergenic
1111370901 13:87314837-87314859 CAGCTCAGCTGCTTGCTGTTGGG + Intergenic
1111472651 13:88704910-88704932 CAGAACAGCTTCTTTCTGTTGGG + Intergenic
1115440385 14:33427739-33427761 CAGCCCTTCTTCTGAGTGTTAGG - Intronic
1115512180 14:34148414-34148436 CAGAACCGCCTCTGGGTGTTCGG - Intronic
1116677777 14:47927263-47927285 GAGCTGTGCTTCTTGGGGTTGGG + Intergenic
1117311574 14:54529665-54529687 CTGCACTGTTTCTTGTCGTTAGG + Intronic
1118626727 14:67666131-67666153 CAGTACTGCTTCTTACTGTCTGG - Intronic
1118847658 14:69559832-69559854 CTGCACTGCTGTTTGCTGTTTGG + Intergenic
1120053475 14:79895769-79895791 CAGAATTGCTTCCTGCTGTTAGG + Intergenic
1121781099 14:96623107-96623129 CAGCACTGTTTCTGGGTCTTTGG + Intergenic
1121947956 14:98141210-98141232 CAGACCTGGTTCTTGGTGCTTGG + Intergenic
1121951980 14:98179228-98179250 ATGCTTTGCTTCTTGGTGTTAGG - Intergenic
1124106307 15:26740887-26740909 CAGCAGTGCTTGTGTGTGTTGGG - Intronic
1126223149 15:46238600-46238622 CAGGACTGGTTTTTGGTGGTTGG + Intergenic
1127535799 15:59888903-59888925 CAGCACTGCCTCTTTGTTTAGGG - Intergenic
1127937625 15:63657701-63657723 AAGAATTGCTTCTTGGTCTTGGG - Intronic
1129906711 15:79192757-79192779 CAGGAATGCTTCTTGGTGCCTGG + Intergenic
1131199327 15:90383559-90383581 CAGCTCTGCCTCTTGCTGTGTGG + Intergenic
1131803856 15:96100944-96100966 CAGCCCTTCTTCTAGGTGATGGG + Intergenic
1132415076 15:101613770-101613792 CAGCACTGCGTGTTGGGGGTAGG + Intergenic
1133178615 16:4035599-4035621 CAGAGCTGCTTCTTGGTTTCAGG + Intronic
1133850474 16:9498843-9498865 CAGAGCTGCTTCTTGGTGTCAGG + Intergenic
1135306351 16:21370763-21370785 CAGCACCGCTTCTCTGTGGTTGG + Intergenic
1135841567 16:25881579-25881601 GACAGCTGCTTCTTGGTGTTTGG + Intronic
1136303095 16:29349907-29349929 CAGCACCGCTTCTCTGTGGTTGG + Intergenic
1136570833 16:31095554-31095576 CACCAGTGCTTCCTGGTGGTCGG + Intronic
1138074472 16:54027257-54027279 CAGCTATGCTTGTTGGGGTTTGG - Intronic
1138354527 16:56366850-56366872 CGGCCCTGCTGCTTGGAGTTAGG + Intronic
1139280194 16:65764018-65764040 CAGCACTGACTGTTGGTGGTGGG - Intergenic
1139306490 16:65990638-65990660 GAGGGCTGCTTCTTTGTGTTTGG + Intergenic
1140546115 16:75811109-75811131 CAGCTCTTCTTATTGGGGTTGGG - Intergenic
1141475575 16:84270892-84270914 GAGCACCGATTCTTGGTGTCCGG + Intergenic
1141524018 16:84599778-84599800 CAGCTCAGCTTTTTGGTGTGTGG - Intronic
1143484499 17:7246118-7246140 CAGCACTGCACTTTGGAGTTGGG - Exonic
1147436621 17:40420455-40420477 CAGTACTTCTTCTGGGTTTTTGG - Intergenic
1147727160 17:42573108-42573130 AAGAACTGCTTCTTGCTCTTGGG + Exonic
1149101670 17:52913638-52913660 CAGCACTGCTTCTTAATGAAGGG + Intergenic
1150272037 17:63872967-63872989 CAGCAGTCCTTCTTGGTGGGGGG - Intronic
1150275584 17:63895863-63895885 CAGCAGTCCTTCTTGGTGGGGGG - Intronic
1150572999 17:66404616-66404638 CAGCCTTGCTTCTTCGTATTTGG - Intronic
1150700060 17:67438778-67438800 CAGTACTGCTTTTTGTTGCTGGG - Intronic
1151324785 17:73372390-73372412 CAGCCATGATTCTAGGTGTTTGG - Intronic
1151416472 17:73969359-73969381 CAGCTCTGCTTCTTAGGATTTGG - Intergenic
1151806132 17:76406638-76406660 CTGCACTGCTGGTTGGTGGTGGG - Intronic
1156026580 18:32661766-32661788 AGGCACTGTTCCTTGGTGTTAGG + Intergenic
1156244053 18:35280651-35280673 CAGCACTGGTTCTGAGTTTTAGG + Intronic
1156746628 18:40399882-40399904 CAGCAATGTTTTTTGGTTTTCGG - Intergenic
1157417340 18:47515228-47515250 AAGCACCTCTTGTTGGTGTTGGG - Intergenic
1158674962 18:59510011-59510033 CACCAGTGCAGCTTGGTGTTTGG - Intronic
1159444302 18:68521817-68521839 CACCATTGCTTCTCAGTGTTTGG + Intergenic
1160420793 18:78742501-78742523 CAGCATTGGGTCTTGCTGTTAGG - Intergenic
1161568318 19:5015852-5015874 GTGCTCTGCCTCTTGGTGTTGGG + Intronic
1162724404 19:12681316-12681338 GAGGACTGATTCTTGGTGTGGGG - Intronic
1163337496 19:16682821-16682843 CAGCAGTGCTGCTGGGTGTGCGG + Intronic
1164267573 19:23633994-23634016 CAGCACTGATTATTCTTGTTTGG - Intronic
1165421296 19:35723249-35723271 CAGCACTGCTTCTTGGTGTTAGG - Exonic
1165431855 19:35777461-35777483 CAGGACTGCTTCTTCGTGTGTGG - Intronic
925571149 2:5314058-5314080 GGTCACTGCTTCTTGCTGTTTGG - Intergenic
928202211 2:29255169-29255191 CAGCACTGCCTCTGGGGGTGTGG + Intronic
929812289 2:45200872-45200894 CAGCCCTGCTGCTGGGGGTTGGG - Intergenic
932653747 2:73588544-73588566 CAGTTCTGTTTCTTGGTGTCTGG + Intronic
933120542 2:78531167-78531189 CATCAGTGCTTCTGGGTGATTGG - Intergenic
935328923 2:101962204-101962226 CAGCATTGCTTCTGGTTGTGTGG + Intergenic
935497644 2:103801618-103801640 CAGCCCTGCTTCCTGGTTTCTGG + Intergenic
935880883 2:107564095-107564117 AAGCACTGCTTCTTCTTCTTGGG + Intergenic
936258717 2:110938439-110938461 CAGCACTGCAGCATGGTGCTTGG + Intronic
937215815 2:120312936-120312958 CAGCATTGCTTCTTGGTACGTGG + Intergenic
938697702 2:133849435-133849457 CAGCATTGCTTCTTTCTGATGGG - Intergenic
941637422 2:167950155-167950177 AAGAACTGCATATTGGTGTTAGG + Intergenic
944699459 2:202233631-202233653 CACCTCTGCTTCTTGGTGTGTGG - Intronic
946204240 2:218091968-218091990 CTGGACGGCTTCTTGGGGTTAGG + Intergenic
948671446 2:239571213-239571235 CAGCACTGCCTCTGGGTTCTGGG + Intergenic
1170079311 20:12454249-12454271 CAGCACTATTTCTAGGTGTTCGG - Intergenic
1170522155 20:17197794-17197816 CAGCACTGCTTGAAGGAGTTGGG + Intergenic
1171420964 20:25017433-25017455 CAGCACTGCTCCGAGGTGCTGGG + Intronic
1172388527 20:34550302-34550324 AAGCACTGCTGCTGGGTGCTAGG - Intronic
1173084038 20:39898198-39898220 CAGGACCTCTTCTGGGTGTTGGG + Intergenic
1175013347 20:55762694-55762716 CAGCATTGATTTTTGGTTTTTGG - Intergenic
1176246489 20:64099669-64099691 CAGCCCTGCTTCTCAGTGTGGGG + Exonic
1178265387 21:31138083-31138105 CAGAACTCTTTCTTGGGGTTTGG - Intronic
1179769298 21:43602606-43602628 CAGAAATGCCTCTTGGAGTTTGG - Intronic
1180968853 22:19804376-19804398 CTGCCCTGCTTCTTGGGGTATGG - Intronic
1181165079 22:20978999-20979021 AAGGTCTGCTTCTTGGGGTTGGG - Intronic
1181745899 22:24954662-24954684 TAGTACTGATTCTTGATGTTGGG + Intronic
1184365127 22:44046333-44046355 CAGAGCTGCTCCTTGGTGCTAGG + Intronic
950927903 3:16760737-16760759 CGCCACTGCTGCTTGGTGATGGG + Intergenic
951036074 3:17933695-17933717 CAGCACAGCTTCTTTGTGCACGG - Intronic
951354140 3:21643430-21643452 CACCAGTCCTTCCTGGTGTTAGG - Intronic
952433022 3:33244206-33244228 CTGCATTCCATCTTGGTGTTTGG - Intergenic
954873783 3:53787364-53787386 CCCCACTGCTTGTTGGTTTTTGG + Intronic
957258038 3:77863839-77863861 CACCATTGCTTGTTGGGGTTAGG + Intergenic
958983200 3:100749025-100749047 CAGAAGTCCTTATTGGTGTTTGG + Intergenic
959173943 3:102880837-102880859 CAGCACTACTTCATGGTCTGGGG - Intergenic
961631866 3:128307112-128307134 CAGCTCTGCTGCTGGGTGTGGGG + Intronic
962757099 3:138473451-138473473 CAGGAATGCTTCTTTGTCTTTGG + Intronic
964446181 3:156761097-156761119 CAGCCCTGCTGCATGCTGTTAGG - Intergenic
964946597 3:162232908-162232930 CAGCACAGTTTCTTGGTGCCTGG - Intergenic
966203792 3:177385127-177385149 CAGCACTTCTTTTTGGTTTCAGG + Intergenic
967903839 3:194485803-194485825 CATCCCTGAATCTTGGTGTTTGG - Intronic
968015368 3:195327354-195327376 CTGCACTGCTTTTTGCTGTTTGG - Intronic
969196474 4:5567323-5567345 CAGCAGCGCTTCTTGGATTTTGG + Intronic
974022507 4:56704584-56704606 CAGCACTCCTTGTTGGTTTTTGG + Intergenic
975428642 4:74260237-74260259 CAGGAATGAGTCTTGGTGTTAGG + Intronic
976450123 4:85179519-85179541 GAACAGTGCTTATTGGTGTTGGG + Intergenic
980938072 4:139245204-139245226 CAGCACGGGTTCTTGCTGTGTGG + Intergenic
981319254 4:143372377-143372399 CAGGACTTGTTCTTGGTGCTGGG + Intronic
982961306 4:161840970-161840992 CAGTAATGCTTCCAGGTGTTGGG - Intronic
985890577 5:2712239-2712261 GAGCCCTACTTCTTGGTATTGGG - Intergenic
986200058 5:5571638-5571660 CAGCACTCCTGGTTTGTGTTGGG + Intergenic
987243364 5:16023942-16023964 CAGCACTTCTCATTGGGGTTTGG + Intergenic
989285380 5:39692959-39692981 CAGCACTGTTTGTTGTTGGTAGG + Intergenic
989837010 5:46006099-46006121 CTGCACTGCTGCTTGTTGTGGGG + Intergenic
991220721 5:64212555-64212577 CAGGACTTATTCTTGGTGCTGGG - Intronic
991578663 5:68131416-68131438 CAGCAGTGCTTGTTGGTGTTAGG - Intergenic
992056667 5:72997385-72997407 CAGCACTGCACTTTGGAGTTGGG + Intronic
992326714 5:75667042-75667064 CAGCAGTGCCTCCTGGTGTGAGG + Intronic
996218916 5:120904217-120904239 CAACATTGCTTATTGGTGTATGG - Intergenic
996777561 5:127149088-127149110 CACCTCTGCTTCTTGTTATTAGG - Intergenic
997054250 5:130421592-130421614 CAGCAGGGCTTCTTGGGGGTTGG + Intergenic
997150563 5:131490114-131490136 CAGTTGTGCTTCTTGCTGTTTGG - Intronic
997992615 5:138558269-138558291 CAGCATTGCTTATTGGTTATTGG - Intronic
999406649 5:151312698-151312720 AAGCTGTGCTTCTTGGGGTTAGG + Intergenic
1002417609 5:179128824-179128846 CACCACTGCTTCCTGGGCTTAGG + Intronic
1002715606 5:181224682-181224704 CTTCAGGGCTTCTTGGTGTTTGG - Exonic
1003386963 6:5677845-5677867 CTGCACTCCTCCTTGGTGCTGGG - Intronic
1003633565 6:7810831-7810853 CAACACTGATTCTTGGCGATGGG + Intronic
1004281457 6:14282846-14282868 CTGCACAGATTCTGGGTGTTGGG + Intergenic
1004412068 6:15390326-15390348 CAACAGTGCTTGTTGGTGTGGGG + Intronic
1005454739 6:26008451-26008473 CACAACTGCTCCTTGGAGTTCGG - Intergenic
1006798502 6:36745312-36745334 CAGCTCTGCCTCTGGGTGGTGGG - Intronic
1007104403 6:39273570-39273592 CAGCCCTGGTTCTTGGTCTTGGG + Intergenic
1007330987 6:41108352-41108374 CAGCAATACCTCTTGGTGATTGG + Intergenic
1008510020 6:52267454-52267476 CAGCGCTGCTTATTGATGTCAGG - Intronic
1009350535 6:62671502-62671524 CATCAATGCTTCTGGGTCTTGGG - Intergenic
1013015179 6:106154612-106154634 CAGCTCTGTTTCTTTGTGCTTGG + Intergenic
1013045147 6:106478111-106478133 CACCACTGCTCCTTTGGGTTTGG + Intergenic
1013980723 6:116125365-116125387 AAGAACTGTGTCTTGGTGTTGGG + Exonic
1014490734 6:122058616-122058638 CATCTCTGCTTCTTGCTCTTGGG + Intergenic
1014998536 6:128184682-128184704 CTCCTCAGCTTCTTGGTGTTGGG - Exonic
1017059041 6:150463703-150463725 GGGCAATGCTTCTTAGTGTTAGG + Intergenic
1017926784 6:158917558-158917580 CACCACTGCATCTTGGAGATGGG - Intergenic
1022348310 7:29539514-29539536 CAGGACTGCATCTTGTGGTTTGG + Intergenic
1024339742 7:48245089-48245111 CACCAATGCTTCTTGGTGTCCGG + Intronic
1026810421 7:73459320-73459342 CAGCCCTGCTTCTTGGTCATTGG - Intronic
1027570148 7:79855901-79855923 GAGGATTGCTTCTTGGTGTCAGG - Intergenic
1032850937 7:135794745-135794767 CAGCTCTGCAACTTGGTGTTTGG - Intergenic
1036671908 8:10795410-10795432 CAACACTCCGTCTTGGTGTGGGG - Intronic
1037451884 8:19023795-19023817 CAGCACTGCTTCACAGTCTTTGG + Intronic
1039244943 8:35598339-35598361 CAGCACTGCTTCATGTTCTGAGG - Intronic
1039351127 8:36764977-36764999 CAGCACTGCCTCTTGGCTATGGG - Intergenic
1039915983 8:41860670-41860692 CAACACTGCTTCTTGTTGGAAGG - Intronic
1040513819 8:48118267-48118289 CAGCACTGGCTTTTGATGTTAGG + Intergenic
1041628255 8:60055873-60055895 CACCACTGCTTCCAAGTGTTAGG + Intergenic
1041737517 8:61127182-61127204 CAGAATTGCTTCTTGGCCTTTGG + Intronic
1041893384 8:62896659-62896681 AAGAACTGCTTCTAGGTGCTGGG + Intronic
1043594173 8:81864441-81864463 CAGGTCTGCTTCTTGGCCTTGGG - Intergenic
1046383057 8:113475073-113475095 CAGAGATGCTTCTTGGTGTGGGG + Intergenic
1047296687 8:123576516-123576538 AAGAGCTGCTTCTTGGTGGTGGG + Intergenic
1047465736 8:125111937-125111959 GAGCACTGCTTTTTGTTATTAGG + Intronic
1048722834 8:137346358-137346380 CAGCACTGCCTCTAGGTGGAAGG - Intergenic
1049005211 8:139850876-139850898 CAGGAATGCTTCTTGGTGTGTGG - Intronic
1049662528 8:143826151-143826173 AAGCACTGCTGCCTGGTGCTGGG - Intronic
1050646544 9:7725695-7725717 CAGGACTGCATTTTGGTTTTAGG - Intergenic
1050744776 9:8862713-8862735 CAGCATCTCTTCTTGCTGTTAGG + Intronic
1051710179 9:19923504-19923526 AAGGACTGCTTCTTGATGTGTGG - Intergenic
1051780444 9:20683867-20683889 CAGAACAGCTTCTTGGTATTTGG - Intronic
1051873056 9:21761451-21761473 CAGCTCTGCTTCTTGTGGTAGGG - Intergenic
1052270888 9:26626821-26626843 CAGAACTGCCTTTTGGGGTTTGG + Intergenic
1052488839 9:29137061-29137083 CAGTACTGCATCTTTGGGTTTGG - Intergenic
1052636513 9:31113077-31113099 CTGCTCTGCTTGCTGGTGTTAGG + Intergenic
1053603163 9:39631125-39631147 CAGCACTCCTTCATCCTGTTTGG - Intergenic
1053860806 9:42384884-42384906 CAGCACTCCTTCATCCTGTTTGG - Intergenic
1054250376 9:62711300-62711322 CAGCACTCCTTCATCCTGTTTGG + Intergenic
1054564484 9:66745828-66745850 CAGCACTCCTTCATCCTGTTTGG + Intergenic
1061014024 9:127971670-127971692 CATCATTGCATCTTGGTCTTGGG - Intronic
1186102697 X:6173575-6173597 CAGCATTCCTTCTGGGTGTGAGG - Intronic
1188070924 X:25717239-25717261 TAGCACTGCTTCTTTTTGCTAGG - Intergenic
1192027043 X:67465204-67465226 AAGCACTGCTGCTGGGGGTTTGG - Intergenic
1197581463 X:128288833-128288855 CAGCACTGGTTCTTGCTCTAGGG - Intergenic
1197605381 X:128579397-128579419 CTATACTGTTTCTTGGTGTTTGG - Intergenic
1197687612 X:129458511-129458533 CAGCACTGCCCCTTAGTGTGTGG + Intronic
1198144125 X:133837751-133837773 CAAAAATGCTTCTTGGTATTTGG - Intronic
1198799269 X:140432702-140432724 CAGCACAGCAGCTGGGTGTTTGG + Intergenic
1200425920 Y:3020248-3020270 GAGCACTGGTTCCAGGTGTTAGG + Intergenic
1200660430 Y:5950770-5950792 CACCACTGCTCCATGGGGTTGGG - Intergenic