ID: 1165421297

View in Genome Browser
Species Human (GRCh38)
Location 19:35723256-35723278
Sequence TCACACACAGCACTGCTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421297_1165421301 6 Left 1165421297 19:35723256-35723278 CCAAGAAGCAGTGCTGTGTGTGA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421297_1165421305 22 Left 1165421297 19:35723256-35723278 CCAAGAAGCAGTGCTGTGTGTGA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1165421305 19:35723301-35723323 CCCGTGGTTGTTGGTCCCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1165421297_1165421302 13 Left 1165421297 19:35723256-35723278 CCAAGAAGCAGTGCTGTGTGTGA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1165421302 19:35723292-35723314 GACCTCATTCCCGTGGTTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421297 Original CRISPR TCACACACAGCACTGCTTCT TGG (reversed) Exonic
904524548 1:31122925-31122947 ACACACACAGCACTGGCTCCAGG - Intergenic
906034454 1:42741634-42741656 GCACACACAGACCTGCTTCCTGG + Intergenic
906552379 1:46675875-46675897 TTACTCAAAGCACTGCTTCTTGG - Exonic
907129830 1:52086359-52086381 TCACACAAAGCTCTGCTGCCTGG + Intronic
908897497 1:68916833-68916855 TAATTCACTGCACTGCTTCTTGG - Intergenic
910164756 1:84314610-84314632 TCACACACATCACTGCATTCAGG - Intronic
913399737 1:118417792-118417814 TCACACACAGTTCTGTTTCTTGG - Intergenic
916327792 1:163582489-163582511 TGACACACTTCACAGCTTCTGGG + Intergenic
916880915 1:169018785-169018807 TCACAGACAGCACTGTTTGGGGG + Intergenic
917947522 1:179990540-179990562 TCACACACAGCTGTACTTGTAGG - Exonic
918053458 1:180995915-180995937 TAACACCCTGCAATGCTTCTGGG + Intronic
920719343 1:208372305-208372327 TCACACATTGGGCTGCTTCTAGG + Intergenic
921055417 1:211539034-211539056 TCAAACACAGCACTAATTTTGGG + Intergenic
921078951 1:211723636-211723658 TCACACTCAGCTTTGTTTCTTGG - Intergenic
921911342 1:220552602-220552624 TTCCACATAGCATTGCTTCTAGG - Intronic
922502068 1:226104646-226104668 TCACGCACCGCCCTGCATCTGGG + Intergenic
923405961 1:233660648-233660670 TCACACACAGAACTGGTTGGTGG - Intronic
1064282752 10:13966559-13966581 TCACACACAGCCATGGTTCTGGG + Intronic
1064585082 10:16832169-16832191 TCACAACCAGCCCTGCTTCCAGG + Intronic
1067940098 10:50647938-50647960 TCACACTGAGCACTGGTCCTGGG + Intergenic
1070533840 10:77360778-77360800 TCACCCAGAGCACCTCTTCTGGG - Intronic
1070659433 10:78293989-78294011 CCACACGCAGCACTCCTTCCCGG - Intergenic
1071537171 10:86443297-86443319 TCCTACACAGCACTACTTCTTGG - Exonic
1072622392 10:97088761-97088783 TCACCCACAGCCCTGGTTCCTGG - Intronic
1073286919 10:102395150-102395172 TCCCACACCGCACCGGTTCTGGG - Intronic
1074158932 10:110821445-110821467 TCACACACAGACATGTTTCTGGG - Exonic
1075911067 10:126126229-126126251 TCACGCACAGCACTAATGCTGGG + Intronic
1075939523 10:126377753-126377775 GCACACACAGATATGCTTCTGGG - Intronic
1076682517 10:132180510-132180532 ACACACACAGTTCTGCTTCCAGG - Intronic
1078759471 11:14240576-14240598 ACACACACAATATTGCTTCTTGG - Intronic
1079414591 11:20221819-20221841 ACACACACACCACTGATACTTGG - Intergenic
1079721931 11:23826092-23826114 ACAGACACAGCTCTGCTTCAGGG - Intergenic
1079723815 11:23853871-23853893 TCAAACCCAGCACTGCTTCCAGG - Intergenic
1080834428 11:35927230-35927252 TAACACTGAACACTGCTTCTGGG + Intergenic
1081709707 11:45208958-45208980 TCCCAAAGAGCACTGCTTCATGG - Intronic
1083604637 11:63970844-63970866 TCAGACACAGCTCCCCTTCTAGG + Intergenic
1084488318 11:69463908-69463930 TCACACACAGGCCAGCTGCTGGG + Intergenic
1084749412 11:71194316-71194338 TCACACGCGGCACTGATGCTGGG - Intronic
1086524812 11:87712590-87712612 TCAAACACAGAACTGCAACTTGG - Intergenic
1087219462 11:95530805-95530827 ACACACACAGCACTGTTTGTTGG + Intergenic
1088401518 11:109425739-109425761 GCACACACACCACTGCCTCCAGG - Exonic
1089316245 11:117593186-117593208 CCACACACAGCGATGCTTCAGGG + Intronic
1089865870 11:121630985-121631007 TCCCAGACCTCACTGCTTCTTGG - Exonic
1090261983 11:125327853-125327875 TCACACAGGGCACCGCTTCAGGG - Intronic
1090658476 11:128863247-128863269 GCACACACACCAGTGTTTCTTGG - Intronic
1091582981 12:1800056-1800078 TCAGACACAGGACTGAATCTCGG + Intronic
1091899848 12:4135864-4135886 TCACATACAAAAGTGCTTCTTGG + Intergenic
1092463645 12:8708808-8708830 TAAAAAACAGCACTGCATCTTGG - Intronic
1092864595 12:12749135-12749157 GCACCCAAAGCACTGATTCTGGG + Intronic
1096211774 12:49771674-49771696 TCACACACTGCACTCCATCCTGG + Intergenic
1096487834 12:51995468-51995490 CCACCCACAGCCGTGCTTCTAGG - Intronic
1098094892 12:66944708-66944730 TCACTCAGAGGACTGCTACTGGG + Intergenic
1100720893 12:97356856-97356878 ACATACCCAGCACTGCTGCTAGG - Intergenic
1100795586 12:98178465-98178487 TATAACACAGCACAGCTTCTGGG + Intergenic
1101541105 12:105666319-105666341 CCACTCACAGCTCTTCTTCTGGG - Intergenic
1103010642 12:117455852-117455874 TTCCACAAGGCACTGCTTCTGGG - Exonic
1103819478 12:123686089-123686111 TCACACACTGCACTCCATCCTGG - Intronic
1105453883 13:20523675-20523697 ACACACCCAGCTCTGCCTCTGGG - Intronic
1105626820 13:22120872-22120894 TCACACACAGGTCAGCTGCTTGG + Intergenic
1105946211 13:25192217-25192239 GCACACACAGCCCTGTTTGTGGG + Intergenic
1109184254 13:59250148-59250170 ACACACACAGAACTGCATATGGG - Intergenic
1112143330 13:96670880-96670902 GCAGACACAGCTGTGCTTCTTGG + Intronic
1113204820 13:107905063-107905085 TCACACAAAACAATACTTCTTGG + Intergenic
1114142551 14:19931329-19931351 TCTTCCACTGCACTGCTTCTGGG + Intergenic
1116648132 14:47556193-47556215 TGACACATAGCACAGCTTATAGG + Intronic
1117337584 14:54767880-54767902 TCTCACTCAGCACTGCTAATGGG + Intronic
1117549515 14:56819753-56819775 TCATCCACAGCAGTGCTCCTAGG + Intergenic
1118455059 14:65937923-65937945 TCATAGACATCAGTGCTTCTAGG + Intergenic
1118609309 14:67527839-67527861 TCACTCACAGCTCTGCATGTAGG + Intronic
1118756306 14:68846633-68846655 TCTCACTCAACACTGCCTCTTGG - Intergenic
1120009856 14:79401294-79401316 TGACAAACAGAACTGCTTCCAGG - Intronic
1120148913 14:81010930-81010952 TTACGGACATCACTGCTTCTTGG + Intronic
1120434760 14:84467074-84467096 TCACTCAAAGAACAGCTTCTAGG - Intergenic
1122945684 14:105007747-105007769 GCACACACAGCACTGCCACATGG + Intronic
1124239671 15:28019151-28019173 TCACACCCAGCGCTGCATCCTGG - Intronic
1125198507 15:37076503-37076525 TGGCACACAGCACTGACTCTAGG + Intronic
1125893877 15:43286142-43286164 CCACTCACAGCACAGCTCCTGGG + Intronic
1126028342 15:44471198-44471220 TCACACACAGGAATACTACTCGG - Intronic
1127120918 15:55771391-55771413 TCCCACAGAACATTGCTTCTAGG - Intergenic
1130845605 15:87741575-87741597 TTGCACAGAGCACTGCCTCTGGG + Intergenic
1130978327 15:88794305-88794327 TCACACGCAGCACCTTTTCTTGG + Intergenic
1131300665 15:91196961-91196983 TCACAAACAGCACTGCTGCAGGG + Intronic
1131796613 15:96024081-96024103 ACACACACACTACTGCTCCTTGG + Intergenic
1132253060 15:100349374-100349396 TCACACACAGCAGTCCTGTTGGG + Intergenic
1132624954 16:887283-887305 TCACACAGAGCACAGCGGCTGGG - Intronic
1133430544 16:5733463-5733485 CCACTGACAGCACTGCTGCTCGG - Intergenic
1135633484 16:24054611-24054633 ACACACACAGCTCCCCTTCTTGG - Intronic
1137414539 16:48262692-48262714 TCAAACACAGCTCTCTTTCTTGG - Intronic
1137944174 16:52717837-52717859 TCACACTCAGCTCTTCTTCTTGG + Intergenic
1138481116 16:57304005-57304027 TCCCACACAGCTCTGTCTCTTGG + Intergenic
1139074970 16:63434254-63434276 TCACACATAGCACTTTTTATAGG + Intergenic
1139884521 16:70198820-70198842 ACACTCACAGCCCTGCTTCCCGG - Intergenic
1140368000 16:74396672-74396694 ACACTCACAGCCCTGCTTCCCGG + Intergenic
1141097525 16:81173242-81173264 ACACACACAGCTCTCATTCTTGG - Intergenic
1141137962 16:81478839-81478861 TCACACCCTGCCCTTCTTCTGGG + Intronic
1141217479 16:82038698-82038720 TCACAGAAAGCACTGCCTCTGGG - Intronic
1143867562 17:9935073-9935095 TATCACACAGCGCTGCTTATAGG + Intronic
1147305091 17:39557758-39557780 CCATACAGTGCACTGCTTCTTGG + Intronic
1149585260 17:57782270-57782292 TCCCTCACATCTCTGCTTCTGGG + Intergenic
1150868896 17:68882690-68882712 TGACACACATCACTACTTCTTGG + Exonic
1153590441 18:6669026-6669048 TCACACTCAGCAATTCTTCAGGG - Intergenic
1156703262 18:39849970-39849992 TCACCTCCAGCACTGATTCTAGG - Intergenic
1156974659 18:43205171-43205193 TCAAACTCAGTACTGGTTCTGGG + Intergenic
1158095415 18:53764584-53764606 TCTCAAAGAGCACTTCTTCTGGG - Intergenic
1158639680 18:59193157-59193179 ACCCCCACAGCTCTGCTTCTAGG - Intergenic
1162737266 19:12753599-12753621 TCACACACAGGACTTATTCCTGG + Intronic
1165421297 19:35723256-35723278 TCACACACAGCACTGCTTCTTGG - Exonic
1167214206 19:48153682-48153704 ACACACACACCTCTCCTTCTGGG + Intronic
1167214219 19:48153764-48153786 ACACACACACCTCTCCTTCTGGG + Intronic
1168160004 19:54503779-54503801 TCCCACCCAGCACTGCCTTTGGG - Intronic
925662587 2:6218727-6218749 ACACACACAGCAATACTTCAGGG + Intergenic
925958629 2:8994345-8994367 TCTCTCGCAGCACTGCTTCCTGG + Intronic
926302432 2:11613987-11614009 TCACAGATAGCATTGCTTGTTGG + Intronic
927853237 2:26512964-26512986 TGTCACACAGCACAGCTTCCTGG + Intronic
928235303 2:29534096-29534118 CCACAGAGAGCATTGCTTCTTGG + Intronic
929087009 2:38178299-38178321 TCAACCACATGACTGCTTCTGGG + Intergenic
935853807 2:107252704-107252726 TCACAAACAGCACTGGGTCCGGG - Intergenic
935857596 2:107292250-107292272 ACACACACAGCTCTGTGTCTGGG - Intergenic
936882918 2:117277576-117277598 TTATACAAAGCATTGCTTCTGGG + Intergenic
939473133 2:142650867-142650889 TCACTCTCAGCACTACTTATAGG + Intergenic
940558387 2:155262277-155262299 TCATGCACAGCAGTGCTTCCAGG - Intergenic
940669501 2:156649944-156649966 TCCTTCACATCACTGCTTCTTGG + Intergenic
943078077 2:183222440-183222462 TAACCTACAGCACTTCTTCTTGG - Intergenic
945969435 2:216221501-216221523 TCTCACAAAGCATGGCTTCTGGG - Intergenic
946130082 2:217599925-217599947 TCTCACACAGCTCTGCTTCATGG - Intronic
946851207 2:223908895-223908917 ACACACCCAGCCCTGCTTCCCGG + Intronic
946930374 2:224664566-224664588 TCACATACATAACTGCTTTTTGG + Intergenic
948057644 2:235020746-235020768 ACACAAAAAGCACTTCTTCTAGG - Intronic
948972936 2:241443306-241443328 CTACACACAGCACTATTTCTGGG - Intronic
1168886187 20:1258805-1258827 ACACATAAAGCTCTGCTTCTTGG + Intronic
1168886223 20:1259243-1259265 ACACATAAAGCTCTGCTTCTTGG + Intronic
1168886288 20:1260121-1260143 ACACATAAAGCTCTGCTTCTTGG + Intronic
1171049352 20:21840726-21840748 TCACTCCCAGCTCAGCTTCTGGG - Intergenic
1171978502 20:31610633-31610655 TCACACACAGCAGGGCTTCCTGG + Intergenic
1172364915 20:34341766-34341788 TCACACACTGCACTCCAGCTTGG + Intergenic
1173344111 20:42182895-42182917 ACACACACACCCCTGCTTGTAGG - Intronic
1175324890 20:58116750-58116772 TCAGAGAGAGTACTGCTTCTTGG - Intergenic
1175633872 20:60564497-60564519 TCACACACAGCTCTTCAGCTTGG - Intergenic
1175725685 20:61316862-61316884 CCCCACCCAGCCCTGCTTCTCGG - Intronic
1175819674 20:61902038-61902060 TGACACGCAGGACTGCATCTTGG - Intronic
1176958669 21:15134969-15134991 ACACACCCAGCTCTGCCTCTGGG - Intergenic
1180833301 22:18917309-18917331 ACAGACACAGCTTTGCTTCTGGG + Intronic
1181986309 22:26802180-26802202 TCAGACACAGCATTCCTGCTGGG + Intergenic
1183207365 22:36428699-36428721 CCACACACACCTCTGCTTGTTGG - Intergenic
1183337872 22:37260974-37260996 TCACACACTGGATTTCTTCTGGG + Intergenic
1183674687 22:39292652-39292674 TCACACCCAGCAGGGCTGCTGGG - Intergenic
1185169267 22:49283020-49283042 TCAAACACAGCACAGCCTCCTGG - Intergenic
950313208 3:11977137-11977159 GCACACACAGAGCTGCTCCTGGG + Intergenic
951031329 3:17885103-17885125 GCACAAACAGCCCTGCTTCATGG - Intronic
951936121 3:28024869-28024891 CCCCACACAGTACTGCTACTGGG + Intergenic
952326603 3:32325928-32325950 CCACTGACAGCACTGCTCCTGGG - Intronic
954590922 3:51780966-51780988 TCACAAAAAGCTGTGCTTCTAGG + Intergenic
954993769 3:54863619-54863641 TCACACACAGCACTGTGTGTGGG - Intronic
960262541 3:115584251-115584273 ACACACAGAGGACTGCTTCTAGG + Intergenic
960807904 3:121601598-121601620 CCAGACACAGCCCTGCTGCTGGG + Intronic
961150945 3:124637316-124637338 ACACACACAGAACTGCCTCCAGG - Intronic
962230788 3:133663708-133663730 TGACACACCACACTGCTCCTGGG + Intergenic
962981289 3:140492756-140492778 TCAGACACAGCTCTAGTTCTGGG - Intronic
964046686 3:152336906-152336928 ACACACACATAACTGCTTTTAGG + Intronic
967269069 3:187718092-187718114 TCACAGATAGCCATGCTTCTGGG - Intronic
969196471 4:5567316-5567338 TCACCCTCAGCAGCGCTTCTTGG + Intronic
972955464 4:44384612-44384634 TCACACCCTTCTCTGCTTCTAGG - Intronic
975838896 4:78453752-78453774 TCATACACTGCACTGCAGCTTGG + Intronic
980290328 4:130841935-130841957 TCACATACAACACAGCTACTTGG - Intergenic
981296231 4:143135054-143135076 TCATTCACATCCCTGCTTCTAGG + Intergenic
983327344 4:166274044-166274066 CCACACAAACCACTGCTTTTTGG - Intergenic
984242332 4:177232692-177232714 GTCCACACAGCACTGCTGCTGGG - Intergenic
984840592 4:184064036-184064058 GCACACGCAGCACAGCCTCTGGG - Intergenic
985161455 4:187048755-187048777 TCACTCAGTGCCCTGCTTCTTGG + Intergenic
985917276 5:2932067-2932089 CCACACAGACCACTGTTTCTTGG - Intergenic
986627946 5:9740400-9740422 TACCACACAGCACTGCTTCATGG + Intergenic
988005580 5:25406349-25406371 TCACACAGATCTTTGCTTCTGGG + Intergenic
988005651 5:25407162-25407184 TCACACAGATCTTTGCTTCTGGG - Intergenic
989475156 5:41866573-41866595 TCACACACATCACTACCTCTTGG - Intronic
990732691 5:58826746-58826768 TGAGACACATTACTGCTTCTGGG - Intronic
991274040 5:64822218-64822240 TCAAACAGAACACTGCTTCAAGG - Intronic
994687805 5:102977713-102977735 CCACATACAGAACTGCTTTTGGG - Intronic
994722004 5:103391247-103391269 TCACACACTGCACTCCACCTTGG - Intergenic
996331883 5:122338973-122338995 TCACATGCACCTCTGCTTCTAGG + Intronic
997054246 5:130421585-130421607 CAACACACAGCAGGGCTTCTTGG + Intergenic
997367102 5:133333068-133333090 TCACACACAGCTGTGGATCTGGG + Intronic
998566436 5:143220044-143220066 TCACCCACAGCACAGGTACTGGG - Intronic
1000393794 5:160751575-160751597 TCACCCAAAGGACTGGTTCTCGG + Intronic
1001473200 5:172030599-172030621 TCACAAACAACACTGTCTCTTGG - Intergenic
1001757136 5:174179228-174179250 TCACACACATCACTGCCCCCAGG - Intronic
1004524144 6:16390401-16390423 TCATACACTGCACTGCCTTTGGG + Intronic
1005312565 6:24572361-24572383 CCATCCACAGCACTGCTTGTGGG - Intronic
1006630696 6:35427786-35427808 TCACACACAGAATGGCTCCTTGG - Exonic
1011134634 6:84086890-84086912 CCACACACAGCTGGGCTTCTGGG + Intronic
1012413166 6:98983415-98983437 TCACACATAACACAGCCTCTGGG - Intergenic
1012425285 6:99107432-99107454 TCTCACAGAGCCCTGCCTCTGGG + Intergenic
1012578362 6:100830752-100830774 TATCACAAAGCACTGTTTCTGGG + Intronic
1013435168 6:110097542-110097564 TCCCAAACACCACTGCTGCTAGG + Intergenic
1014980706 6:127943136-127943158 TCTCTCACAGCACTTCATCTTGG - Intergenic
1017629964 6:156387339-156387361 TCTCACACATCACTGCCTGTGGG + Intergenic
1019955038 7:4406631-4406653 TCACACACACTCCAGCTTCTGGG + Intergenic
1020542585 7:9477715-9477737 TCACATACAGAGCTGGTTCTAGG + Intergenic
1022322423 7:29299380-29299402 TCCCAGACAGCACTGCCTATGGG - Intronic
1023033760 7:36112585-36112607 TCACACACAGCCCTGCAGGTAGG + Intergenic
1023920552 7:44626198-44626220 TTTCACAGAGCACTTCTTCTGGG - Intronic
1023981797 7:45074697-45074719 TCACTCCCAGCCCTGCTCCTGGG - Intronic
1024045156 7:45580755-45580777 CCACACTCAGCACTGCTCTTGGG - Intronic
1024301331 7:47889793-47889815 TCAGTCCCAGCACTGCTTCCTGG + Intronic
1024389139 7:48787040-48787062 TCCCACTCTGCCCTGCTTCTCGG - Intergenic
1028869750 7:95756478-95756500 TGAAACACAGCTCTGTTTCTTGG + Intergenic
1030835858 7:114284352-114284374 TCACACACTGTCCTGGTTCTGGG - Intronic
1031468305 7:122140923-122140945 TTACAGACACCAGTGCTTCTTGG - Intronic
1033531789 7:142271553-142271575 TAACACACAGCACTGCCAATAGG - Intergenic
1034138216 7:148791658-148791680 CCACAGACAACACTGCTTCCAGG - Intronic
1034151773 7:148922467-148922489 CCACACACTGCACTGCCTGTGGG + Intergenic
1034481154 7:151321162-151321184 TTCCCCACAGCAATGCTTCTTGG - Intergenic
1037761822 8:21746558-21746580 CCAGACATAGCACTGCTTGTGGG + Intronic
1039610986 8:38919184-38919206 TCAGACACTGCACTGGATCTTGG + Intronic
1043021230 8:75002618-75002640 TCTCACACAACCCTGCTTCCAGG - Intronic
1044106757 8:88217930-88217952 TCACACAGAACACTGCACCTTGG + Intronic
1047989532 8:130271356-130271378 TAAGACACTGCACTGCTTGTAGG + Intronic
1048722838 8:137346365-137346387 TCACCCACAGCACTGCCTCTAGG - Intergenic
1048810255 8:138279262-138279284 AGACACACAGAACTGCTGCTCGG - Intronic
1048889058 8:138931728-138931750 TCACACAGCGCCCTGCTCCTGGG + Intergenic
1054789939 9:69247323-69247345 TCACACACAGCTGTGCTGCAGGG + Intronic
1055376356 9:75652221-75652243 ACACACACAGCACAGCTTAATGG + Intergenic
1058419056 9:104817484-104817506 TCTCACACAACAGAGCTTCTTGG - Intronic
1059748873 9:117229312-117229334 TCACACACAGGACTGCCCCAAGG + Intronic
1059860548 9:118456060-118456082 TCAAACACATCACTGCCTCCTGG + Intergenic
1060517552 9:124275535-124275557 TCTCAGACATCACTGCTTCTGGG + Intronic
1061356906 9:130112628-130112650 GTGCACACAGCACTGCTGCTGGG + Intronic
1062270347 9:135705400-135705422 GCACACACAGCACTTGTTTTTGG - Intronic
1062444701 9:136588724-136588746 CCACACACAGCAGGGCCTCTAGG - Intergenic
1203655212 Un_KI270752v1:17239-17261 TCACATACAGAACTGCAGCTCGG - Intergenic
1185582739 X:1223600-1223622 TGACACACAGCCCAGCTTCCAGG - Intergenic
1187573051 X:20524870-20524892 TCACACACACCACTCCAGCTTGG + Intergenic
1187810184 X:23167097-23167119 ACAGACACTGCTCTGCTTCTTGG + Intergenic
1189828736 X:44948373-44948395 GCACACACAGCTCTGTTTCTGGG - Intronic
1192027047 X:67465211-67465233 CCACACCAAGCACTGCTGCTGGG - Intergenic
1195772392 X:108365292-108365314 TCAGACACAGCACTAGTTGTTGG - Intronic