ID: 1165421298

View in Genome Browser
Species Human (GRCh38)
Location 19:35723264-35723286
Sequence CAGTGCTGTGTGTGAGTAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421296_1165421298 -8 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421295_1165421298 -7 Left 1165421295 19:35723248-35723270 CCCTAACACCAAGAAGCAGTGCT 0: 1
1: 0
2: 3
3: 11
4: 138
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421290_1165421298 17 Left 1165421290 19:35723224-35723246 CCTAGACAAGCCCAAGTTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421293_1165421298 7 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421294_1165421298 6 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237
1165421287_1165421298 30 Left 1165421287 19:35723211-35723233 CCTGTGTCAACTGCCTAGACAAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421298 Original CRISPR CAGTGCTGTGTGTGAGTAGC TGG Exonic
900181943 1:1315014-1315036 CAGGGCTGGGTGTGACAAGCTGG + Intronic
902376845 1:16033874-16033896 CAGAGCTGAGTGTGAGAAGATGG + Exonic
902382013 1:16057132-16057154 CAGAGCTGAGTGTGAGAAGATGG + Exonic
904386697 1:30147338-30147360 CATTGTTGTGTGTGACTAGAGGG + Intergenic
904556143 1:31365921-31365943 CAGTGCCGTGGGTGAGTGTCTGG + Exonic
905789593 1:40783215-40783237 CAGTGCTGTGTGTGGCTGGGTGG - Intergenic
905894996 1:41539942-41539964 CAGTGCTGAGTACGAATAGCAGG + Intronic
907386146 1:54126575-54126597 CAGTGCTCTGTGTGAATACTTGG + Intergenic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
912507066 1:110163679-110163701 CTGTGCTGTGTGTGAGGACTGGG - Intronic
913534774 1:119760777-119760799 CAGTGCTGTGGGTGAATACTGGG - Intronic
915635773 1:157185527-157185549 CACTGCTGTGTGTGGTGAGCAGG - Intergenic
915662358 1:157414903-157414925 CACTGCTGTGTGTGGTGAGCAGG - Intergenic
916573640 1:166048562-166048584 CAGAGGTATGTGTGAGTAGACGG + Intergenic
917206310 1:172574806-172574828 CAGTGCTGAGTGTGAGGTGGAGG - Intronic
918097935 1:181349771-181349793 CAGGGCTGTGTGTGTGTATAGGG + Intergenic
919732268 1:200920881-200920903 CTGGGCTGGGTGTGAGGAGCAGG + Intergenic
920661550 1:207919927-207919949 CAGAGCAGTGTCTGAGCAGCAGG + Intergenic
921929206 1:220741560-220741582 CAGGGATGTTTGTCAGTAGCTGG + Intergenic
924089705 1:240489486-240489508 ATCTGCTGTGTGTGAGAAGCAGG + Intergenic
1066285755 10:33964489-33964511 CAGTGCTTGGTGTGATTACCTGG + Intergenic
1069176478 10:65295557-65295579 CAGCCCTCTGTCTGAGTAGCTGG + Intergenic
1069249718 10:66253560-66253582 CACTGCTGTATCTCAGTAGCAGG + Intronic
1070396123 10:76012443-76012465 CATGGCTGTGTGTGTGTATCGGG + Intronic
1070918512 10:80169719-80169741 CAGAGGTGTCTGTGGGTAGCAGG - Intronic
1073138152 10:101230839-101230861 CAGGGCTGTGTGTGTGTGGGAGG - Intergenic
1075072170 10:119326633-119326655 CTGTGCGGGGAGTGAGTAGCAGG + Intronic
1075583502 10:123640273-123640295 CATTGCTGTTTGGGAGCAGCAGG + Intergenic
1077363925 11:2153888-2153910 CAGTGTTGTCTGTGAGAGGCAGG - Intronic
1079697741 11:23504182-23504204 CAGTGCTGTGGGAGAGTCACAGG + Intergenic
1081660133 11:44882989-44883011 CATTGCTGTCTGTGTTTAGCAGG + Intronic
1083445791 11:62707353-62707375 AAGTGCTGTGTCAGAGTAGAGGG + Exonic
1084214711 11:67641031-67641053 GAGTGCTCTGTGTGAGTTGGAGG + Intergenic
1084699611 11:70777789-70777811 CAGTGATGTGTTTGATGAGCTGG - Intronic
1088692997 11:112343890-112343912 CAGACCTGTGTGTGTGTTGCGGG + Intergenic
1090795448 11:130131724-130131746 CAGTTTTGTGTGAGAGTAGAAGG + Intronic
1091747169 12:2999807-2999829 CAGCACTGAGTGTGAGGAGCGGG - Intronic
1094063769 12:26342081-26342103 TTGGGCTGTGTGTGAGCAGCTGG - Intronic
1098425172 12:70355609-70355631 CATTGCTGTGTTTGTGTACCAGG + Intergenic
1102523735 12:113495885-113495907 CAGTGATCTGTGTGAGTCTCGGG + Intergenic
1102524083 12:113498949-113498971 CCCTCCTGTCTGTGAGTAGCAGG - Intergenic
1103651681 12:122437800-122437822 CAGTTCTGTGTCTGAGTGGTTGG - Intergenic
1103908129 12:124337755-124337777 CAGCTCTGTGAGTGAGAAGCTGG + Intronic
1104001235 12:124862019-124862041 CTGTGCTGTGAGTGAGCACCTGG - Intronic
1104993794 12:132641837-132641859 CTGTGCAGTGTGTGTGGAGCTGG - Exonic
1105820046 13:24072564-24072586 CTGAGCTGTGTGTGAGCAGGAGG - Intronic
1106733232 13:32563449-32563471 CAGTGTTGTGTGGGAATGGCTGG - Intergenic
1107539496 13:41373870-41373892 CAGTACTGTGTGTAAGTATGGGG + Intronic
1110453230 13:75660719-75660741 CTGTGCTGTCTATGAGTAGAAGG + Intronic
1112496603 13:99910577-99910599 CAATGCTGTGTGTGAGTTGTGGG - Intergenic
1112639078 13:101252501-101252523 AATTGCTGTGCATGAGTAGCAGG + Intronic
1112917757 13:104572213-104572235 CAGGGGTGTGTGTGAGAGGCAGG - Intergenic
1112922004 13:104625545-104625567 CAGTTCAATGTGTGACTAGCTGG - Intergenic
1113549908 13:111184788-111184810 CAGTCCTGTGTGTGGGTTACCGG + Intronic
1118723575 14:68610604-68610626 CAGTTCTGGGAGTGAGCAGCAGG - Intronic
1119778587 14:77263372-77263394 CATTGCTGTGTGGGAGAAGTGGG - Intergenic
1120174460 14:81278296-81278318 CAGTGCTTTCTTTGAGGAGCAGG - Exonic
1122200861 14:100121738-100121760 CAGGCCTGTGTGTGGGCAGCTGG + Intronic
1122500255 14:102193278-102193300 GAGTGCTGCGAGTGAGCAGCGGG - Intronic
1122571861 14:102709125-102709147 CATTTCTGAGTGTGAGTACCTGG - Intronic
1122713202 14:103676058-103676080 CAGCGCTGTGTGTGAGGGGCTGG - Intronic
1122862261 14:104587943-104587965 CAGAGCTGTGTGGGTGTGGCCGG - Intronic
1123029863 14:105446522-105446544 CAGCGCTGTGGGTGAGGGGCAGG + Intronic
1202906482 14_GL000194v1_random:76524-76546 CAGAGCAGTGTGTCAGTAGGTGG + Intergenic
1123552562 15:21397405-21397427 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1123552991 15:21399969-21399991 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1123589236 15:21837357-21837379 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1124793346 15:32751057-32751079 CAGTGCTGTGTGCAGGAAGCAGG + Intergenic
1125754940 15:42057172-42057194 CAGTGCTGCGTGACAGGAGCCGG + Intergenic
1125769045 15:42153084-42153106 ACGTGCTGTGTGGGAGTAGGAGG + Intronic
1126319314 15:47405201-47405223 GAGTGGAGTGTGTTAGTAGCAGG + Intronic
1126844877 15:52749554-52749576 CAGTTGTGTGTGTCAGAAGCTGG - Intergenic
1129172896 15:73818568-73818590 CAGGGCCGGGTGTGAGCAGCTGG + Intergenic
1131107843 15:89746833-89746855 CAGGGCTGTGTGTGTGGAGGCGG - Intergenic
1132024170 15:98390825-98390847 CAGTGGGGTGGGTGAGTAGTTGG - Intergenic
1132136086 15:99340715-99340737 GAGTTCTGTGTTTGAGTAGAAGG + Intronic
1132142810 15:99409121-99409143 CAGTGCTGTGTATGTGTCACTGG - Intergenic
1132217594 15:100077721-100077743 CAGTGTTGAATGGGAGTAGCAGG - Intronic
1132292366 15:100712550-100712572 GAGGGCTGTGTGGGAGAAGCTGG + Intergenic
1202961339 15_KI270727v1_random:127189-127211 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1133132823 16:3688334-3688356 CAGTCCTGTGTGTATGGAGCAGG - Intronic
1134043585 16:11085704-11085726 AAGTGTTGTATGTGAGTAGCTGG + Intronic
1137349996 16:47705339-47705361 CAGTCCTGTGTGTGAGTGAGTGG + Intergenic
1137546526 16:49408251-49408273 AAGTGATGTTAGTGAGTAGCTGG - Intergenic
1138008421 16:53357624-53357646 CAGCCCTGGGTGTGAGAAGCAGG + Intergenic
1138029720 16:53550718-53550740 CAGGGCTGTGTGTGTGGAGGAGG - Intergenic
1138097370 16:54222621-54222643 CAGTGGTGGGTGTGAGGGGCTGG + Intergenic
1139527442 16:67525591-67525613 CAGTGCCGTGTGTGAGGACTGGG + Intronic
1139841522 16:69885063-69885085 GAGTGGTGTGTGTGTGTAGGGGG - Intronic
1141111130 16:81271658-81271680 CTGTGCTGTGTGAAAGGAGCCGG - Intronic
1141401284 16:83749271-83749293 TAATGGTTTGTGTGAGTAGCCGG - Intronic
1143252293 17:5532709-5532731 CAGTGGTGAGTGTGAGTTGGGGG + Intronic
1143569357 17:7745349-7745371 AAATGCTGTGTGTGTGTAGGAGG + Intronic
1144384746 17:14738882-14738904 CAGTGCTGTGTTCAAGTAACTGG + Intergenic
1144725843 17:17502267-17502289 CAGTGCCGAGTGAGAGAAGCCGG + Intergenic
1147685999 17:42287364-42287386 CTGTGCTGTGAGTGGGCAGCTGG + Intergenic
1149345351 17:55728789-55728811 CAGGGGTGTGTGTGTGTAGGGGG + Intronic
1149671598 17:58417674-58417696 AAGTGTTGTGTGTGAGCACCAGG - Intergenic
1151283440 17:73092994-73093016 ATGTGCTGTGTGTGTGTTGCGGG + Intergenic
1151469169 17:74307219-74307241 CAGGGCTGTGTGAAAGGAGCAGG + Intronic
1153138945 18:1949941-1949963 TAGTGCTTTGTGTGAATATCTGG - Intergenic
1154297046 18:13160602-13160624 AAGTGATGTGTGTGTGTGGCAGG + Intergenic
1154453477 18:14500805-14500827 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1154453686 18:14502086-14502108 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1154453997 18:14503996-14504018 CAGAGCAGTGTGTCAGTACCTGG - Intergenic
1155695333 18:28678227-28678249 CAGTGCTATAAGTGAGTGGCAGG - Intergenic
1157984705 18:52423894-52423916 TAATGCTGTGTGTGAATGGCAGG + Intronic
1160329606 18:77979351-77979373 CAGAGCTGTGTGTGGGCAGGTGG + Intergenic
1163143539 19:15365627-15365649 CAGTGCTGTGTATGAGCCCCGGG - Intronic
1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG + Exonic
1166253952 19:41589333-41589355 GAGTGCTGTGTGTGCCCAGCAGG - Intronic
1166257334 19:41615797-41615819 GAGTGCTGTGTGTGACTAGCAGG + Intronic
1167660438 19:50793034-50793056 CAGTGATGTGTGTGACTAAGGGG + Intronic
925230380 2:2227541-2227563 CAGGGCTGGGTGTGACGAGCTGG - Intronic
927465411 2:23332735-23332757 CAGTGCTGTGTAACAGGAGCCGG + Intergenic
928126294 2:28618824-28618846 CTGTGCTATGTGTGAGGAACCGG - Intronic
928429518 2:31205940-31205962 GAATGCTGTGTGTCTGTAGCTGG - Intronic
929035752 2:37690029-37690051 CTGGGCTCTGTGTGAGTGGCGGG - Intronic
930065295 2:47323325-47323347 CAGGGCTGGGTGGGAGCAGCCGG - Intergenic
932314082 2:70768131-70768153 CAGGGCTGTGAGGGACTAGCGGG - Exonic
932634178 2:73373490-73373512 CACAGCATTGTGTGAGTAGCTGG + Intergenic
937870805 2:126784719-126784741 CAGTGCTTTCTGAGAATAGCAGG + Intergenic
938281333 2:130065616-130065638 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
939721221 2:145654405-145654427 CAGTGCTGTTTATTAGTATCAGG - Intergenic
944631205 2:201626689-201626711 CAGTGATGGGAGTGAGTAGCTGG - Intronic
947491040 2:230594427-230594449 TTGTGCTGTGTGTGGGCAGCTGG - Intergenic
948211128 2:236193916-236193938 CAGTGTTGTGTGTGGGTGGGTGG + Intergenic
948236512 2:236394858-236394880 CAGGGCTGTGTGTGTATTGCTGG + Intronic
948366547 2:237458681-237458703 CAATGCAGTGAGAGAGTAGCTGG - Intergenic
1170509336 20:17060503-17060525 CACTGCTGTGTGTGCATAGATGG - Intergenic
1170574990 20:17655621-17655643 CAGGTCTGTGGGTGAGTGGCTGG - Intronic
1170899496 20:20447367-20447389 TAGTGTTGTGTTTGTGTAGCTGG - Intronic
1170934130 20:20795270-20795292 CATGGCTGTGTGTGAGAAGCAGG + Intergenic
1171881704 20:30622124-30622146 CAGAGCAGTGTGTCAGTAGGTGG - Intergenic
1175199423 20:57267317-57267339 CAGTGCTCTGGGTGTCTAGCGGG - Intergenic
1175308980 20:57998328-57998350 CAGAGCTGTGTGTGGGGAGGGGG + Intergenic
1176036015 20:63036982-63037004 CTGTGCAGTGTGGGAGGAGCGGG + Intergenic
1176145006 20:63561651-63561673 CAGTGCCGCGTGTGGGCAGCAGG - Exonic
1176625827 21:9091323-9091345 CAGAGCAGTGTGTCAGTAGGTGG + Intergenic
1176820388 21:13650578-13650600 CGGAGCAGTGTGTCAGTAGCTGG + Intergenic
1176820705 21:13652500-13652522 CAGAGCAGCGTGTCAGTAGCTGG + Intergenic
1179080671 21:38167822-38167844 TAGTGGTGTGTGTGTGTAGTAGG + Intronic
1180069620 21:45429876-45429898 GAGTGCTGTGTCTGTGAAGCGGG + Intronic
1183467424 22:37986732-37986754 CAGTGCTGTGTGTGTGTGGTTGG + Intronic
1184364331 22:44040244-44040266 TAGTGATGTGTGTGATTAGAGGG + Intronic
1184393398 22:44218573-44218595 CAGAGATGTGTGTGTGTTGCGGG - Intronic
1184947926 22:47817511-47817533 CAGTGCTGTGAGTGACCTGCGGG + Intergenic
949392373 3:3577379-3577401 CAGTGCTGGGTGTACCTAGCAGG - Intergenic
949801724 3:7911530-7911552 CAGTGCTCTGTATGAGCAGGAGG + Intergenic
950578687 3:13848924-13848946 AAGTGTTGTGTATCAGTAGCCGG - Intronic
950892444 3:16416100-16416122 CAGTGCTCTGTGTAAGTGGGGGG - Intronic
952705912 3:36377950-36377972 CAGTGCTTTGAGTCAGTAGATGG - Intergenic
952943692 3:38461540-38461562 CAGGGCTGTGTGGGAGTAGAAGG + Intronic
953485519 3:43290992-43291014 CAGTGCTGTGAGTGAGTATAGGG + Intronic
960225544 3:115164086-115164108 CAGTGCTGTGTGTTAGTGTGTGG + Intergenic
960713741 3:120556171-120556193 CAGTGCTGTGTTCCAGGAGCTGG + Intergenic
961312913 3:126015247-126015269 CAGGGCTGCCTGTGAGGAGCCGG + Intronic
961488481 3:127234061-127234083 CAGTGTTGTGTGTGAGGGGAGGG + Intergenic
961871522 3:129992000-129992022 CAGTGCTGTGAAGGAGGAGCTGG - Intergenic
963166770 3:142212195-142212217 CAGTGGTGTGTGTGGGTACGTGG + Intronic
964307505 3:155356908-155356930 CATTGCTGTCTGTGAATGGCGGG - Intergenic
965625385 3:170679256-170679278 CAGTGCCATGAGTGAGCAGCAGG - Intronic
967146575 3:186611753-186611775 CGGTGTGGTGTGTGAGCAGCTGG + Intergenic
967267091 3:187700327-187700349 CAGTGCTGGGTGAGAGCTGCAGG + Intronic
967742597 3:193019780-193019802 AAGTACTATGTGTGAGGAGCTGG + Intergenic
968581107 4:1395692-1395714 CAGGGCTTTGTGTGAGCAGGCGG - Exonic
969111059 4:4844544-4844566 CAGAGCTGCCTGTGAGTAGAAGG + Intergenic
969570637 4:8006257-8006279 GGGTGCTGTGTGGGAGAAGCCGG - Intronic
969596035 4:8149794-8149816 CAGTCCTGAGTGTGAGGTGCTGG - Intronic
970366284 4:15361795-15361817 CATTGCTATGTATGAGTAGACGG + Intronic
972870597 4:43293123-43293145 CAATGGTGTGTGTGTGTGGCGGG + Intergenic
973338616 4:48981866-48981888 CAGTGCTGTGTGTGCCTAGCAGG - Intergenic
973745879 4:53962970-53962992 GGGTGGTGTGTGTGTGTAGCAGG - Intronic
975033258 4:69650254-69650276 TACTGCTGTGTGTGAATAGTAGG - Intronic
977291369 4:95168353-95168375 CAGTGCTGTTTGTTAGTATTTGG - Exonic
985523670 5:391138-391160 CGGTGGTGTGAGTGAGTACCTGG + Intronic
986327465 5:6686910-6686932 AGGGGCTGTGTGTGAGCAGCAGG - Intergenic
987195873 5:15525593-15525615 CATTGCTGTGTGTGTGTGGGGGG + Intronic
988458981 5:31415536-31415558 CAGTGCTGTGTGGAAGCATCAGG + Intronic
988968776 5:36445391-36445413 CAGTGCTGTCTGTGACATGCAGG - Intergenic
992861556 5:80916149-80916171 CAGTCCTGTGGGTGAGTGGATGG - Intergenic
995461877 5:112411857-112411879 CAGACCTGTGTTTGAGAAGCAGG - Intronic
996017996 5:118562274-118562296 CAGTTATGTGTATGAGAAGCAGG - Intergenic
999742379 5:154566133-154566155 CAGAGCTGGGTGGGAGGAGCTGG - Intergenic
1000280857 5:159780728-159780750 CTGTGCAGTGTGTGGGTAGGAGG - Intergenic
1000359588 5:160434650-160434672 CAGCCCTGTGTCTGAGTACCCGG - Intergenic
1002799429 6:507245-507267 CACTGCTGTGTGTGTGTGGGGGG - Intronic
1002953521 6:1839798-1839820 CAGTGATGAGTGTGAGGAGCAGG + Intronic
1003246967 6:4390560-4390582 CAGTCCTATGTCTGATTAGCAGG - Intergenic
1003378959 6:5605081-5605103 CACTGCTGTGTGTTTGGAGCAGG - Intronic
1004494920 6:16154545-16154567 CAGTGCTGTGGGTGGGTTGGGGG - Intergenic
1005650165 6:27878712-27878734 CATTGCTGTGGGGGAGTTGCAGG + Intergenic
1006382862 6:33710875-33710897 CGCAGCTGTGTGTGAGTAGTAGG - Intronic
1006474921 6:34247492-34247514 CAGTGCTGTGTCTCTGTTGCAGG - Exonic
1007402388 6:41610811-41610833 CAGGCCTGGGTGTGAGAAGCTGG + Intergenic
1009984032 6:70761054-70761076 CAGTGCTGTGTGTTTGAAACTGG + Intronic
1011099933 6:83709207-83709229 GGGCGGTGTGTGTGAGTAGCTGG - Exonic
1011453438 6:87520676-87520698 CTGTCCTGTGTGTCAGTAGTTGG - Intronic
1011827720 6:91330314-91330336 CTGTACTGTGTGTGAGTGGTAGG + Intergenic
1012332832 6:98015043-98015065 CAGTGCTATGTTTGCATAGCTGG + Intergenic
1012415119 6:99004847-99004869 CACTCCAGTGTGTGAGGAGCAGG - Intergenic
1016895289 6:149045486-149045508 CTGTTCTTTGTGTGACTAGCAGG - Intronic
1016936539 6:149452346-149452368 CAAAGCTGTGTCTGAGAAGCCGG - Intronic
1019006140 6:168798360-168798382 CAGTGCTGGGGGTGAGCCGCGGG + Intergenic
1019287044 7:228890-228912 CAGTGCTGAGTTTGAGGAGGAGG - Exonic
1020713680 7:11641556-11641578 CAATGTTATCTGTGAGTAGCTGG - Intronic
1023792788 7:43766775-43766797 CAGAGCTGTGAGTGACTGGCAGG - Intronic
1023803806 7:43857031-43857053 CATTGCTGAGTGTGAGAATCAGG + Intergenic
1023987591 7:45105806-45105828 CAGTCCTGTGTGTGAGCTGGAGG + Intronic
1024307947 7:47943894-47943916 TAGGGCTGTGAGTGAGCAGCAGG - Intronic
1024749320 7:52446221-52446243 CTCTGCTGTGTTTCAGTAGCAGG + Intergenic
1025741684 7:64202827-64202849 CAGTGCTGTAGCTCAGTAGCTGG - Intronic
1025746145 7:64244755-64244777 CAGTGCTGTAGCTCAGTAGCTGG - Intronic
1026502875 7:70957830-70957852 GAGAGCAGTGTGTAAGTAGCAGG + Intergenic
1026976907 7:74504470-74504492 CAGCTCTGCGTGTGAGCAGCTGG + Intronic
1027436056 7:78165583-78165605 CAGTGCTGTGTGTGGGAAAAGGG - Intronic
1027875018 7:83757684-83757706 CAGTGTGTTGTGTGACTAGCTGG + Intergenic
1029510415 7:100991162-100991184 CAGTGTTGTGTCTGTGGAGCCGG - Exonic
1030825133 7:114146740-114146762 CATTGCTGTGTGTGACAGGCAGG + Intronic
1032401326 7:131626331-131626353 CAGTGCTGTGAGTGTGCAGGTGG + Intergenic
1033586699 7:142779651-142779673 CAGTGCTGTGATGGAGGAGCAGG - Intergenic
1035178489 7:157072017-157072039 CAGTGGTGTCTGTGAGTGCCCGG + Intergenic
1035972979 8:4272108-4272130 CAGGGGTGTGTGTGTGTGGCTGG + Intronic
1038041634 8:23728277-23728299 CAGGGCTGTGTGTCTGTACCAGG + Intergenic
1039750699 8:40475721-40475743 CACAGTTGTGTGTGAGAAGCTGG - Intergenic
1040386108 8:46916096-46916118 CAGTGTTGTGTGGGAGAAACAGG + Intergenic
1040581942 8:48705490-48705512 CAGAACTCTGTGTGAGTGGCTGG + Intergenic
1040831538 8:51682506-51682528 CAGAGCTGTGTGTGAACAGAGGG - Intronic
1040991344 8:53353380-53353402 CAGTGCTTTGTCTGTGTAACTGG + Intergenic
1042077337 8:65010462-65010484 TGGTGCTGTGTGTGGGTGGCAGG - Intergenic
1042435890 8:68764163-68764185 CAGTGCAGGGTGTGAGGAGAGGG + Intronic
1042723973 8:71852414-71852436 CCTGGCTCTGTGTGAGTAGCTGG + Intronic
1047526548 8:125638793-125638815 CAGTGCTTTGTGTGGGAGGCAGG + Intergenic
1048139255 8:131777148-131777170 CACTGCTGTCAGTGAGCAGCAGG - Intergenic
1048420929 8:134277701-134277723 GAGTGGTGTGAGTGAGCAGCGGG + Intergenic
1049181910 8:141227273-141227295 CAGTGCCGTGTGTGATAAACTGG + Intronic
1049545571 8:143229133-143229155 CAGGGGTGTGTGTGAGAAGCCGG - Intergenic
1049752454 8:144291636-144291658 CGGGGCTGTGTGTGCGCAGCGGG + Exonic
1052273725 9:26655173-26655195 AAGTGCTGTGGGTGAGCAGCAGG + Intergenic
1053417940 9:37958595-37958617 CATTGCTGTCTGTGTGTAGTTGG - Intronic
1055496787 9:76862614-76862636 GGGTGCTATGTGTGTGTAGCGGG - Intronic
1056258353 9:84823571-84823593 CAGTCCTGGGCGTCAGTAGCTGG + Intronic
1057910509 9:99016449-99016471 CAGTGCTGTGTGTGTGTTGGGGG + Intronic
1058734751 9:107883954-107883976 CCGTGCTGTGTGTGAGTCAGAGG - Intergenic
1060269102 9:122128579-122128601 CGGTGCTGGGGGTGACTAGCGGG - Intergenic
1203526651 Un_GL000213v1:97065-97087 CAGAGCAGCGTGTCAGTAGCTGG - Intergenic
1203526862 Un_GL000213v1:98343-98365 CGGAGCAGTGTGTCAGTAGCTGG - Intergenic
1203749000 Un_GL000218v1:61744-61766 CAGAGCAGTGTGTCAGTAGGTGG + Intergenic
1188537589 X:31214818-31214840 GTGTGGTGTGTGTGTGTAGCTGG + Intronic
1189180925 X:39003944-39003966 CAGAGCTGTGAGGGAGTAGCTGG + Intergenic
1191875221 X:65788545-65788567 CAGTGCTGTGTGGGACTCACTGG + Intergenic
1192358752 X:70425558-70425580 CAGAGCTGGGTTTGAGCAGCTGG - Intronic
1197425320 X:126289844-126289866 CAGAGCTTTTTGTGAGCAGCTGG + Intergenic