ID: 1165421299

View in Genome Browser
Species Human (GRCh38)
Location 19:35723265-35723287
Sequence AGTGCTGTGTGTGAGTAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421295_1165421299 -6 Left 1165421295 19:35723248-35723270 CCCTAACACCAAGAAGCAGTGCT 0: 1
1: 0
2: 3
3: 11
4: 138
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421294_1165421299 7 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421290_1165421299 18 Left 1165421290 19:35723224-35723246 CCTAGACAAGCCCAAGTTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421296_1165421299 -7 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227
1165421293_1165421299 8 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421299 Original CRISPR AGTGCTGTGTGTGAGTAGCT GGG Exonic
900593521 1:3470167-3470189 AGTGGTGTGTGTGAGTGGGCTGG + Intronic
904613329 1:31736898-31736920 AGTGCTGTGTGTGTGTCACCAGG - Intronic
905789592 1:40783214-40783236 AGTGCTGTGTGTGGCTGGGTGGG - Intergenic
906612394 1:47212441-47212463 AGTGCTGTGTGAGAGAGGCCTGG - Intergenic
907514788 1:54986666-54986688 AGTGCTGTGTGAGAGAGGCATGG + Intronic
910250482 1:85192851-85192873 TGTACTGTTTGTGAGTAGCATGG - Intronic
910982077 1:92968236-92968258 ATTGGTGTGTGTGAGAGGCTTGG - Intergenic
913192722 1:116426859-116426881 GGAGCTGTGTGTGGGCAGCTGGG - Intergenic
913424515 1:118712598-118712620 AGGGTTGTGTGTGACAAGCTGGG + Intergenic
915529064 1:156493082-156493104 AGTGCTGTGGGTGAGAAGAAAGG - Intronic
918699279 1:187587177-187587199 AGTGATGTGTGTTAACAGCTTGG + Intergenic
921762576 1:218933185-218933207 AGTGATGTTTGTAAGTAACTTGG + Intergenic
921929207 1:220741561-220741583 AGGGATGTTTGTCAGTAGCTGGG + Intergenic
923405964 1:233660657-233660679 AGTTCTGTGTGTGAGTTGCACGG + Intronic
924089706 1:240489487-240489509 TCTGCTGTGTGTGAGAAGCAGGG + Intergenic
1065004757 10:21369236-21369258 AGCGCTGTGGGGGAGTTGCTGGG - Intergenic
1065722183 10:28637467-28637489 AGTACTGTGTGTTACTGGCTGGG + Intergenic
1066285756 10:33964490-33964512 AGTGCTTGGTGTGATTACCTGGG + Intergenic
1067708541 10:48629089-48629111 AGGGCTGGGTGTTAGCAGCTGGG - Intronic
1069176479 10:65295558-65295580 AGCCCTCTGTCTGAGTAGCTGGG + Intergenic
1070663489 10:78327556-78327578 AGTGGTGTTTGTGAGTTCCTCGG + Intergenic
1071566367 10:86673360-86673382 ACGGCTGTGTGTGAGCAGGTGGG + Intronic
1072205488 10:93201095-93201117 AATACTGTGTGTGGGTAGATGGG + Intergenic
1073043544 10:100623117-100623139 AGTGTTGTGTGTGAGAAACATGG + Intergenic
1073943151 10:108720404-108720426 AGTGCTGTGTTTGTGTTGCTTGG - Intergenic
1073981998 10:109164709-109164731 AATGCGTTGTGTGAGAAGCTGGG - Intergenic
1075702444 10:124478177-124478199 AGGGCTGTGTGGGCGCAGCTCGG + Intronic
1075903318 10:126060952-126060974 AGTTCTGTGTGTGTAGAGCTTGG - Intronic
1076134232 10:128034331-128034353 AGTTCTGTGTGTGTGTCGGTGGG - Intronic
1078110361 11:8387227-8387249 AGAGGTGTTTGTGAGTTGCTCGG + Intergenic
1083108815 11:60385213-60385235 AGCTCTGTGTGTGAGTAGAATGG + Exonic
1084214712 11:67641032-67641054 AGTGCTCTGTGTGAGTTGGAGGG + Intergenic
1084699610 11:70777788-70777810 AGTGATGTGTTTGATGAGCTGGG - Intronic
1084916962 11:72435653-72435675 GCAGCTGTGTGTGAGAAGCTGGG + Intergenic
1087512338 11:99113460-99113482 AGTACTGTATGTGACTAACTTGG + Intronic
1087688014 11:101287064-101287086 ACTGCTGTGTGTGAGGGGGTGGG - Intergenic
1089589627 11:119532091-119532113 ACTGCTGTGTGTGAGCAGGATGG - Intergenic
1090381860 11:126332955-126332977 TGTGGTTGGTGTGAGTAGCTGGG + Intronic
1092311316 12:7357554-7357576 AGTGCAGTGTTTGATCAGCTGGG + Intronic
1094690188 12:32761172-32761194 AGTTCTGTGTGTCAGTGCCTTGG + Intergenic
1096715388 12:53488011-53488033 AGTACCGTGTGTAAGTACCTGGG - Intronic
1096780601 12:53989727-53989749 AATGCTGTGTGTGAGTGCGTGGG - Exonic
1101876081 12:108597752-108597774 AGTGTTGTGTGTGTGCGGCTGGG - Intronic
1101926833 12:108978749-108978771 TGTGCTGTGTTTAATTAGCTTGG - Intronic
1103908130 12:124337756-124337778 AGCTCTGTGAGTGAGAAGCTGGG + Intronic
1103916664 12:124379275-124379297 GGCTCTGTGTGTGAGGAGCTGGG - Intronic
1104579743 12:130002242-130002264 TGTCCTGTGTGTGAGTCACTTGG - Intergenic
1106178737 13:27352960-27352982 GGTGCTGTGTGTGTGTGTCTGGG + Intergenic
1106406471 13:29479225-29479247 AATGATGTGTCTGTGTAGCTCGG + Intronic
1107430180 13:40333405-40333427 AGAGCTGGGGGTGAGTGGCTGGG + Intergenic
1112639079 13:101252502-101252524 ATTGCTGTGCATGAGTAGCAGGG + Intronic
1112930337 13:104727978-104728000 AGTACTGTGTGTGTGTATGTGGG - Intergenic
1114449020 14:22812684-22812706 AGTGCTTACTGTGAGAAGCTGGG + Intronic
1114453548 14:22841529-22841551 AGCGCTGTGTGTGGGTACGTAGG - Exonic
1115873546 14:37834954-37834976 AGTGGTGTCTGTGAGTTCCTTGG + Intronic
1116870108 14:50062239-50062261 AGTGCTGTGTGTCAGTGTCAAGG + Intergenic
1117366928 14:55038361-55038383 GAAGCTGTGTGTGAGTAGCCAGG + Intronic
1117767814 14:59101022-59101044 CAGGCTGTGTGTGAGTACCTGGG - Intergenic
1120644724 14:87059888-87059910 AGTGTTGTGTCTGAGTTGTTAGG - Intergenic
1120936044 14:89896266-89896288 CCTCCTGTGAGTGAGTAGCTGGG - Intronic
1121337053 14:93083860-93083882 AGTGCTGGGTGTGGGCAGCTTGG - Intronic
1121429233 14:93874977-93874999 AGTGATCTGAGGGAGTAGCTGGG + Intergenic
1122270531 14:100566912-100566934 AGTGCCGTGGGTGAGTGGCTTGG - Intronic
1122500254 14:102193277-102193299 AGTGCTGCGAGTGAGCAGCGGGG - Intronic
1202906483 14_GL000194v1_random:76525-76547 AGAGCAGTGTGTCAGTAGGTGGG + Intergenic
1123552561 15:21397404-21397426 AGAGCAGCGTGTCAGTAGCTGGG - Intergenic
1124588187 15:31030022-31030044 ATTGAAGTGTGTTAGTAGCTTGG - Intronic
1125341211 15:38677431-38677453 AGTGATCTGTGTGAGCAGCCTGG - Intergenic
1125899039 15:43328715-43328737 TGAGCTGTGTGGGAGTACCTTGG + Exonic
1126263568 15:46725210-46725232 AGGGGTGTGTTTGAATAGCTTGG + Intergenic
1126319315 15:47405202-47405224 AGTGGAGTGTGTTAGTAGCAGGG + Intronic
1126844876 15:52749553-52749575 AGTTGTGTGTGTCAGAAGCTGGG - Intergenic
1128680320 15:69646824-69646846 AGTGCTGTGTGTGAGAATGATGG + Intergenic
1130717706 15:86352088-86352110 AATGCTGTTTCTGAGTAGCTAGG + Intronic
1133280926 16:4664898-4664920 AGGGCAGGGTGTGAGCAGCTTGG + Intronic
1134043586 16:11085705-11085727 AGTGTTGTATGTGAGTAGCTGGG + Intronic
1134256223 16:12613887-12613909 AGTGGTGGGGGTGAGTAGCTTGG - Intergenic
1134418533 16:14065796-14065818 AGTGCTAAGTGTTAGTGGCTGGG - Intergenic
1137546525 16:49408250-49408272 AGTGATGTTAGTGAGTAGCTGGG - Intergenic
1138097371 16:54222622-54222644 AGTGGTGGGTGTGAGGGGCTGGG + Intergenic
1140207787 16:72947735-72947757 AGGGTTGTGTGTGAGAAGCCCGG + Intronic
1140945043 16:79760147-79760169 AGAGCTGTGTGGCAGCAGCTTGG - Intergenic
1142412116 16:89922192-89922214 AGGGCTGTGTGTGGGTGGCGTGG - Intronic
1144067337 17:11636398-11636420 AGAGCTGGGGGTGAGTAACTCGG + Intronic
1144493509 17:15733389-15733411 AATGCTGGGTGTGAGTGGCAAGG - Intronic
1144906753 17:18643263-18643285 AATGCTGGGTGTGAGTGGCAAGG + Intronic
1147220562 17:38926761-38926783 AGTCCTGTGTGTGAGAAGGAAGG - Intergenic
1147686000 17:42287365-42287387 TGTGCTGTGAGTGGGCAGCTGGG + Intergenic
1150650669 17:67008103-67008125 CCTGCTGTGTGTGAGGTGCTGGG - Intronic
1152394821 17:80025907-80025929 AGTGCTGTATGTGAGGAGATAGG - Intronic
1152700520 17:81816241-81816263 GGTGCTGTGTGTGCATGGCTGGG + Intergenic
1154297047 18:13160603-13160625 AGTGATGTGTGTGTGTGGCAGGG + Intergenic
1154388105 18:13913696-13913718 AGTGCTGAGTGTGAGAAGTGAGG - Intronic
1154453476 18:14500804-14500826 AGAGCAGCGTGTCAGTAGCTGGG - Intergenic
1154453996 18:14503995-14504017 AGAGCAGTGTGTCAGTACCTGGG - Intergenic
1159559603 18:69979375-69979397 GGTGCTGTGTGAGAGGAGGTAGG - Intergenic
1160622762 18:80182105-80182127 AGCACTGTGGGTGAGCAGCTGGG - Intronic
1160962410 19:1729160-1729182 AGTGCTTTGTGTGAGCATGTGGG + Intergenic
1165421299 19:35723265-35723287 AGTGCTGTGTGTGAGTAGCTGGG + Exonic
1165729797 19:38137744-38137766 ACTGAGTTGTGTGAGTAGCTGGG + Intronic
1166253951 19:41589332-41589354 AGTGCTGTGTGTGCCCAGCAGGG - Intronic
1166257335 19:41615798-41615820 AGTGCTGTGTGTGACTAGCAGGG + Intronic
1167168748 19:47817222-47817244 CATGCAGTGTGTGAGAAGCTGGG - Intronic
1167169985 19:47824548-47824570 CATGCAGTGTGTGAGAAGCTGGG + Intronic
925230379 2:2227540-2227562 AGGGCTGGGTGTGACGAGCTGGG - Intronic
927145769 2:20164654-20164676 TGTGGTGTGTGTGAGTATGTAGG - Intergenic
927170565 2:20366057-20366079 AGTGATGTCTGTGTGTATCTGGG - Intergenic
927708814 2:25312914-25312936 GGTGGTGTCTGGGAGTAGCTGGG - Intronic
928429517 2:31205939-31205961 AATGCTGTGTGTCTGTAGCTGGG - Intronic
928716596 2:34068317-34068339 AGTGCAGTATATGAGTAGTTTGG + Intergenic
929400629 2:41577305-41577327 AGCTCTGTGTGTAAGGAGCTTGG + Intergenic
931094959 2:58929179-58929201 AGTGCTGTGTTCTTGTAGCTTGG - Intergenic
931920119 2:67005980-67006002 AGTGGTGTGTCTGACTAGTTTGG + Intergenic
932557024 2:72833475-72833497 TGTCCTGTGTGTGACTGGCTGGG - Intergenic
935133926 2:100281995-100282017 ACTGCAGTGTGGGAGTAGATTGG - Exonic
937061346 2:118982420-118982442 GGTGCAGTGGGTGAGTAGGTGGG + Intronic
937096656 2:119240080-119240102 ACTTCTGAGTCTGAGTAGCTGGG - Intronic
937447496 2:121971222-121971244 AGGGCTGAGGGTGAGTAGCCAGG - Intergenic
938192346 2:129295167-129295189 AGTGCCCTGGCTGAGTAGCTAGG - Intergenic
938281332 2:130065615-130065637 AGAGCAGCGTGTCAGTAGCTGGG - Intergenic
938331461 2:130451288-130451310 GGAGCAGTGTGTCAGTAGCTGGG - Intergenic
938331654 2:130452459-130452481 GGAGCAGTGTGTCAGTAGCTGGG - Intergenic
938357809 2:130666117-130666139 GGAGCAGTGTGTCAGTAGCTGGG + Intergenic
938358297 2:130669047-130669069 GGAGCAGTGTGTCAGTAGCTGGG + Intergenic
938434883 2:131276881-131276903 GGAGCAGTGTGTCAGTAGCTGGG + Intronic
938545915 2:132331232-132331254 AGTGCTGTGTGTGGGAGGGTCGG + Intergenic
939593469 2:144095386-144095408 TGTGCTGTGTGTGAGAATATAGG - Intronic
940997925 2:160170519-160170541 GCTGCTGTGTGTGTGTAGCCAGG + Intronic
944631204 2:201626688-201626710 AGTGATGGGAGTGAGTAGCTGGG - Intronic
945980915 2:216309939-216309961 GGTGGTGTGTGTTTGTAGCTAGG - Intronic
946470898 2:219960133-219960155 AGTGCTGTGTGTCTGCAGCATGG + Intergenic
947110642 2:226715642-226715664 GGTGGTGTGTGTGTGTAGGTGGG + Intergenic
948211129 2:236193917-236193939 AGTGTTGTGTGTGGGTGGGTGGG + Intergenic
948256978 2:236575630-236575652 TGTGCTGTGTGTGCGTGTCTGGG + Intronic
948256981 2:236575655-236575677 TGTGCTGTGTGTGCGTTTCTGGG + Intronic
948291233 2:236826395-236826417 AGTGCTGTGTGTGAGTAGAGAGG - Intergenic
1169950416 20:11037387-11037409 AGTTCTGTGTGTGAGTGTCTTGG - Intergenic
1170574989 20:17655620-17655642 AGGTCTGTGGGTGAGTGGCTGGG - Intronic
1170854453 20:20038130-20038152 TATGCTGCATGTGAGTAGCTTGG - Intronic
1170922078 20:20688600-20688622 AGAGCAGTATGTGAGGAGCTGGG - Intronic
1171874777 20:30563965-30563987 AGTGCTGTGTGTGGGAGGGTCGG + Intergenic
1171881703 20:30622123-30622145 AGAGCAGTGTGTCAGTAGGTGGG - Intergenic
1173556382 20:43969162-43969184 TGTGCTGTGTGTGCGTTGGTTGG + Intronic
1173822261 20:46027111-46027133 AGTGCTGTGTGTGTGTAGAGTGG + Intronic
1174724818 20:52850656-52850678 AGTTCTGTGAGGGAGGAGCTTGG - Intergenic
1176031205 20:63013162-63013184 AGTCCACTGTGTGAGAAGCTTGG - Intergenic
1176336148 21:5601812-5601834 AGAGCTGTGCGTGACTCGCTGGG + Intergenic
1176391609 21:6219136-6219158 AGAGCTGTGCGTGACTCGCTGGG - Intergenic
1176469810 21:7097038-7097060 AGAGCTGTGCGTGACTCGCTGGG + Intergenic
1176493371 21:7478816-7478838 AGAGCTGTGCGTGACTCGCTGGG + Intergenic
1176507271 21:7659567-7659589 AGAGCTGTGCGTGACTCGCTGGG - Intergenic
1176625828 21:9091324-9091346 AGAGCAGTGTGTCAGTAGGTGGG + Intergenic
1176820389 21:13650579-13650601 GGAGCAGTGTGTCAGTAGCTGGG + Intergenic
1176820706 21:13652501-13652523 AGAGCAGCGTGTCAGTAGCTGGG + Intergenic
1179080672 21:38167823-38167845 AGTGGTGTGTGTGTGTAGTAGGG + Intronic
1179620964 21:42615809-42615831 TGTGCTGTGTGTGTGTAGTGTGG - Intergenic
1180069621 21:45429877-45429899 AGTGCTGTGTCTGTGAAGCGGGG + Intronic
1180921225 22:19522658-19522680 AGTGCTGGGGGTGAGCAGCCAGG - Intergenic
1182572456 22:31249208-31249230 AGTCCTGGGTGTGGGTAGCCTGG + Intronic
1183467425 22:37986733-37986755 AGTGCTGTGTGTGTGTGGTTGGG + Intronic
1185037591 22:48487988-48488010 AGTGTTGTGTGTGTGTGGATGGG + Intergenic
1185193856 22:49455890-49455912 AGTGCTGTCTGGGAGGGGCTGGG + Intronic
1185299666 22:50072797-50072819 AGTTCTCTGTCTCAGTAGCTGGG + Intronic
955558427 3:60163016-60163038 AGAGCTCTGTGTGAGAAACTAGG - Intronic
956753806 3:72366274-72366296 AGCCCTGGGTTTGAGTAGCTTGG - Intergenic
960713742 3:120556172-120556194 AGTGCTGTGTTCCAGGAGCTGGG + Intergenic
962261964 3:133916168-133916190 CTTGCTGTGTGTGAGTATGTAGG + Intergenic
962416293 3:135185180-135185202 AGGGCTGTGTGAGAATAGTTGGG + Intronic
963166771 3:142212196-142212218 AGTGGTGTGTGTGGGTACGTGGG + Intronic
964220046 3:154332962-154332984 AGTGCTTAGTGTGACTGGCTTGG - Intergenic
966731377 3:183154088-183154110 GGAGCTGTGTGTGAGTTGTTGGG + Exonic
967146576 3:186611754-186611776 GGTGTGGTGTGTGAGCAGCTGGG + Intergenic
967599278 3:191365306-191365328 AGTGCTATGTGTAAGTACCATGG - Intronic
967742598 3:193019781-193019803 AGTACTATGTGTGAGGAGCTGGG + Intergenic
969045597 4:4334332-4334354 AGTGCTGGGTGTCAGAGGCTCGG - Intergenic
969596034 4:8149793-8149815 AGTCCTGAGTGTGAGGTGCTGGG - Intronic
969862708 4:10050415-10050437 AGTGGTGTGTGTGGGAAACTAGG - Intronic
972275921 4:37557810-37557832 ATTGCTGAGTGTCAGGAGCTGGG + Intronic
972333219 4:38082280-38082302 AGGGCTGTGTCTGGGAAGCTGGG - Intronic
979356218 4:119708837-119708859 AGAGCTATGGGTGAGCAGCTTGG - Intergenic
981274260 4:142879622-142879644 AGTTCTGCATGTGAGAAGCTTGG + Intergenic
985235380 4:187867553-187867575 AGTGCTGTTTGTAATTAGCATGG + Intergenic
985523671 5:391139-391161 GGTGGTGTGAGTGAGTACCTGGG + Intronic
986168815 5:5298848-5298870 TCTGCAGTGTGTGAGTATCTGGG + Intronic
986327464 5:6686909-6686931 GGGGCTGTGTGTGAGCAGCAGGG - Intergenic
987688875 5:21242003-21242025 TGTCATGTGTGTGAGTAGGTGGG + Intergenic
989989605 5:50745752-50745774 AGTGCTATGTGACAGAAGCTTGG - Intronic
991950134 5:71939279-71939301 AGGGATGTCTGTGAGTAGCCAGG + Intergenic
998535509 5:142926699-142926721 AGTGCTGTGTATGAGTGTGTTGG + Intronic
1000915250 5:167073708-167073730 TGTGCTGGTTGTGATTAGCTAGG + Intergenic
1001857198 5:175023270-175023292 AGTGCTGAGTTTGAGAAACTTGG - Intergenic
1002319192 5:178364955-178364977 AGGGTTGTGAGTGAGCAGCTCGG - Intronic
1002704183 5:181149094-181149116 AGTGCTATGTGACAGTAGCCTGG + Intergenic
1003328009 6:5107417-5107439 AGTGCCGTGCGTTAGTAGCGTGG + Intronic
1006255786 6:32830866-32830888 AGTGGAGTGTGTGAGGAGTTGGG - Intronic
1008541760 6:52551948-52551970 AGGGCTGTGTGTAATTGGCTTGG - Intronic
1011099932 6:83709206-83709228 GGCGGTGTGTGTGAGTAGCTGGG - Exonic
1011260281 6:85463118-85463140 AGTGGTGGGGGTGAGGAGCTGGG + Intronic
1011942938 6:92865314-92865336 AGTTCTGTGTGTAAGCAGCTTGG - Intergenic
1014361096 6:120475323-120475345 AGTGATGTTTGTCAGTGGCTGGG - Intergenic
1017953926 6:159162460-159162482 GGTGCTGTGAGTGAGTAGAAAGG + Intergenic
1018274098 6:162111571-162111593 AGTGCGGGGTGTGTGTAGCATGG + Intronic
1019196586 6:170286773-170286795 AGGGGTGTGTGTGAGGAGGTGGG - Intronic
1019492992 7:1323757-1323779 AGTGCTGGGGGTGAGTCCCTGGG + Intergenic
1021606821 7:22416403-22416425 AGTGCAGAGTATGGGTAGCTAGG - Intergenic
1022524718 7:31029551-31029573 GCTTCTGTATGTGAGTAGCTGGG + Intergenic
1024273852 7:47661472-47661494 AGGGATGTGTGTGGGTAGATGGG + Exonic
1025741683 7:64202826-64202848 AGTGCTGTAGCTCAGTAGCTGGG - Intronic
1025746144 7:64244754-64244776 AGTGCTGTAGCTCAGTAGCTGGG - Intronic
1026502876 7:70957831-70957853 AGAGCAGTGTGTAAGTAGCAGGG + Intergenic
1026905189 7:74058899-74058921 ATTGCTGTGTGTGAGAATATGGG - Intronic
1027503478 7:78984708-78984730 AGTGCTGAGTGTGTGTGGGTGGG - Intronic
1027630041 7:80593097-80593119 AGTTCTGTGTGTCAGAAGTTGGG - Intronic
1029436906 7:100568678-100568700 AGTGCTGTGTGCATGGAGCTGGG - Intergenic
1030208813 7:106976377-106976399 ACCGCTGTGTGTGAATTGCTAGG - Intergenic
1032401327 7:131626332-131626354 AGTGCTGTGAGTGTGCAGGTGGG + Intergenic
1034696181 7:153056009-153056031 AGATATGTGTGTGACTAGCTAGG + Intergenic
1035140696 7:156757636-156757658 TTTGCTGAGTGTGAGTAGTTTGG - Intronic
1040060673 8:43100505-43100527 AGTGCTGTGTGTGTGTCTGTGGG + Intronic
1040581943 8:48705491-48705513 AGAACTCTGTGTGAGTGGCTGGG + Intergenic
1040862489 8:52014065-52014087 AGTGCTGTGTATTGGTTGCTAGG + Intergenic
1041626008 8:60027919-60027941 AGTGCTGTGTGTGTGTACAAAGG + Intergenic
1041820885 8:62031773-62031795 TGTCCTGGGTGTGACTAGCTGGG + Intergenic
1042077336 8:65010461-65010483 GGTGCTGTGTGTGGGTGGCAGGG - Intergenic
1044390705 8:91647376-91647398 AGTGATCTTTCTGAGTAGCTGGG + Intergenic
1046231078 8:111358889-111358911 AGTGATGTTTGTGAGTGCCTCGG - Intergenic
1046504080 8:115114784-115114806 AGTGCTGTGTGTTATTTGCCTGG - Intergenic
1048415536 8:134224110-134224132 AGTGCTGTGGGAGGCTAGCTGGG - Intergenic
1049181911 8:141227274-141227296 AGTGCCGTGTGTGATAAACTGGG + Intronic
1049545570 8:143229132-143229154 AGGGGTGTGTGTGAGAAGCCGGG - Intergenic
1052273726 9:26655174-26655196 AGTGCTGTGGGTGAGCAGCAGGG + Intergenic
1055496786 9:76862613-76862635 GGTGCTATGTGTGTGTAGCGGGG - Intronic
1056258354 9:84823572-84823594 AGTCCTGGGCGTCAGTAGCTGGG + Intronic
1057297428 9:93857480-93857502 TGTGCTCTGGGTGAGGAGCTTGG - Intergenic
1059237399 9:112772660-112772682 AGTACTGAGTGTGAGTAGAAAGG + Intronic
1059890071 9:118791914-118791936 TGTGCTGTGTGTGTGTGCCTAGG + Intergenic
1060265202 9:122108073-122108095 AGTGCTGTGTGACAATAGCCTGG + Intergenic
1060758783 9:126231690-126231712 CCTGCTGTGTATGAGAAGCTTGG - Intergenic
1203425495 Un_GL000195v1:33090-33112 AGAGCTGTGCGTGACTCGCTGGG - Intergenic
1203526650 Un_GL000213v1:97064-97086 AGAGCAGCGTGTCAGTAGCTGGG - Intergenic
1203526861 Un_GL000213v1:98342-98364 GGAGCAGTGTGTCAGTAGCTGGG - Intergenic
1203749001 Un_GL000218v1:61745-61767 AGAGCAGTGTGTCAGTAGGTGGG + Intergenic
1186314328 X:8352482-8352504 AATCCTGTGTGTGTGTTGCTCGG + Intergenic
1187628225 X:21141188-21141210 AGTGGTGTCTGTGAGTTCCTTGG + Intergenic
1188537590 X:31214819-31214841 TGTGGTGTGTGTGTGTAGCTGGG + Intronic
1189100686 X:38186297-38186319 TGTTATGTGTGTGTGTAGCTGGG - Intronic
1192358751 X:70425557-70425579 AGAGCTGGGTTTGAGCAGCTGGG - Intronic
1192563570 X:72143936-72143958 AGTGCAGTGTGAGAGCAGATTGG + Intergenic
1198673623 X:139108382-139108404 AGTGCTGTGTCTGATTGACTGGG + Intronic