ID: 1165421300

View in Genome Browser
Species Human (GRCh38)
Location 19:35723266-35723288
Sequence GTGCTGTGTGTGAGTAGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 416}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421294_1165421300 8 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421295_1165421300 -5 Left 1165421295 19:35723248-35723270 CCCTAACACCAAGAAGCAGTGCT 0: 1
1: 0
2: 3
3: 11
4: 138
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421296_1165421300 -6 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421290_1165421300 19 Left 1165421290 19:35723224-35723246 CCTAGACAAGCCCAAGTTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416
1165421293_1165421300 9 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421300 Original CRISPR GTGCTGTGTGTGAGTAGCTG GGG Exonic
900274491 1:1815262-1815284 GTGCTGTGTGTGCTTTGCTGCGG - Intronic
900363753 1:2302148-2302170 GTGTTGTGTGTCAGGTGCTGAGG - Intronic
900988471 1:6086772-6086794 GTTCTGGGTTTGAGTAGCTGAGG - Intronic
902148510 1:14423525-14423547 GTACTGTGTGTGGGGAGCTGAGG - Intergenic
902858235 1:19224921-19224943 GTGAGTTGTGTGGGTAGCTGCGG - Intronic
903016166 1:20363553-20363575 GAGCAGTGTGTGATGAGCTGGGG - Intergenic
903647073 1:24902169-24902191 GGGCCGTGGGTGAGTTGCTGTGG + Exonic
904785977 1:32983336-32983358 GTGCTGTGTGTTGGCAACTGGGG + Intergenic
905416325 1:37807190-37807212 CTGCCGTGTGAGAGTACCTGAGG - Exonic
907307911 1:53523733-53523755 GAGCCGTGTGTGAGTTCCTGAGG - Intronic
908461174 1:64349625-64349647 GTGGTGTGTGTGTGTACGTGTGG + Intergenic
910416140 1:87001189-87001211 GTGCTGTATGTGAATACCTTTGG + Intronic
910868046 1:91805697-91805719 CTGCCTTGTGTGAGAAGCTGGGG + Intronic
910981818 1:92965669-92965691 GATCTGTGAGTGAGTAGGTGAGG + Intergenic
911518783 1:98903392-98903414 ATGCTGTGCGTGAGTAACTCTGG - Intronic
912470128 1:109901124-109901146 GTGGTGAGTGTGAGTGGCAGAGG - Intergenic
912746691 1:112251223-112251245 CTGCTGTGAGTAAGTACCTGAGG - Intergenic
913657242 1:120972950-120972972 GTTCTGTGTGTGAGTAGCAATGG + Intergenic
914008584 1:143756035-143756057 GTTCTGTGTGTGAGTAGCAATGG + Intergenic
914521797 1:148424229-148424251 GTTCTGTGTGTGAGTAGCTATGG + Intergenic
914647215 1:149664686-149664708 GTTCTGTGTGTGAGTAGCAATGG + Intergenic
915613317 1:157013670-157013692 GTTCTGGGTGTGAGTAGTGGAGG - Intronic
917451587 1:175151798-175151820 GTGTGGTGTGTGAGGAGATGTGG + Intergenic
917561455 1:176161480-176161502 GTGGTGTGAGTGAGAGGCTGAGG + Intronic
917579997 1:176366805-176366827 GTGCTGTGTGTGGTTAGGTGTGG - Intergenic
918315101 1:183316685-183316707 GGGCTGTGGGGGAGGAGCTGAGG - Intronic
919732270 1:200920883-200920905 GGGCTGGGTGTGAGGAGCAGGGG + Intergenic
920701322 1:208219831-208219853 GGGCTGTGTCGGAGTAGCTGAGG - Intronic
922547789 1:226471532-226471554 GTGCTGTGAATGGGGAGCTGTGG + Intergenic
923410594 1:233705013-233705035 GTTCTGGGTCTGAGTACCTGGGG + Intergenic
1062831387 10:608253-608275 GGGCTGTGTGTGGGGGGCTGTGG - Intronic
1063057130 10:2518218-2518240 CTGCTGTGTTTGAGAAGCTGTGG - Intergenic
1063274839 10:4554301-4554323 GTGGTGTGTGTGTGTGGCTGAGG - Intergenic
1063866410 10:10369582-10369604 GTCCTATGTGTGAGTTTCTGTGG + Intergenic
1064535924 10:16357958-16357980 TTGCTGAGTGTGAGTGGCTGTGG - Intergenic
1065004756 10:21369235-21369257 GCGCTGTGGGGGAGTTGCTGGGG - Intergenic
1065231802 10:23606092-23606114 GTGCTGTGTGACAGAAGCTCAGG - Intergenic
1065722184 10:28637468-28637490 GTACTGTGTGTTACTGGCTGGGG + Intergenic
1066134004 10:32425040-32425062 TTGTTGTGTGTGTGTAGTTGGGG + Intergenic
1068984320 10:63093078-63093100 GGGGTGTGTGGGAGTGGCTGGGG - Intergenic
1069455843 10:68553226-68553248 GAGCTGTGTGACAGGAGCTGGGG - Intergenic
1070352876 10:75610480-75610502 GTGGTGTGTGTGTGTATGTGGGG - Intronic
1072414771 10:95238090-95238112 GTGGTGTGTTTGTGAAGCTGCGG - Exonic
1072661059 10:97363779-97363801 GTGGTGGGGGTGAGAAGCTGTGG + Intronic
1073182847 10:101595961-101595983 GGGCTGGGAGTGAGGAGCTGCGG - Intronic
1073566193 10:104537646-104537668 GTGTTGTGGGTGGGTAGCAGAGG + Intergenic
1074946179 10:118282995-118283017 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1076134231 10:128034330-128034352 GTTCTGTGTGTGTGTCGGTGGGG - Intronic
1076165349 10:128277938-128277960 GTGATCTGTGTGAGAAACTGTGG + Intergenic
1076701433 10:132275244-132275266 GGGCTGTCTGTGAGTAGCCATGG - Intronic
1076745979 10:132514776-132514798 GTGCTGTGTGTGTGTGTATGTGG + Intergenic
1076763332 10:132616498-132616520 GTGGTGTGTGTGGGATGCTGTGG + Intronic
1076833983 10:133010727-133010749 GTGATGTGTGTTAGTGGGTGTGG + Intergenic
1077358978 11:2132091-2132113 GTGTTGTGTGTGTGTAGCTGCGG + Intronic
1078901770 11:15649300-15649322 CTTCTGTGTGCAAGTAGCTGAGG + Intergenic
1080372644 11:31669642-31669664 GTGCTGTGGGTGAATGACTGAGG - Intronic
1081979619 11:47258157-47258179 GGGCTCTGTGTGTGTATCTGGGG + Exonic
1084085631 11:66853863-66853885 ATGTGGTGTGTGAGGAGCTGGGG - Intronic
1085184515 11:74564124-74564146 GTGGTATGTGTGAGTGGATGTGG - Intronic
1085257611 11:75184850-75184872 GTGGTGGGTGTGAGTAGAGGGGG - Intronic
1087688013 11:101287063-101287085 CTGCTGTGTGTGAGGGGGTGGGG - Intergenic
1088678841 11:112222052-112222074 GGGCTGTGTGTGGGAGGCTGCGG - Intronic
1089013459 11:115148299-115148321 GTGGTGTGTGTGTGTGGGTGTGG + Intergenic
1089260636 11:117221664-117221686 GTGGTGAGGGTGAGAAGCTGAGG + Intronic
1089452808 11:118609201-118609223 GGGCTGTGTGTGTATAACTGGGG - Intronic
1091358175 11:134954292-134954314 GTGCTGTGTGTGTGTGTGTGTGG - Intergenic
1091698333 12:2643019-2643041 CTGCTTTGTGTGTGAAGCTGTGG - Intronic
1092186016 12:6478815-6478837 GTGCTGTATGAAAGTGGCTGCGG - Intergenic
1092744636 12:11661834-11661856 GGGCTGTGAGTGAGGAGATGAGG + Intronic
1095683502 12:45005571-45005593 ATGCTGTGTCTGAGGAACTGAGG - Intergenic
1096793334 12:54058724-54058746 GTGCTGAGTCTGTGTACCTGGGG + Intergenic
1096815797 12:54201016-54201038 CTGCTGGGTTTGAGTATCTGAGG - Intergenic
1096867627 12:54574645-54574667 GTGGGGTGTGTGTGTAGCTTTGG + Intronic
1098625228 12:72657947-72657969 GTGCTCAGTGTGGTTAGCTGTGG - Intronic
1100000909 12:89833962-89833984 GTACTGAGTGTGAGGAGTTGAGG + Intergenic
1101196073 12:102384145-102384167 GTGCTTTTCGTGAGTAGCTTTGG - Intergenic
1101876080 12:108597751-108597773 GTGTTGTGTGTGTGCGGCTGGGG - Intronic
1102444294 12:112989877-112989899 GGGCTGTGAGTGAGGAGGTGGGG - Intronic
1103797213 12:123512239-123512261 GTGCAGTGTGTGTGTATCTGCGG + Intronic
1103908131 12:124337757-124337779 GCTCTGTGAGTGAGAAGCTGGGG + Intronic
1103916663 12:124379274-124379296 GCTCTGTGTGTGAGGAGCTGGGG - Intronic
1104518411 12:129449775-129449797 GTGTTTTGTGTGTGTACCTGAGG - Intronic
1104586930 12:130055130-130055152 GTGGTGTGTGTGTGTGGTTGTGG - Intergenic
1104617210 12:130280897-130280919 TTGCTGTGTGTGGATATCTGTGG - Intergenic
1104716133 12:131017502-131017524 GTGCTGGGTGGGTGTAGATGGGG - Intronic
1105013997 12:132774839-132774861 CTGCTGTGTGTGAAGGGCTGGGG - Intronic
1105525059 13:21169704-21169726 GTTGTGGGTGTGACTAGCTGGGG - Intronic
1105724891 13:23153736-23153758 GTGCTGTGTGTGTGTGTGTGTGG + Intergenic
1105820044 13:24072562-24072584 GAGCTGTGTGTGAGCAGGAGGGG - Intronic
1105891000 13:24681938-24681960 GTGGTGTGTGTGTGTATGTGTGG + Intronic
1106178738 13:27352961-27352983 GTGCTGTGTGTGTGTGTCTGGGG + Intergenic
1106560723 13:30843974-30843996 GTGGTGTGTGTGTGTGTCTGTGG + Intergenic
1106560817 13:30844614-30844636 GTGGTGTGTGTGTGTATGTGGGG + Intergenic
1106560834 13:30844902-30844924 GTGGTGTGTGTGTGTGTCTGTGG + Intergenic
1106830293 13:33574123-33574145 GCGCTGAGTGTGAGGAGCTGCGG + Intergenic
1107427076 13:40304860-40304882 GTGCTGTCTCTCAGTAGCTAAGG - Intergenic
1108340160 13:49491440-49491462 CTGCAGTGTGGAAGTAGCTGGGG - Intronic
1108911014 13:55551280-55551302 GTGCTGGCTTTGAGTACCTGTGG - Intergenic
1109818457 13:67619321-67619343 TTGCTGTGTGTACGTGGCTGGGG - Intergenic
1110550537 13:76806798-76806820 CTGTTGTGTGGGAGTAGCAGTGG - Intergenic
1110766113 13:79281076-79281098 GTACAGTGTGTCTGTAGCTGGGG - Intergenic
1111603376 13:90503098-90503120 GTTCTGGGTCTGAGTAGCTCAGG + Intergenic
1112639080 13:101252503-101252525 TTGCTGTGCATGAGTAGCAGGGG + Intronic
1113574794 13:111387611-111387633 GTGCTGTTTGGAAGTTGCTGGGG + Intergenic
1113750591 13:112773994-112774016 GCACTGTGTTTGAGGAGCTGAGG - Intronic
1113777604 13:112957183-112957205 GTACTGTCTGTGAGCAGCAGGGG - Intronic
1113916345 13:113876232-113876254 CTGCTGTGTGGGTGTCGCTGAGG + Intergenic
1114059929 14:19009274-19009296 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1114060040 14:19009925-19009947 GAGCAGTGTGTTAGTACCTGGGG - Intergenic
1114060222 14:19011066-19011088 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1114060738 14:19014186-19014208 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1114060852 14:19014837-19014859 GAGCAGTGTGTTAGTACCTGGGG - Intergenic
1114101403 14:19385142-19385164 GAGCAGTGTGTTAGTACCTGGGG + Intergenic
1114101516 14:19385794-19385816 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1114102128 14:19389540-19389562 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1114102322 14:19390705-19390727 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1114102618 14:19392477-19392499 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1114449021 14:22812685-22812707 GTGCTTACTGTGAGAAGCTGGGG + Intronic
1116814451 14:49570488-49570510 GAGCAGTGTCTGAGGAGCTGAGG + Intergenic
1116876160 14:50114163-50114185 ATGCTGTTTGTGTGAAGCTGAGG - Intronic
1117366929 14:55038362-55038384 AAGCTGTGTGTGAGTAGCCAGGG + Intronic
1117767813 14:59101021-59101043 AGGCTGTGTGTGAGTACCTGGGG - Intergenic
1120075877 14:80157783-80157805 GTGCTGTGTGTCAGATGCTATGG - Intergenic
1120302063 14:82720693-82720715 GTGGTGTGTGTGAGTATGAGCGG + Intergenic
1120302423 14:82725054-82725076 GTGATGTGTGTGTGTATGTGTGG + Intergenic
1121337052 14:93083859-93083881 GTGCTGGGTGTGGGCAGCTTGGG - Intronic
1121525831 14:94618704-94618726 GTTCTGTATGTGAGTTGGTGAGG - Intronic
1121703244 14:95972407-95972429 GTGCTGTTTGTGTGTATGTGTGG - Intergenic
1122869728 14:104632764-104632786 GTGCCTTGTGTGAAGAGCTGGGG - Intergenic
1123069631 14:105636156-105636178 TTGCTGAGTGTGGGTAGCAGAGG + Intergenic
1123088724 14:105731939-105731961 TTGCTGAGTGTGGGTAGCAGAGG + Intergenic
1202836982 14_GL000009v2_random:85670-85692 GAGTAGTGTGTCAGTAGCTGGGG + Intergenic
1202906484 14_GL000194v1_random:76526-76548 GAGCAGTGTGTCAGTAGGTGGGG + Intergenic
1123552560 15:21397403-21397425 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1123552882 15:21399328-21399350 GAGCAGTGTATCAGTAGCTGGGG - Intergenic
1123842742 15:24265561-24265583 GTTCTGTATGTGAGAAGGTGGGG + Intergenic
1123997588 15:25729661-25729683 ATGCTGTGTGGGGGTGGCTGGGG - Intronic
1124834276 15:33180695-33180717 TGGCTGTGTGTGACTAGCTGAGG - Intronic
1125899040 15:43328716-43328738 GAGCTGTGTGGGAGTACCTTGGG + Exonic
1126844875 15:52749552-52749574 GTTGTGTGTGTCAGAAGCTGGGG - Intergenic
1128520640 15:68372485-68372507 GTGCTGTGAGTCACTGGCTGCGG + Intronic
1132476834 16:143564-143586 GTTCTGTGCCTGAGCAGCTGAGG - Intergenic
1132565118 16:618645-618667 GTGCAGTGTGTGCGCAGGTGTGG + Intronic
1132565209 16:619255-619277 GTGCAGTGTGTGTGCAGGTGTGG + Intronic
1132670409 16:1100167-1100189 AGGCTGTGTGTGAGCAGGTGGGG - Intergenic
1133290254 16:4716006-4716028 GTGGTGGGTGGGAGTACCTGCGG + Intronic
1134248608 16:12558598-12558620 CTGCACTGTGTGAGCAGCTGTGG - Intronic
1135011622 16:18885473-18885495 GTTGTGTGTGTGAGGATCTGAGG - Intronic
1135318524 16:21473056-21473078 GTTGTGTGTGTGAGGAACTGAGG - Intergenic
1135371417 16:21904851-21904873 GTTGTGTGTGTGAGGAACTGAGG - Intergenic
1135440370 16:22465864-22465886 GTTGTGTGTGTGAGGAACTGAGG + Intergenic
1136010358 16:27359480-27359502 GTCCTGTGGGTGAGTGGGTGGGG + Intronic
1136328780 16:29554799-29554821 GTTGTGTGTGTGAGGAACTGAGG - Intergenic
1136443411 16:30294498-30294520 GTTGTGTGTGTGAGGAACTGAGG - Intergenic
1137490806 16:48931066-48931088 GTGGTGTGTGTGAGCAAGTGTGG - Intergenic
1138097372 16:54222623-54222645 GTGGTGGGTGTGAGGGGCTGGGG + Intergenic
1139665649 16:68453700-68453722 GTGCTCAGTGTGAGGAGGTGTGG + Intergenic
1139890134 16:70246921-70246943 GTTGTGTGTGTGAGGAACTGAGG - Exonic
1139891315 16:70254788-70254810 ATCCTGTGTCTGAGCAGCTGCGG + Intronic
1141624557 16:85254410-85254432 CTGCTGTGTGCGAGGCGCTGTGG - Intergenic
1141676979 16:85523156-85523178 GTGTTGTGTGTATGTGGCTGTGG + Intergenic
1141793450 16:86252346-86252368 GTGCCTTGTGTAAGTAGATGTGG + Intergenic
1141853249 16:86662605-86662627 GTGGTGTGTGTGTGTATATGTGG + Intergenic
1141856483 16:86684745-86684767 GTGGGGGGTGTGAGAAGCTGTGG - Intergenic
1142055036 16:87988671-87988693 TTGCTGTGAGGGATTAGCTGGGG + Intronic
1142247263 16:88975838-88975860 GTTCTGTGTGTGAGTGTCAGGGG + Intronic
1143532505 17:7513457-7513479 GGGAAGTGGGTGAGTAGCTGGGG - Exonic
1143564990 17:7715853-7715875 GGGATGTGTGTGGGGAGCTGTGG + Intergenic
1144335494 17:14265589-14265611 GTTCTGTGTGTGGGTAGCAGAGG - Intergenic
1145117061 17:20220707-20220729 GTACTGTGTGTGAATAACAGTGG + Intronic
1148199450 17:45740235-45740257 GAGGTGTGTGTGTGTATCTGCGG + Intergenic
1150650668 17:67008102-67008124 CTGCTGTGTGTGAGGTGCTGGGG - Intronic
1150653761 17:67026304-67026326 GTGGTGTGTGTGTGTATTTGAGG + Intronic
1150653768 17:67026375-67026397 GTGGTGTGTGTGTGTATTTGAGG + Intronic
1151024791 17:70665644-70665666 GTTTTGTTTGTGAGTAGCAGAGG + Intergenic
1151145272 17:72034679-72034701 GTGAGGTGTGTGAGGAGGTGGGG - Intergenic
1151528688 17:74689862-74689884 GTACTGTTTGAGAGTAGTTGAGG - Intronic
1152235910 17:79138598-79138620 GTGCTATGTGTGTGTGGGTGAGG - Intronic
1152394820 17:80025906-80025928 GTGCTGTATGTGAGGAGATAGGG - Intronic
1153242889 18:3046562-3046584 GTGATCTGTGTGAGTGGCAGGGG + Intergenic
1153897587 18:9580788-9580810 GTCCTGAGTGAGAGCAGCTGAGG + Intronic
1154297048 18:13160604-13160626 GTGATGTGTGTGTGTGGCAGGGG + Intergenic
1154453475 18:14500803-14500825 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1154453995 18:14503994-14504016 GAGCAGTGTGTCAGTACCTGGGG - Intergenic
1155157489 18:23169831-23169853 GTGGTGTGTGTGAGCTGCTGAGG + Intronic
1155779406 18:29811887-29811909 GTGCTGTGCTTGAGGGGCTGAGG - Intergenic
1156527558 18:37780883-37780905 GTGTTGTGTGTGTGTGTCTGTGG - Intergenic
1156575085 18:38305495-38305517 CTGCTGTGTGTGAGCAGCTCTGG + Intergenic
1157578455 18:48759255-48759277 CTGCTGTGTGGGAATGGCTGTGG - Intronic
1159559602 18:69979374-69979396 GTGCTGTGTGAGAGGAGGTAGGG - Intergenic
1160622761 18:80182104-80182126 GCACTGTGGGTGAGCAGCTGGGG - Intronic
1160962411 19:1729161-1729183 GTGCTTTGTGTGAGCATGTGGGG + Intergenic
1162396821 19:10421899-10421921 GTGCTCTGTGTGAGCTTCTGGGG + Intronic
1162539131 19:11283240-11283262 GCTCTGTGTCTCAGTAGCTGTGG - Intergenic
1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG + Exonic
1166741233 19:45116104-45116126 CTGCTGTGTGTGAGGCGCTGTGG + Intronic
1167169986 19:47824549-47824571 ATGCAGTGTGTGAGAAGCTGGGG + Intronic
1168062345 19:53899920-53899942 CATCTGTGTGTGAGTGGCTGTGG + Intronic
1168308291 19:55448124-55448146 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1168308294 19:55448163-55448185 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1168308313 19:55448296-55448318 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1168308328 19:55448437-55448459 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1168308346 19:55448582-55448604 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1168308365 19:55448776-55448798 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1168308367 19:55448806-55448828 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
926081966 2:9994643-9994665 CTGCTGTGTGTTAGGAACTGAGG + Intronic
927145768 2:20164653-20164675 GTGGTGTGTGTGAGTATGTAGGG - Intergenic
928062593 2:28130199-28130221 TTTCTGTCTGTGAGTAGATGTGG + Intronic
928110966 2:28508505-28508527 GTGCTGCATGTGACTAGCTGTGG - Intronic
928422604 2:31150602-31150624 GTTCTCTGTGAGAGTAGCTGTGG + Intronic
929166974 2:38892364-38892386 ATGGAGTGTGTGAGTAGGTGGGG + Intronic
930532708 2:52610391-52610413 GTGCTGGGGATGATTAGCTGTGG + Intergenic
930648953 2:53944758-53944780 GTGGTGAGTGTGGGGAGCTGAGG + Intronic
931856116 2:66303267-66303289 GTGCTGTGTGTATGTATGTGTGG - Intergenic
931978853 2:67672738-67672760 GTGGTGTGTGTGTGTATGTGAGG - Intergenic
932501520 2:72187013-72187035 GGGGTGTGTGTGAGTAAGTGTGG + Intronic
932557023 2:72833474-72833496 GTCCTGTGTGTGACTGGCTGGGG - Intergenic
932595699 2:73092317-73092339 GTGTGCAGTGTGAGTAGCTGGGG - Intronic
932620918 2:73264572-73264594 GGGATGTGTGTGGGGAGCTGGGG + Intronic
933533060 2:83535152-83535174 GTGCAGTGTTTGAGCAACTGAGG - Intergenic
933758977 2:85661574-85661596 GAGCTGGGTGTGGGGAGCTGAGG - Intronic
935562920 2:104577121-104577143 ATGCTGTGGGTCAGAAGCTGGGG - Intergenic
935639390 2:105276387-105276409 GTGCTGTGTATGGGTGGGTGAGG - Intronic
935742753 2:106165208-106165230 CTGCTGTGTATGACTAGGTGGGG - Intronic
935945406 2:108281646-108281668 CTGCTGTGAGAAAGTAGCTGAGG + Intergenic
936620386 2:114090323-114090345 GTGCTGCGTGTCAGAAGATGCGG + Intergenic
937146296 2:119647970-119647992 GTACTGTGAGTGAGTGGCGGTGG - Intronic
937311676 2:120906687-120906709 GTGCTGAGTTTGAGATGCTGTGG - Intronic
937347338 2:121134390-121134412 GTGGTGTCTGTGAGTATGTGTGG + Intergenic
937518401 2:122681906-122681928 GTGGTGAGTGTGGGGAGCTGGGG + Intergenic
938140740 2:128792775-128792797 GTGTTGTGTGTGAGACACTGTGG - Intergenic
938280293 2:130059295-130059317 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
938280709 2:130061819-130061841 GAGCAGTGTGTCAGTAGCTGAGG - Intergenic
938280816 2:130062450-130062472 GAGCAGTGTGTCAGTAGCTGAGG - Intergenic
938281009 2:130063623-130063645 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
938323424 2:130380940-130380962 TTGCTGTGTGTGCTTAGATGTGG + Intergenic
938331460 2:130451287-130451309 GAGCAGTGTGTCAGTAGCTGGGG - Intergenic
938331759 2:130453098-130453120 GAGCAGTGTGTTAGTACCTGGGG - Intergenic
938357612 2:130664942-130664964 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
938434365 2:131273716-131273738 GAGCAGCGTGTCAGTAGCTGGGG + Intronic
938434687 2:131275706-131275728 GAGCAGCGTGTCAGTAGCTGGGG + Intronic
938434884 2:131276882-131276904 GAGCAGTGTGTCAGTAGCTGGGG + Intronic
938477956 2:131633559-131633581 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
938478306 2:131635710-131635732 GGGCAGCGTGTCAGTAGCTGGGG + Intergenic
939089125 2:137758018-137758040 GTGCTGTGTTGGAGGGGCTGAGG - Intergenic
940039428 2:149344730-149344752 GTGCTTTGTGGGAGTGGGTGCGG + Intronic
943098563 2:183458612-183458634 GAGATGTGTGTGGGTAGATGCGG + Intergenic
946954910 2:224918951-224918973 GTGGTGTGTGTGTGTATGTGTGG + Intronic
947110643 2:226715643-226715665 GTGGTGTGTGTGTGTAGGTGGGG + Intergenic
948256979 2:236575631-236575653 GTGCTGTGTGTGCGTGTCTGGGG + Intronic
948256982 2:236575656-236575678 GTGCTGTGTGTGCGTTTCTGGGG + Intronic
948989515 2:241545873-241545895 GTGGTGTGTGTGTGCATCTGTGG - Intergenic
1169950415 20:11037386-11037408 GTTCTGTGTGTGAGTGTCTTGGG - Intergenic
1169999197 20:11596262-11596284 GTGCTGGTTTTGAGTGGCTGCGG + Intergenic
1170574988 20:17655619-17655641 GGTCTGTGGGTGAGTGGCTGGGG - Intronic
1170816681 20:19720244-19720266 CTGGTGGGTGTGAGTGGCTGAGG + Intronic
1170854452 20:20038129-20038151 ATGCTGCATGTGAGTAGCTTGGG - Intronic
1170886527 20:20344231-20344253 GAGCTGTGGGGGAGTAGCAGAGG + Intronic
1171378029 20:24708557-24708579 GTTCTGAGTGTGAGTAACTGTGG + Intergenic
1171429031 20:25068023-25068045 GTGGTGTGTGTGTGCACCTGTGG - Intergenic
1171881702 20:30622122-30622144 GAGCAGTGTGTCAGTAGGTGGGG - Intergenic
1172100441 20:32481936-32481958 TTGGTGTGTGTGAGTTGGTGGGG + Intronic
1174390139 20:50213926-50213948 GTGGTGTGTGTGTGTGGCAGGGG + Intergenic
1176256027 20:64153586-64153608 GTGGTGTGTGTGTGTGTCTGTGG + Intronic
1176366889 21:6038829-6038851 GTGTGGTGTGTGAGCAGGTGGGG + Intergenic
1176625829 21:9091325-9091347 GAGCAGTGTGTCAGTAGGTGGGG + Intergenic
1176820390 21:13650580-13650602 GAGCAGTGTGTCAGTAGCTGGGG + Intergenic
1176820707 21:13652502-13652524 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1178324771 21:31635482-31635504 CTGCTGTATGAGAATAGCTGAGG - Intergenic
1179085035 21:38208285-38208307 GTGCTGACTGTGAAGAGCTGAGG - Intronic
1179467244 21:41584251-41584273 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1179467247 21:41584396-41584418 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1179756629 21:43499717-43499739 GTGTGGTGTGTGAGCAGGTGGGG - Intergenic
1179828608 21:43982155-43982177 CTGCTGTCAGTGAGTAGGTGTGG - Intronic
1179886214 21:44315281-44315303 CTGCTCTGTGTGAGCAGCTCAGG + Intronic
1180365057 22:11931546-11931568 GAGTAGTGTGTCAGTAGCTGGGG + Intergenic
1180478407 22:15731886-15731908 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1180478521 22:15732537-15732559 GAGCAGTGTGTTAGTACCTGGGG - Intergenic
1180478701 22:15733678-15733700 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1180479221 22:15736798-15736820 GAGCAGCGTGTCAGTAGCTGGGG + Intergenic
1180479335 22:15737449-15737471 GAGCAGTGTGTTAGTACCTGGGG - Intergenic
1180949934 22:19716394-19716416 GTGCTGCCTGTGAGGAGGTGGGG - Intronic
1181743444 22:24939508-24939530 GAGCAGTGTGTGGGTAGCTCTGG - Intronic
1182089850 22:27586723-27586745 GTGCTGTGTGTTTGTTTCTGTGG - Intergenic
1182175407 22:28281086-28281108 ATGCTGTTTGAGAGTAGCTGAGG + Intronic
1183238566 22:36638779-36638801 GTACTGTGTGTGAAACGCTGGGG - Intronic
1183467426 22:37986734-37986756 GTGCTGTGTGTGTGTGGTTGGGG + Intronic
1184055298 22:42043524-42043546 GTTATGTGTGTGTGTAGCTGTGG + Intronic
1184382532 22:44154629-44154651 GTGGTGTGTGTGTGTATTTGTGG + Intronic
1184827391 22:46962092-46962114 GTGCTGTCTGGGAGGAGATGCGG + Intronic
951516996 3:23571206-23571228 ATGCTGTGTGTGAGGGGCAGTGG - Intronic
955494859 3:59520635-59520657 ATGATGTGTGTGAGTGGCAGAGG + Intergenic
955950182 3:64235922-64235944 GCGTTGTGTGTGTGTAGTTGGGG + Intronic
959247215 3:103887526-103887548 GTTCTGTGTCTGAGTAACTCAGG + Intergenic
959590353 3:108073441-108073463 GTGCAGAGTGGGAGAAGCTGAGG + Intronic
960713743 3:120556173-120556195 GTGCTGTGTTCCAGGAGCTGGGG + Intergenic
960717922 3:120596030-120596052 GAGCTGTGTGGGACTGGCTGTGG - Intergenic
961101037 3:124199279-124199301 GTGGAGTGTGTGAGAAGTTGAGG - Intronic
962274115 3:133999349-133999371 GGGCTGTGTGTGAGTATGGGTGG + Intronic
963221156 3:142813703-142813725 GTGTTCTGGGTGAGTAGCTCTGG - Intergenic
965694653 3:171394902-171394924 GAGCTGTGTGTGTGTTGCAGGGG + Intronic
965785882 3:172334163-172334185 GTGCAGTGTGTGACTATTTGAGG + Intronic
967926296 3:194651121-194651143 GTGCTTTGTGTGACCAGGTGTGG + Exonic
968126665 3:196165193-196165215 GTGTTGTGTGTGTGTGTCTGGGG + Intergenic
968126676 3:196165308-196165330 GTGGTGTGTGTGTGTGTCTGGGG + Intergenic
968126689 3:196165409-196165431 GTGGTGTGTGTGTGTGTCTGGGG + Intergenic
968495118 4:911017-911039 GTGGTCTGTGTGAGTGACTGCGG - Intronic
968672359 4:1858349-1858371 GTGCTGGGTGTGAGGAAATGTGG + Intergenic
968856872 4:3131687-3131709 CAGCTGTGTGGGAGCAGCTGTGG + Exonic
968950376 4:3688443-3688465 GTCTTGGGTGTGAGTGGCTGTGG + Intergenic
969596033 4:8149792-8149814 GTCCTGAGTGTGAGGTGCTGGGG - Intronic
972540064 4:40031396-40031418 GTGCTGTGTGCAAGGACCTGAGG - Intergenic
972663674 4:41143113-41143135 TTGCTGTGGGTGAGCTGCTGTGG - Exonic
972818958 4:42676903-42676925 GTGCTGTAGCTCAGTAGCTGAGG + Intergenic
973207040 4:47572321-47572343 AGGCTGTGTGTGGCTAGCTGAGG + Intronic
974776477 4:66489761-66489783 CTTTTGTGTGTGAGAAGCTGAGG + Intergenic
976392411 4:84518770-84518792 GAGCTGTGTGTGTGAAACTGAGG - Intergenic
979646575 4:123076955-123076977 GTGCTGTGTGTGTGTGTGTGTGG + Intronic
982864210 4:160489692-160489714 GTGCTGTAGGTTAGTAGCTAAGG + Intergenic
984013801 4:174402679-174402701 GTGGTGAGACTGAGTAGCTGAGG + Intergenic
985123206 4:186664392-186664414 GTGCTTTGTGTAAGGTGCTGCGG - Intronic
985344837 4:188993166-188993188 GTGCAGTGTGGGAGTGGGTGAGG - Intergenic
985416331 4:189739235-189739257 GTGCTGTGTGTGTCTGGGTGAGG - Intergenic
1202762978 4_GL000008v2_random:127560-127582 GAGTAGTGTGTCAGTAGCTGGGG - Intergenic
985508549 5:298929-298951 CAGCTGGGTGGGAGTAGCTGAGG - Intronic
985508559 5:298970-298992 CAGCTGGGTGGGAGTAGCTGGGG - Intronic
985692608 5:1321866-1321888 GTGCCGTCTGTGCGTAGATGTGG - Intronic
986396359 5:7334621-7334643 CTCCTGTGTGTGAGAAGCTAAGG - Intergenic
986793029 5:11181816-11181838 GTGGTGTGTGTGTGTATGTGTGG + Intronic
988006673 5:25421317-25421339 GTGCTCTGTGTGAGTGAGTGAGG - Intergenic
992386273 5:76287587-76287609 ATGTTGAGTGTGAGGAGCTGAGG - Intronic
992443457 5:76814448-76814470 GTGGTGTGTGTGTGTGGATGGGG + Intergenic
992496211 5:77296768-77296790 GTGCTCTGTGGGAGTAACTGAGG + Intronic
992638731 5:78750269-78750291 GTGCTGTGTGTGTGTGTGTGTGG + Intronic
992894765 5:81236320-81236342 GGGCTGTATGTGAGGTGCTGCGG + Intronic
992913142 5:81418329-81418351 ATACTGTGTGTGATTAACTGAGG + Exonic
993953605 5:94205177-94205199 TTGGTGTGTGTGTGTATCTGTGG + Intronic
994003688 5:94812427-94812449 GTGCTGTTTGTGATTAGGTCAGG + Intronic
995517682 5:112970129-112970151 GTGCTGTGTGAGGGAAGCTAAGG + Intergenic
996192290 5:120560248-120560270 GTTCTGTGTGATACTAGCTGTGG + Intronic
996919659 5:128752957-128752979 GTGCTGTGTGTCAAGAGTTGAGG - Intronic
997062802 5:130527306-130527328 GTGCTGTGTGTGAATGTGTGTGG + Intergenic
998983213 5:147726969-147726991 GTGCTGTGGCTTAGTAGCTAAGG + Intronic
999651294 5:153770178-153770200 TTGCTGTGTTTGAGAAGATGTGG + Exonic
1002446462 5:179293078-179293100 GTGCTGTGAGTGAGAAGCTGTGG - Intronic
1003157947 6:3612090-3612112 GTGCTGTGGGAGAACAGCTGAGG - Intergenic
1005317171 6:24614372-24614394 AGGCTGTGTTTGAGAAGCTGAGG - Intronic
1007336596 6:41159161-41159183 GTGCTGGGTGGGATTTGCTGAGG - Intronic
1007884407 6:45209873-45209895 CTGCTGAGTTTGAGTGGCTGAGG - Intronic
1008621864 6:53278773-53278795 GTGGTAGGTGTGAGTAGCAGTGG - Intronic
1008646389 6:53519068-53519090 CTGTAGTGTGAGAGTAGCTGTGG - Intronic
1008675180 6:53811528-53811550 ATCCTGTGTGTGAGCAGCTCAGG - Intronic
1010040615 6:71378631-71378653 ATTCAGTGAGTGAGTAGCTGAGG + Intergenic
1010082562 6:71881291-71881313 CTGCTTTGTGTGAGGTGCTGAGG - Intergenic
1011211692 6:84962548-84962570 GTGATTTGTGGGAATAGCTGAGG - Intergenic
1011260282 6:85463119-85463141 GTGGTGGGGGTGAGGAGCTGGGG + Intronic
1011664034 6:89617837-89617859 GTGCTGGGTGTGACTGGGTGTGG + Intronic
1013084741 6:106846780-106846802 GTGCTGTGTGTGCCCAGATGAGG - Intergenic
1013582456 6:111549891-111549913 TTGCTATGTGTTAGTTGCTGTGG + Intergenic
1014539755 6:122661144-122661166 GTGCTGGGTGTGAATCTCTGAGG - Intronic
1016679084 6:146807541-146807563 TTTCTGTGTGTCAGGAGCTGGGG - Intronic
1016679727 6:146815171-146815193 TTTCTGTGTGTCAGGAGCTGGGG - Exonic
1017953927 6:159162461-159162483 GTGCTGTGAGTGAGTAGAAAGGG + Intergenic
1019196585 6:170286772-170286794 GGGGTGTGTGTGAGGAGGTGGGG - Intronic
1019505431 7:1388192-1388214 CTGCTCTGTGTGCGTGGCTGAGG + Intergenic
1020432662 7:8129636-8129658 GTGTTGTGGGTGAGAAGATGGGG + Intronic
1020800421 7:12725984-12726006 CAGCTGTGTGGGAGTAGCTATGG - Intergenic
1022173210 7:27849240-27849262 GTTCAGTGTGTGAGCAGGTGGGG + Intronic
1022536093 7:31099544-31099566 GTGCTGATTCTGAGTTGCTGGGG + Intronic
1022622644 7:32000563-32000585 GCGATGTTTGTGAGTAGCTCAGG - Intronic
1023625488 7:42111391-42111413 GTGTTGTCAGTGAGTAGCTATGG + Intronic
1023731742 7:43198169-43198191 GTGCTGTGTGTGTGAATGTGGGG - Intronic
1023870230 7:44259258-44259280 GTGGTGTTTGGGAGCAGCTGAGG - Intronic
1024987040 7:55203631-55203653 GTGGTGTGTGTGTGTATGTGTGG - Intronic
1026502877 7:70957832-70957854 GAGCAGTGTGTAAGTAGCAGGGG + Intergenic
1026905188 7:74058898-74058920 TTGCTGTGTGTGAGAATATGGGG - Intronic
1027318625 7:76998917-76998939 GTGTGGTGTGTGTGTAGGTGTGG + Intergenic
1027503477 7:78984707-78984729 GTGCTGAGTGTGTGTGGGTGGGG - Intronic
1028820427 7:95204684-95204706 GTGGTGTGTGTGGGTATGTGTGG - Intronic
1028820464 7:95204963-95204985 GTGGTGTGTGTGGGTATGTGTGG - Intronic
1029226982 7:99035325-99035347 GGGCCGTGTGTGAGCAGGTGTGG - Intronic
1029436905 7:100568677-100568699 GTGCTGTGTGCATGGAGCTGGGG - Intergenic
1029793248 7:102867502-102867524 GTTCTGTGTGTCTGGAGCTGAGG + Intronic
1030364928 7:108634934-108634956 ATGCTGTGTGTGAGAAAATGTGG + Intergenic
1032505118 7:132428602-132428624 TTCCTGTGTCTGAGTAGCAGGGG - Intronic
1032509492 7:132460730-132460752 GTGATGTGTGGGATTAGCAGAGG - Intronic
1033880007 7:145869292-145869314 CTGCTGTGTGCAGGTAGCTGGGG + Intergenic
1034324127 7:150214430-150214452 GTGGTTTGTGTGCGTAGCTCCGG - Intergenic
1034858301 7:154574977-154574999 GTGCTGTGTGTGTATATGTGTGG + Intronic
1035198274 7:157241135-157241157 GCACTCTGCGTGAGTAGCTGTGG - Intronic
1035283204 7:157790226-157790248 GTGGTGTGTGTGTGTGTCTGTGG + Intronic
1035558003 8:580574-580596 GTGCTATGGATGAGTATCTGTGG - Intergenic
1035708227 8:1694005-1694027 GGGCTGTGTGTGGGAAGCTTTGG - Intronic
1035752644 8:2007397-2007419 CTTGTGTGTGAGAGTAGCTGAGG + Intergenic
1036083982 8:5592480-5592502 GTGGTGTGTGTGTGTATGTGTGG - Intergenic
1037358186 8:18045281-18045303 GAGCTGGGTGTAAGTAGCAGAGG - Intergenic
1039593423 8:38769623-38769645 GTGGTGTGTGTGACTACGTGGGG + Intronic
1039922231 8:41901510-41901532 ATGCTGTGTGTGGGTCACTGTGG - Intergenic
1039992396 8:42499408-42499430 GTGCTGTGAGAGAGTGGCAGCGG - Intronic
1040060674 8:43100506-43100528 GTGCTGTGTGTGTGTCTGTGGGG + Intronic
1040581944 8:48705492-48705514 GAACTCTGTGTGAGTGGCTGGGG + Intergenic
1040611086 8:48982898-48982920 GTACAGAGTGTGAGAAGCTGTGG + Intergenic
1040706735 8:50137432-50137454 TTGCTGTGTTTCAGTAGGTGTGG + Intronic
1041421487 8:57671868-57671890 GTGTGGTGTGTGTGTTGCTGTGG + Intergenic
1041820886 8:62031774-62031796 GTCCTGGGTGTGACTAGCTGGGG + Intergenic
1044835292 8:96289413-96289435 GAGCTCTGTGTCAGTAACTGGGG + Intronic
1047203885 8:122788083-122788105 GTGCTGTGTCTGGGTATGTGGGG - Intronic
1048089065 8:131218875-131218897 GGGCTGTGTGTGCTTTGCTGAGG + Intergenic
1049245782 8:141561660-141561682 GTGCTGTGTGTGTGCAAATGTGG - Intergenic
1049305541 8:141901211-141901233 GTGTTGTGTGTGAGTGTGTGTGG + Intergenic
1049415646 8:142493657-142493679 CTGCTGCCTGTGAGGAGCTGAGG + Intronic
1049989992 9:981644-981666 TTGCTGTGTGTGTGTTGCGGAGG + Intronic
1050057215 9:1668174-1668196 GTGCTGTGTCTCAATACCTGTGG + Intergenic
1051214481 9:14781605-14781627 GTGTTGTGTGTGAGTGTGTGTGG - Intronic
1052273727 9:26655175-26655197 GTGCTGTGGGTGAGCAGCAGGGG + Intergenic
1052662325 9:31449804-31449826 GTGGTGTGTGTGTGTGGGTGTGG - Intergenic
1055496785 9:76862612-76862634 GTGCTATGTGTGTGTAGCGGGGG - Intronic
1056258355 9:84823573-84823595 GTCCTGGGCGTCAGTAGCTGGGG + Intronic
1056655443 9:88504918-88504940 GTGCTGTCTGTGAGGCTCTGGGG - Intergenic
1056702573 9:88923403-88923425 GAGCTCTGTGTGAGCAGATGAGG - Intergenic
1056819341 9:89826417-89826439 GTGCTGCTTGTGAGTATTTGGGG - Intergenic
1057419851 9:94902673-94902695 ATGCTGTGTGTGTGTACTTGTGG + Intronic
1057871364 9:98720702-98720724 ATGCTGGGTGTGAGTCTCTGAGG + Intergenic
1058626688 9:106940795-106940817 GGGCTGGGTGAGAGTACCTGTGG + Intronic
1058734749 9:107883952-107883974 GTGCTGTGTGTGAGTCAGAGGGG - Intergenic
1058813492 9:108663263-108663285 GTGCTGTGTGTGCAGAGATGAGG + Intergenic
1060154463 9:121309504-121309526 CTGCTGGGTGGGAGTTGCTGCGG + Intronic
1061204710 9:129156268-129156290 GTGCTGGGTGTCTGGAGCTGGGG + Intergenic
1061696364 9:132377352-132377374 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696365 9:132377371-132377393 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696369 9:132377447-132377469 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696375 9:132377576-132377598 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696379 9:132377650-132377672 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696385 9:132377770-132377792 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696391 9:132377876-132377898 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696401 9:132378070-132378092 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696404 9:132378127-132378149 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696405 9:132378146-132378168 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696410 9:132378251-132378273 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696413 9:132378300-132378322 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696422 9:132378459-132378481 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061696436 9:132378679-132378701 GTGGTGTGTGTGAGTGCATGTGG + Intronic
1061743005 9:132721106-132721128 GTTTTGTGTGTCAGTTGCTGTGG - Intergenic
1062123548 9:134847431-134847453 GTGGTGTGTGTGTGTGCCTGTGG + Intergenic
1062635255 9:137487233-137487255 GTGCGGTCTGTGAACAGCTGGGG - Intronic
1203526649 Un_GL000213v1:97063-97085 GAGCAGCGTGTCAGTAGCTGGGG - Intergenic
1203526860 Un_GL000213v1:98341-98363 GAGCAGTGTGTCAGTAGCTGGGG - Intergenic
1203749002 Un_GL000218v1:61746-61768 GAGCAGTGTGTCAGTAGGTGGGG + Intergenic
1203543741 Un_KI270743v1:112441-112463 GAGTAGTGTGTCAGTAGCTGGGG - Intergenic
1203636742 Un_KI270750v1:119806-119828 GTGCTGTGTGTGTCTGGGTGGGG + Intergenic
1186439004 X:9568595-9568617 GTGCTGTGTGTGTGTGTGTGTGG + Intronic
1187550597 X:20301033-20301055 GGGCTGTCTGACAGTAGCTGTGG + Intergenic
1188537591 X:31214820-31214842 GTGGTGTGTGTGTGTAGCTGGGG + Intronic
1189100685 X:38186296-38186318 GTTATGTGTGTGTGTAGCTGGGG - Intronic
1191671512 X:63752659-63752681 TTGGTGTGGGTGAGAAGCTGAGG - Intronic
1191853310 X:65602197-65602219 GTGCTGTCTGTGTGTGGCAGGGG + Intronic
1192079247 X:68031707-68031729 GACCTGTATGAGAGTAGCTGAGG + Intergenic
1192537013 X:71936730-71936752 GTGGTGTGTGTGTGTAGTGGGGG + Intergenic
1193509971 X:82387736-82387758 TTTCTGGGTGTGAGTAGCAGAGG + Intergenic
1194751960 X:97694877-97694899 GTGCTGTGTATTAGTTGCTAAGG - Intergenic
1195025475 X:100872767-100872789 GTCCTGTGGGTGTGTAGGTGGGG - Intronic
1199533026 X:148871049-148871071 GTGCTGTGTGTGTGTGGTTGTGG + Intronic
1200042854 X:153382318-153382340 CTGCTGTGTGAGAGCTGCTGGGG + Intergenic
1200044037 X:153391046-153391068 GTGTGGTGTGTGAGTATGTGTGG - Intergenic
1200765700 Y:7079025-7079047 GTGGTGGGGGTGAGAAGCTGTGG - Intronic
1201162362 Y:11176760-11176782 GAGCAGTGTGTCAGTAGGTGGGG + Intergenic