ID: 1165421301

View in Genome Browser
Species Human (GRCh38)
Location 19:35723285-35723307
Sequence GGGGCGTGACCTCATTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421294_1165421301 27 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421293_1165421301 28 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421295_1165421301 14 Left 1165421295 19:35723248-35723270 CCCTAACACCAAGAAGCAGTGCT 0: 1
1: 0
2: 3
3: 11
4: 138
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421296_1165421301 13 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421297_1165421301 6 Left 1165421297 19:35723256-35723278 CCAAGAAGCAGTGCTGTGTGTGA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421301 Original CRISPR GGGGCGTGACCTCATTCCCG TGG Intronic
900899071 1:5504564-5504586 GGGGAGTGATCTCATCCCCCTGG + Intergenic
904517824 1:31070569-31070591 GTGGCGTGACCTCAGCCCCCTGG + Intergenic
905982447 1:42241735-42241757 GTGGTGTGTCCTCATTCCCCTGG - Intronic
907388662 1:54142070-54142092 GGGCCCTGACCACATTCCCTGGG - Intronic
911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG + Intergenic
912723971 1:112042862-112042884 CGGGGGTGACCCCATTCCCCTGG - Intergenic
1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG + Intronic
1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG + Intronic
1072789651 10:98308956-98308978 GGGGCTTGAGCTCATTTCAGGGG + Intergenic
1107177376 13:37414853-37414875 GGGGCATGACCTCATCCAGGTGG - Intergenic
1113552636 13:111205014-111205036 GGAGTGTGAGCTCATTCACGGGG - Intronic
1129834490 15:78693505-78693527 GGGGAGTGAGCTCATCCCAGAGG - Intronic
1136666979 16:31820496-31820518 GGTGCATGACTTCCTTCCCGTGG - Intergenic
1137673789 16:50293833-50293855 GGGGCTTTACCTCATTCTGGGGG - Intronic
1138599650 16:58046988-58047010 GGGGCTTGACCTCAATGCCAAGG + Intergenic
1142631692 17:1229801-1229823 GGGGCGGGTTCTCATCCCCGGGG - Intergenic
1143381787 17:6501244-6501266 GGGGTGTCACCCCATTCCCCAGG - Intronic
1147582426 17:41634891-41634913 GGGGCCTGACATCATTGCCCAGG + Intergenic
1152422200 17:80199958-80199980 TGGGCTTCACCTCATTCCAGAGG + Intronic
1157936105 18:51874576-51874598 GGGGCCTCACCCCATTCCAGAGG + Intergenic
1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG + Intronic
1164938225 19:32231226-32231248 GGGGCAGGATCTCATCCCCGTGG - Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1165818393 19:38658003-38658025 GGGGAGTGCCCTCATACCAGAGG + Intronic
928081984 2:28319896-28319918 GGGAAGTGACCTCACTCCCGAGG + Intronic
935553569 2:104483263-104483285 GAGGCATGACCTGATTCCCCAGG - Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946102476 2:217337949-217337971 GGGAAGTGACCTCATACCCTGGG - Intronic
947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG + Exonic
1172037113 20:32018527-32018549 GGGGCGGGGCCTGATTCCAGGGG + Intronic
1172121904 20:32603432-32603454 GGGGCCTGAGCTCATTCCCAAGG - Intronic
1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG + Intergenic
1179703760 21:43170087-43170109 GGGCAGTGACCTCATTCCACAGG + Intronic
1180895914 22:19331937-19331959 GGGGCTTGACCTCAAACCCCTGG - Intronic
1183821066 22:40346455-40346477 GGGGCGGGACTTCCTTCACGCGG - Intergenic
1185383039 22:50518857-50518879 GGGGCGAGGCCTCACTCCCATGG - Intronic
954145089 3:48630538-48630560 GGGGAGAGACCTCCTTCCCCAGG + Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG + Exonic
995409396 5:111837861-111837883 GGGTCGTCACCTCATTCCAGTGG + Intronic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG + Exonic
1003177404 6:3762227-3762249 GGGGAGTGACCTCTTTCAGGTGG - Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1021234460 7:18125163-18125185 GGGGGGTACCCTCATTCCCCAGG - Intronic
1029147775 7:98458852-98458874 GAGGCCTGGCCTGATTCCCGAGG - Intergenic
1038701457 8:29853192-29853214 GGGGCATAACCTCATCCCTGGGG + Intergenic
1062240453 9:135534771-135534793 GCGTCGTGACCTCATTCACAGGG - Intergenic