ID: 1165421301

View in Genome Browser
Species Human (GRCh38)
Location 19:35723285-35723307
Sequence GGGGCGTGACCTCATTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421294_1165421301 27 Left 1165421294 19:35723235-35723257 CCAAGTTTGGGGGCCCTAACACC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421295_1165421301 14 Left 1165421295 19:35723248-35723270 CCCTAACACCAAGAAGCAGTGCT 0: 1
1: 0
2: 3
3: 11
4: 138
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421293_1165421301 28 Left 1165421293 19:35723234-35723256 CCCAAGTTTGGGGGCCCTAACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421297_1165421301 6 Left 1165421297 19:35723256-35723278 CCAAGAAGCAGTGCTGTGTGTGA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1165421296_1165421301 13 Left 1165421296 19:35723249-35723271 CCTAACACCAAGAAGCAGTGCTG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421301 Original CRISPR GGGGCGTGACCTCATTCCCG TGG Intronic