ID: 1165421573

View in Genome Browser
Species Human (GRCh38)
Location 19:35724674-35724696
Sequence CAGGCTGCAGGGTAGGTTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165421573_1165421579 0 Left 1165421573 19:35724674-35724696 CCGCAAACCTACCCTGCAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 307
Right 1165421579 19:35724697-35724719 TGTTGCAGCTCAAGGCCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1165421573_1165421577 -8 Left 1165421573 19:35724674-35724696 CCGCAAACCTACCCTGCAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 307
Right 1165421577 19:35724689-35724711 GCAGCCTGTGTTGCAGCTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 202
1165421573_1165421580 7 Left 1165421573 19:35724674-35724696 CCGCAAACCTACCCTGCAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 307
Right 1165421580 19:35724704-35724726 GCTCAAGGCCCGAAGGCGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1165421573_1165421584 22 Left 1165421573 19:35724674-35724696 CCGCAAACCTACCCTGCAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 307
Right 1165421584 19:35724719-35724741 GCGCCTGGACAAGGTCAGCACGG 0: 1
1: 0
2: 1
3: 14
4: 165
1165421573_1165421581 13 Left 1165421573 19:35724674-35724696 CCGCAAACCTACCCTGCAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 307
Right 1165421581 19:35724710-35724732 GGCCCGAAGGCGCCTGGACAAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165421573 Original CRISPR CAGGCTGCAGGGTAGGTTTG CGG (reversed) Exonic
900164656 1:1239866-1239888 CAGGCAGCAGGGTCGGCCTGCGG + Intergenic
900512308 1:3066550-3066572 CAGGCTGTTGGGTAGGGATGGGG - Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
901213752 1:7541694-7541716 AAGGCTGCAGTGGGGGTTTGGGG - Intronic
902664480 1:17927841-17927863 CAGGCTGCAGGAGGGGTGTGAGG + Intergenic
903382839 1:22908883-22908905 GAAGCTGCATGGTAAGTTTGGGG + Intronic
904595195 1:31639847-31639869 CAGGCTGCACAGGAAGTTTGGGG + Intronic
905913387 1:41669132-41669154 CAGAGTTCAGGGTGGGTTTGAGG - Intronic
907121891 1:52015263-52015285 GAGGCAGCAGGGTTGGTTTTGGG + Intergenic
907160270 1:52364511-52364533 TAGGCTACTGGGTCGGTTTGGGG - Intronic
908329295 1:63054846-63054868 AAGAATGCAGGGTAGGTGTGAGG + Intergenic
908455140 1:64296449-64296471 CAGGTTGCGGGGTATGTTTGTGG - Intergenic
910629062 1:89338147-89338169 CAGGCCTCAGGGTAGTCTTGGGG + Intergenic
911469938 1:98305857-98305879 CAGGCAGCTGGGCAGGTTTGAGG - Intergenic
911974265 1:104471791-104471813 CAGGTTGCATGGTAGCTTGGTGG - Intergenic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
915298981 1:154941445-154941467 CAGGTTGCAGGGTAGGGGTGTGG - Intergenic
916062816 1:161112757-161112779 CAGTGTGTAGGGTAGGTTTGGGG - Intronic
917852289 1:179075490-179075512 AAGGCTGCATTGTGGGTTTGGGG + Exonic
919416698 1:197319386-197319408 CAGGCTGCAGTGTAGTGTAGTGG - Intronic
921448095 1:215270558-215270580 CAGGAGGAAGGGCAGGTTTGCGG - Intergenic
922400473 1:225249124-225249146 CAGGATGCAGTATTGGTTTGAGG - Intronic
922555972 1:226532251-226532273 CAGGCTGGAGTGTAGTTGTGCGG + Intergenic
922660777 1:227428847-227428869 CAGGATGCTGGGTGGGTTTCAGG - Intergenic
1067558250 10:47287095-47287117 CAGGGTGGAGGGTAGGGTAGAGG + Intergenic
1067990292 10:51204554-51204576 CCGGCAGCAGGGTAGCTATGAGG - Intronic
1068815440 10:61305328-61305350 CAGAGTGCTGGGTAGGATTGGGG + Intergenic
1068828452 10:61466100-61466122 GAGCCAGCAGGGTAGGTTTCTGG - Intergenic
1069717631 10:70531160-70531182 CAGGTTGCAGGGATGGTGTGGGG + Intronic
1069964341 10:72101674-72101696 AAGGCTTTAGGGTAGGTTGGTGG + Intronic
1069991841 10:72321074-72321096 CCGGCTGTCGGGTAGGGTTGGGG - Intergenic
1069994140 10:72332342-72332364 CGGGCTGCGGGGGCGGTTTGGGG + Intergenic
1070129574 10:73647374-73647396 AAGGCTGCAGGGCAGGGGTGGGG - Exonic
1070300081 10:75197188-75197210 CAGGCTGCAGCTTTGGCTTGAGG - Intergenic
1071433611 10:85626106-85626128 CCAGGTGCAGGGTAGGTGTGGGG + Intronic
1072030824 10:91520455-91520477 CAGGTTACAGGGTAGCTTTATGG + Intergenic
1074338157 10:112599197-112599219 CAGCTTGCAGAGTAGGATTGGGG + Intronic
1074757465 10:116635112-116635134 CAGGCAGCAGGGTGGGCTGGAGG + Intronic
1075178071 10:120184250-120184272 AATGCTGCAGGGGAGGCTTGGGG - Intergenic
1076545555 10:131243627-131243649 AAGGTTGCAGGGTTGGTTTTAGG - Intronic
1077168122 11:1152822-1152844 CAGAGTGCAGTGAAGGTTTGTGG + Intergenic
1079496871 11:21053828-21053850 CAGGCTGCAGGGTGCCTTTCTGG + Intronic
1080716532 11:34807417-34807439 AAGGCAGCAGTGTATGTTTGTGG - Intergenic
1081857531 11:46313040-46313062 AAGGCTGCAGGGTGTGTTTCTGG - Intronic
1082043538 11:47706631-47706653 GAGGCTGCAGGGTAGGGGTTGGG + Intronic
1083016476 11:59459315-59459337 AAGGCTGAAGGGTGGATTTGAGG - Intergenic
1083299301 11:61732009-61732031 TAGGCTGCAGGCCAGGTCTGGGG - Intronic
1083364144 11:62131214-62131236 CAGGCTGCAGGGTGGGTGAATGG - Intronic
1083881114 11:65548711-65548733 CAGGCTGCATGGCAGGAGTGAGG - Intronic
1084962804 11:72726189-72726211 AAAGCTGCGGGGTAGGGTTGGGG - Intronic
1085259028 11:75193745-75193767 AAGGCTCCAGGGTAGGTGTCAGG + Intronic
1085321928 11:75580230-75580252 AAGGCTGCAGGGTTGGAGTGGGG + Intergenic
1085365497 11:75938941-75938963 CAGGCTTCAGAGTAGGGATGGGG - Intronic
1086371057 11:86156335-86156357 CAGGCTGAATGCTAGGTTTTGGG - Intergenic
1088343728 11:108798742-108798764 CAGGTTGCAGGGTGGGGTAGGGG + Intronic
1089150777 11:116362393-116362415 CTGGCTGCAGAGAAGGATTGGGG + Intergenic
1089329244 11:117678275-117678297 CAGGCTACAGGGTGGGGTGGCGG + Intronic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1090239970 11:125174982-125175004 CAGGCTTCAGGGAAGGCTGGAGG - Intronic
1090392001 11:126394813-126394835 CAGGCTGCAGGGGCGGATGGTGG + Intronic
1090422848 11:126587488-126587510 CAGGCTACAGGGTTGGTGAGAGG - Intronic
1090868969 11:130726236-130726258 CTGGCTGCAGGGCAGGATGGGGG - Intergenic
1090897898 11:130995449-130995471 CAGGAAGCAGGGGAGGTTAGAGG + Intergenic
1090918279 11:131186257-131186279 CAGGTTGCGGGGGAGGTTTGGGG - Intergenic
1091179556 11:133591396-133591418 CAGGGTCCAGGGTTGTTTTGTGG - Intergenic
1091584056 12:1805897-1805919 CAGGCGGCAGGGAAGGTGAGAGG + Intronic
1094242868 12:28248904-28248926 CAGGTTGCTGGGAGGGTTTGGGG + Intronic
1097924379 12:65111255-65111277 CAGGGTGGAGGGTAGTTTTGAGG - Intronic
1098142352 12:67463011-67463033 CTGGATGCAGGGCAGGTGTGTGG + Intergenic
1099981728 12:89612053-89612075 CATGATGCAGGGCAAGTTTGAGG - Intronic
1100187250 12:92151427-92151449 AAGGCTGCGGGGTAGGGGTGGGG - Intergenic
1102027640 12:109722656-109722678 CAGGCAGCAGGGTAGGGGAGTGG - Intronic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1103004462 12:117409758-117409780 CAGGCTGCTGGGGAAGTTGGAGG - Intronic
1103949341 12:124542647-124542669 CAGCCTGCAGGGAAGGCTTCTGG - Intronic
1104648509 12:130514141-130514163 CAGGCTGCAGGACAGATCTGGGG + Intronic
1104856211 12:131903649-131903671 GGGGCTGCAGGGTAGGGTGGGGG - Intronic
1104906012 12:132213948-132213970 CATGCTGCAGGGAGGGTGTGCGG - Intronic
1105212887 13:18267610-18267632 TAGGCAGCAGGGTATGTATGCGG - Intergenic
1105279432 13:18954571-18954593 CCACCTGCAGGGCAGGTTTGAGG - Intergenic
1105356151 13:19661824-19661846 CATGCTGCAGAGAAGGTTTGTGG + Exonic
1105743025 13:23348630-23348652 CAGACTGCAGGGCAGGGGTGAGG + Intronic
1106021939 13:25924031-25924053 CAGGCTGAAGGGTAGCTTCCTGG - Intronic
1106889195 13:34225136-34225158 CATGCTCCAGGCTATGTTTGTGG + Intergenic
1108211026 13:48139897-48139919 CAGGATGCAGGGGAGCTCTGGGG - Intergenic
1113670552 13:112172755-112172777 CAAGTTGCAGGGTAGGGTTCCGG + Intergenic
1114575755 14:23711424-23711446 CTGGCCACAGGGTTGGTTTGGGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115587196 14:34826137-34826159 CAGGTTGCAGTGTAGGATTTTGG - Exonic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1119700864 14:76753583-76753605 CAGGCTGCAGTGCAGGCTGGGGG - Intergenic
1121118700 14:91361934-91361956 CAGCCTGGAGTGTAGTTTTGAGG - Intronic
1122229857 14:100300942-100300964 CAGGCTGGAGTGTAGTGTTGCGG + Intronic
1122232850 14:100315651-100315673 CAGGCTGGAGTGTAGTGTTGCGG + Intergenic
1123118261 14:105904547-105904569 CAGGCTGGGCGGTAGGTTTGGGG - Intergenic
1123562752 15:21513235-21513257 CAGGGGGCAGGGTGGGTTGGGGG - Intergenic
1123598996 15:21950518-21950540 CAGGGGGCAGGGTGGGTTGGGGG - Intergenic
1124378398 15:29143431-29143453 CAGGCTGCAGGGCTGCCTTGGGG + Intronic
1125251577 15:37711264-37711286 CACATTGCAGGGAAGGTTTGAGG + Intergenic
1125816126 15:42586290-42586312 CAGCCTGCAAGGTAGGTAGGAGG + Intronic
1127124817 15:55801699-55801721 CAGGAGGCAGGGTAGGGTTCTGG - Intergenic
1127372772 15:58356288-58356310 AATGCTGCAGGGAAGGTATGTGG - Intronic
1128347790 15:66865386-66865408 CAGGCTCTAGTGTTGGTTTGGGG + Intergenic
1128492140 15:68158360-68158382 AAGGCAGCAGGGGAGTTTTGAGG - Intronic
1129393742 15:75233391-75233413 ATGGCTGCTGGGTAGGTCTGGGG + Intergenic
1132359715 15:101202126-101202148 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359731 15:101202189-101202211 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359745 15:101202252-101202274 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359761 15:101202315-101202337 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359775 15:101202378-101202400 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359799 15:101202504-101202526 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359815 15:101202567-101202589 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359829 15:101202630-101202652 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1202971103 15_KI270727v1_random:240368-240390 CAGGGGGCAGGGTGGGTTGGGGG - Intergenic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1135468925 16:22712107-22712129 AAGGCTGCAGGGTAGGTGGGGGG + Intergenic
1137060948 16:35791374-35791396 CTGGCTGCAGGCTAGGTTCTGGG - Intergenic
1137072270 16:35913961-35913983 CTGGCTGCAGGCTAGGTTGTGGG - Intergenic
1139254943 16:65531700-65531722 CAGGCTCCAGGGCAGGTATTGGG - Intergenic
1139310157 16:66021318-66021340 CAGGCTCCAGGGAAGGTATTGGG - Intergenic
1140732012 16:77864898-77864920 GAGGCTGCAGGCTAATTTTGAGG + Intronic
1140866748 16:79068764-79068786 CAGGCTGCAGGGCAGTGGTGAGG - Intronic
1141713650 16:85714736-85714758 CCGACTGCTGGGTAGTTTTGAGG + Intronic
1141857099 16:86690853-86690875 CAGGCATCAGGGTATGATTGCGG - Intergenic
1141929871 16:87195246-87195268 CAGGCTGCACTGTGGCTTTGCGG - Intronic
1143499837 17:7332176-7332198 CAGGCTGCAGGACAGTTTTGAGG + Intergenic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1144086407 17:11812900-11812922 TAGGCTTTAGGGTAGCTTTGGGG - Intronic
1145869075 17:28258747-28258769 CAGGCTGCAGGGAGGGGTTTGGG - Intergenic
1145919285 17:28598587-28598609 CGGGCTGCAGGGTAAGTTCACGG + Exonic
1145999242 17:29121515-29121537 GAGTCTGCAGGGTAGCCTTGAGG + Intronic
1146459383 17:33033556-33033578 CAGCCTGCAGGGATGGGTTGGGG - Intronic
1147923168 17:43931152-43931174 CAGGCTGCAGGGAGGGGTTTGGG + Intergenic
1148080798 17:44966972-44966994 CTGGCTGCAGGAAATGTTTGGGG - Intronic
1148172917 17:45538358-45538380 CAGCCTGGAGGGGAGGTTGGAGG + Intergenic
1148276350 17:46307092-46307114 CAGCCTGGAGGGGAGGTTGGAGG - Intronic
1148298467 17:46524667-46524689 CAGCCTGGAGGGGAGGTTGGAGG - Intronic
1148340444 17:46870399-46870421 CAGGCTGCAGGGAGGGGTTTGGG + Intronic
1148486922 17:47996537-47996559 GAAGCTGCAGGACAGGTTTGGGG + Intergenic
1150404123 17:64885281-64885303 CAGCCTGGAGGGGAGGTTGGAGG + Intronic
1150812420 17:68367291-68367313 CAGGGTGCAGGGGGGATTTGAGG + Intronic
1151218005 17:72591188-72591210 CAGGCTGCAGGAGAGGGGTGAGG + Intergenic
1151354530 17:73550589-73550611 GAAGCTGCAGGGTAGGGGTGGGG - Intronic
1152058350 17:78050172-78050194 CAGGCTGTACGGTAGGGTTCTGG - Exonic
1152476228 17:80520200-80520222 GAGGCTGCAGCGCAGGCTTGGGG + Intergenic
1153140563 18:1967738-1967760 CAGGCTGGAGGGTAGTGGTGTGG - Intergenic
1153503183 18:5769370-5769392 CAGCCTGCAAGATAGATTTGGGG - Intergenic
1153964838 18:10169923-10169945 AGGCCTGAAGGGTAGGTTTGGGG + Intergenic
1155160029 18:23188100-23188122 CAGGGAGCAGGGTAGGGTGGTGG - Intronic
1156459672 18:37314706-37314728 CAAGCTGCAGGGGAGGCTGGAGG - Intronic
1157678308 18:49583864-49583886 CATGCTGGAGGGAAGGATTGAGG - Intronic
1159029950 18:63220763-63220785 CAGACTTCAGGGAAGGTTTCCGG + Intronic
1159448428 18:68568847-68568869 CTGGCTGCTGGGTTTGTTTGTGG - Intergenic
1159541993 18:69789895-69789917 GAGGCTGCAGTGTAAGTCTGTGG + Intronic
1159974736 18:74696819-74696841 AAGGCTGCAAGGTAGTTTGGAGG + Intronic
1161527248 19:4764029-4764051 CAGGCTGCAGGTCAGGTTTCGGG + Intergenic
1161591074 19:5129278-5129300 CTGGCTGCAGGGTCTGTTGGGGG + Intronic
1162917317 19:13881416-13881438 CAGGCCTCAGGGCTGGTTTGTGG - Intergenic
1163199040 19:15749365-15749387 TAGGCTGTAGTGTAGGTTTAAGG - Intergenic
1164149801 19:22541317-22541339 CAGGCTGCCGGGGAAGATTGAGG - Intergenic
1164694763 19:30235020-30235042 CAGGAGGAAGGGAAGGTTTGGGG + Intronic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
1165810131 19:38607060-38607082 AAGGCTGGAGGGTGGGTCTGGGG + Intronic
1167064622 19:47175170-47175192 CAGGATGCAGGGTGGCTTTGGGG + Intronic
1168147181 19:54426338-54426360 CACTCTGCAGGGTGGGGTTGGGG + Intronic
1168284321 19:55322855-55322877 CAGGCAGCACCGTAGCTTTGGGG + Intronic
1168287851 19:55343263-55343285 CATGCTGCAGGGGAGCTGTGAGG + Intronic
925568968 2:5288690-5288712 GAGGCTGAGGGGCAGGTTTGGGG - Intergenic
926473815 2:13296446-13296468 CAGGATGCAGAGTAGGTTATGGG - Intergenic
927150646 2:20193597-20193619 AAGGGTGCAGGGAAGTTTTGGGG + Intergenic
927158254 2:20234731-20234753 AAGGGTGCAGGGAAGTTTTGGGG - Intergenic
931647649 2:64439500-64439522 CAGGCTGAAGAGTATGTGTGTGG + Intergenic
932091949 2:68813741-68813763 CAGGCTGGAAGGCAGGTGTGAGG + Intronic
934570892 2:95372686-95372708 CAGGCAGGTGGGTAGGTGTGGGG + Intronic
936344531 2:111665200-111665222 CAGGCTCCAGGGTAGACTTCTGG - Intergenic
936849723 2:116881340-116881362 AAGTCTGCAGGGTATGTGTGTGG - Intergenic
937424698 2:121789371-121789393 CAGCCTGCAGGGTGGGTAGGGGG + Intergenic
938228353 2:129636847-129636869 TAAGCTGCAGGGTGGGTTGGGGG - Intergenic
942967287 2:181911904-181911926 CAGACTTCAGAGCAGGTTTGGGG - Intronic
943809799 2:192170660-192170682 CAATCTGCAGAATAGGTTTGTGG + Intronic
946934068 2:224701288-224701310 CAGGCAGAGGGGTTGGTTTGGGG - Intergenic
947899905 2:233712620-233712642 CAGGCTGCAGCTGAGGTCTGAGG - Intronic
947900601 2:233718451-233718473 CAGGCTGCAGCTGAGGTCTGAGG - Intronic
948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG + Intergenic
948897180 2:240932968-240932990 CAGGCTGAAGGGTAGTTATGGGG + Intronic
1170769370 20:19318659-19318681 CAGGTAGAAGGGTAGGTGTGGGG + Intronic
1173498068 20:43533412-43533434 CAGGCTGCAGGGTCACCTTGTGG - Exonic
1173665790 20:44762230-44762252 CAGGCTGCAGAGCAGGTGAGCGG - Intronic
1174449207 20:50609410-50609432 CTGGCTGCAGGGATGGTTAGAGG - Intronic
1175333026 20:58177687-58177709 CAGGCAGCAGGGGAGGGTTTGGG - Intergenic
1175517794 20:59579818-59579840 CAGGATGCCCTGTAGGTTTGGGG + Intronic
1175854435 20:62112832-62112854 CAGGCAGCAAGATGGGTTTGTGG + Intergenic
1179179626 21:39034536-39034558 CTGGCTGGAAGGCAGGTTTGGGG - Intergenic
1179360828 21:40706636-40706658 ACAGCTGAAGGGTAGGTTTGAGG - Intronic
1180670331 22:17548227-17548249 CAGTCTGCAGGGGAGGTGTGGGG - Exonic
1180854995 22:19040101-19040123 CAGGCTGCAGAGCAGGGTGGGGG - Intronic
1180885584 22:19241025-19241047 CCGGCTGCAGGGTGGGTGTGGGG - Intronic
1180980433 22:19875784-19875806 ATGGCTGCAGGCCAGGTTTGGGG - Exonic
1181046107 22:20215074-20215096 CAGCCTGCTGGGTAGGGTGGAGG - Intergenic
1181631809 22:24155637-24155659 CAGGCAGAAGTGTAGGTGTGTGG - Intronic
1183063203 22:35347796-35347818 CAGGCTGCAGGTGAGGCTTCAGG + Exonic
1183451006 22:37895074-37895096 CAGTCTGCAGGGCAGGCTGGGGG - Intergenic
1183485334 22:38085150-38085172 CAGGCTGCCGGGGTGGTCTGGGG + Exonic
1183610377 22:38898875-38898897 CATGTTGCAGGCTAGGTTTTAGG + Intergenic
1184096588 22:42319460-42319482 CAGGAGGCAGGGGAGGTCTGGGG - Intronic
1184272293 22:43391602-43391624 CTGGGTGCAGGTTTGGTTTGAGG - Intergenic
949536480 3:5000043-5000065 CGGGCTGCATGTTAGCTTTGAGG + Intergenic
949889657 3:8724341-8724363 CATGCTGTAGGGTTGGTGTGGGG - Intronic
950357172 3:12421438-12421460 TTGGCTGCTGGGTAGGTTTTGGG - Intronic
950494090 3:13323497-13323519 CAGACTGCAGGGTGAGGTTGTGG - Intronic
950530974 3:13552207-13552229 CAGGCTGGAGGGCAGCTGTGGGG + Intronic
950769763 3:15302101-15302123 GAGGGTTCAGGTTAGGTTTGAGG - Intronic
952377593 3:32780574-32780596 CAGGCTCCAGGGTGGGAGTGGGG + Intergenic
953443137 3:42936793-42936815 CAAGCTGAGGGGTAGGGTTGGGG - Intronic
953596416 3:44318595-44318617 CAGGCCCCAGGGCAGGTCTGAGG + Intronic
954075904 3:48180043-48180065 CAGGCTGCTGGGCAGTTTTGGGG - Intronic
954217066 3:49130576-49130598 CAGACTGCAGAGGAGGATTGAGG + Intronic
954419136 3:50409350-50409372 CAAGCTGCAGGGAAGGTTCAGGG + Intronic
956029584 3:65023212-65023234 CAGGGTGCAAGGTAGGTTCCTGG + Intergenic
959864013 3:111245339-111245361 CATGGTGCAGTGTAGTTTTGAGG + Intronic
960966737 3:123110837-123110859 CAGGGTGAAGGGTAGGGATGGGG - Intronic
961000189 3:123368890-123368912 AAGGCTGCAGGGTACCTTTAAGG + Intronic
961018063 3:123482466-123482488 CAGGCTGTAGGGTGGGGTGGGGG + Intergenic
961186899 3:124923136-124923158 CAGGGTGCAGTGAAGGTCTGAGG - Intronic
962133086 3:132703622-132703644 CAGGCTGGAGGGCAGGGGTGTGG + Intronic
962315201 3:134354911-134354933 CAGGCTGGAGGGTTGGGTGGAGG + Intergenic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
965024174 3:163277499-163277521 CTGGCTGCATGGTGGGTTTGAGG - Intergenic
966334582 3:178854064-178854086 CATGGTGCAGGGCAGTTTTGTGG - Intergenic
967254532 3:187576216-187576238 CAGTCTCCAGGGTAGGGATGAGG - Intergenic
968145146 3:196292283-196292305 CAGGCTGGAGGTGAGGTTAGTGG - Intronic
968549816 4:1216465-1216487 CAGGCTGCAGGGGAGTGGTGTGG - Intronic
968841146 4:3006726-3006748 CAGGCTGGAGGGTAGTGGTGAGG - Intronic
970405190 4:15756191-15756213 AAGACTGCAGGGTGGGTTGGGGG + Intergenic
972509570 4:39755257-39755279 CAGGGTGCAGAATAGGTTTGAGG - Intronic
973065030 4:45779349-45779371 CAGGCTGCAAAGTTGGTTTTGGG + Intergenic
973086991 4:46076670-46076692 CTGGCCTCAGGGCAGGTTTGTGG - Intronic
975632588 4:76417899-76417921 GAGGCTGCAGGGTAGCTAAGTGG + Intronic
978986104 4:115014849-115014871 CAGGTTGCATGGTAACTTTGTGG - Intronic
981006189 4:139878116-139878138 CAGGCTGGAGGGAAGGGTTCCGG - Intronic
986766476 5:10932612-10932634 AAGGCTGAGGGGTAGTTTTGTGG + Intergenic
987490780 5:18578223-18578245 CAGGCTGCACGGTAACTTGGTGG + Intergenic
988541806 5:32116800-32116822 CAGGCTGCAGTGTAGTAGTGTGG - Intergenic
989239707 5:39189780-39189802 CAGGCTTCACCGAAGGTTTGAGG - Intronic
993671174 5:90763668-90763690 GAGGCAGCAGGGTAGGAGTGGGG - Intronic
995255460 5:110040827-110040849 CAGGATGCTGGTGAGGTTTGGGG - Intergenic
996081784 5:119265664-119265686 CAGGCTGCAGGATGGCTTAGTGG + Intergenic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
998131180 5:139651720-139651742 CAGGTTGCAGGATAGGGTGGAGG + Intronic
998837449 5:146216700-146216722 CAGGCTGGAGGGTAGTGGTGTGG + Intronic
999928231 5:156403126-156403148 AAGGCGGCAGGGTGGGTTGGAGG - Intronic
1001519090 5:172378070-172378092 GAGGCTGCATGGTGGCTTTGTGG - Intronic
1001768305 5:174272689-174272711 CAGGCTGGGGGGAAGATTTGAGG - Intergenic
1001788020 5:174430627-174430649 CAGGCTCTAGGGGAGGTGTGGGG + Intergenic
1001965943 5:175910101-175910123 CAAGCTGCAGGGGAGGTGGGGGG - Intergenic
1002095031 5:176825558-176825580 CAGGATGCAGTGAAGGTTTCAGG + Intronic
1002251002 5:177929099-177929121 CAAGCTGCAGGGGAGGTGGGGGG + Intergenic
1002719475 5:181249115-181249137 CACGGTGCAGGCTAGGTTGGAGG + Intergenic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1004279640 6:14269824-14269846 CAGGCTGGAGGAGAGGTGTGGGG + Intergenic
1004811673 6:19269887-19269909 AAGGCTGCATGGTTGGCTTGGGG - Intergenic
1006341293 6:33448579-33448601 CAGGCAGCTGGGAAGGTCTGAGG - Intronic
1006672379 6:35737401-35737423 GACGCTGCAGGGTGGGCTTGAGG - Intronic
1006984974 6:38169998-38170020 CAGGGTGCTGGGTGGGTTGGAGG + Exonic
1007162219 6:39800855-39800877 CAGGCAGGAGGGCAGGTTGGAGG - Intronic
1007548250 6:42710020-42710042 CAGTCTGCAGGCTGGGCTTGCGG + Intronic
1007661589 6:43490086-43490108 CAGGCTGCGGGGAAGGATGGAGG - Intronic
1009957266 6:70470962-70470984 GAGACTGAAGGCTAGGTTTGAGG + Intronic
1011805154 6:91062934-91062956 CAGATTGTAGGGTATGTTTGTGG + Intergenic
1012949517 6:105503253-105503275 CAGGCTGCAGAGGAGGCTGGAGG - Intergenic
1015338185 6:132065885-132065907 GAGGATGCAGGGAAGGTTTGGGG + Intergenic
1017421045 6:154273610-154273632 TATGCGGCAGGGGAGGTTTGGGG + Intronic
1018577446 6:165274412-165274434 GAGGCTGCAGGGTAGAGGTGGGG + Intergenic
1018809284 6:167285721-167285743 CAGCCTGGAGGGTAGGTGGGGGG + Intronic
1019102478 6:169642506-169642528 GAGGCTGCAGGATAGATATGAGG + Intronic
1019701644 7:2477168-2477190 CAGGCTGTCGGGCAGCTTTGGGG + Intergenic
1021025197 7:15658237-15658259 CAGCCTGCAGGGGAGGTGGGAGG + Intronic
1021893088 7:25206430-25206452 CATGCCTCAGGGGAGGTTTGTGG - Intergenic
1022221593 7:28319394-28319416 CAAGTTGCAGGGTAGCTTTATGG + Intronic
1022806154 7:33824496-33824518 TAGGCTGCAGGGTAGGTGGCAGG - Intergenic
1023729114 7:43173506-43173528 CAGAGTCCAGGGTTGGTTTGGGG + Intronic
1024059690 7:45688434-45688456 TAGGGTGAAGGGTAGGTGTGAGG + Intronic
1025832201 7:65062169-65062191 CAGGCTGCAGAGCAGGGATGGGG + Intergenic
1025919879 7:65901598-65901620 CAGGCTGCAGAGCAGGGATGGGG + Intronic
1026602164 7:71785837-71785859 CAGGCAGCAGGGCAGGTAAGGGG + Exonic
1027787191 7:82594998-82595020 CAGACTGAAGGGTAGGACTGTGG + Intergenic
1027946256 7:84749205-84749227 CAGACTGAAGGGTAGGGTTATGG - Intergenic
1029532896 7:101137198-101137220 CAGGAAGCAGGGTAGGGTTATGG - Intronic
1031476665 7:122231067-122231089 CAGGCTGGAGTGTAGGGGTGTGG - Intergenic
1032192156 7:129771505-129771527 CAGGCTGCAGGGGAGGCATGGGG - Intergenic
1033572541 7:142646386-142646408 CAGGCTGCAGGGTGCGTTCTTGG - Intergenic
1033651874 7:143350153-143350175 GGGGTTGCAGGGTAGGTTGGGGG + Intronic
1034490788 7:151392185-151392207 CAGGCTGCAGCATAGGCTGGGGG - Intronic
1036645756 8:10610879-10610901 CAGGCTGCAGGGTGAGCCTGCGG - Exonic
1036648232 8:10625428-10625450 CAGGCTGGAGGGTGCGTGTGGGG + Intronic
1036691594 8:10948005-10948027 CAGGGTGCAGGGTGGGTTAGGGG + Intronic
1037771611 8:21804141-21804163 TAGGCAGCAGTATAGGTTTGTGG - Intronic
1037923281 8:22824400-22824422 CAGGCAGCAGTGTAGGGTTAGGG - Intronic
1038342824 8:26702019-26702041 CAGTCTGCTGGGTAGGTCTGTGG + Intergenic
1038434257 8:27523828-27523850 CAGTCTGCAGGGTAACTTTTTGG - Intronic
1039896347 8:41719361-41719383 CATCCTGCATGGTAGGTATGCGG - Intronic
1041080208 8:54208471-54208493 GTGCCTGCAGGGTAGGTTTCTGG + Intergenic
1045144673 8:99328041-99328063 CAGGCTGCATAGCAGGTTAGTGG + Intronic
1048037639 8:130692731-130692753 CAGGTTGTAGGGTATGTCTGCGG + Intergenic
1049020920 8:139957253-139957275 AAGGCTGCAGGGCAGGTACGCGG - Intronic
1049391304 8:142373017-142373039 CAGGCTGAGGGGTAGGATGGAGG - Intronic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049588367 8:143442172-143442194 CAGGATCCAGGGAAGGTATGGGG - Intronic
1050339325 9:4620179-4620201 GAGGCCACAGGGCAGGTTTGTGG - Intronic
1052097832 9:24406198-24406220 GAGGCTGCAGGATAGGATTGAGG - Intergenic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1053153586 9:35757654-35757676 AAGGGTGAAGGGTAGGTTTTAGG + Exonic
1056714995 9:89021503-89021525 CAGGTTTCAGGTTAGTTTTGTGG - Intronic
1057648219 9:96896979-96897001 CAGGTTGCAGGGTAGCTAGGTGG - Intergenic
1058853533 9:109036998-109037020 CAGGTCAGAGGGTAGGTTTGTGG + Intronic
1059723560 9:116984925-116984947 CAGGAAGCAGGATAAGTTTGGGG + Intronic
1060201274 9:121652787-121652809 CAGCCTGCAGGGTGGGAATGTGG - Intronic
1061177532 9:129006709-129006731 CAGGGTGCAGTGTAGGCTGGTGG - Exonic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG + Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062547934 9:137072092-137072114 CTGGAAGCAGGGTAGGTGTGGGG - Intergenic
1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG + Intergenic
1192209903 X:69121423-69121445 GAGGCTGCAGGGGATGTTGGGGG - Intergenic
1197388132 X:125826448-125826470 CAGGCTGCAGGGGTCCTTTGGGG + Intergenic
1197756865 X:130001749-130001771 GAGGCTGGAGAGGAGGTTTGAGG + Intronic
1198406251 X:136315545-136315567 GAGGCTGCAGAGCAGATTTGAGG - Intronic
1198603486 X:138310848-138310870 AAGACTGCAGGGTGGGTTGGAGG + Intergenic
1198776550 X:140185537-140185559 TAGGCTGCAGGGCAGCTTAGTGG - Intergenic
1198924810 X:141777587-141777609 AAGGCTGCAGAGTAGGTCTCAGG + Intergenic
1199164828 X:144659321-144659343 AATGCTGCAGGGAAGATTTGAGG + Intergenic
1199683233 X:150241919-150241941 CAGGCTACACAGTAAGTTTGAGG - Intergenic
1200037984 X:153345713-153345735 TAGGCTTCAGGTTAGGGTTGGGG + Intronic
1200283799 X:154801712-154801734 CAGGCTGGAGTGTAGGGGTGTGG - Intronic
1201471115 Y:14335949-14335971 CAGGGTAGAGGGTAGTTTTGGGG + Intergenic
1202507490 Y:25535504-25535526 CAGGCTGCAGCGTGGCTGTGAGG - Intergenic