ID: 1165422382

View in Genome Browser
Species Human (GRCh38)
Location 19:35728661-35728683
Sequence CCCGCTACTCCCTCTCTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165422382_1165422385 -5 Left 1165422382 19:35728661-35728683 CCACATAGAGAGGGAGTAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165422385 19:35728679-35728701 GCGGGTGTCATGGCGAGTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 45
1165422382_1165422386 -1 Left 1165422382 19:35728661-35728683 CCACATAGAGAGGGAGTAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165422386 19:35728683-35728705 GTGTCATGGCGAGTTCAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1165422382_1165422388 10 Left 1165422382 19:35728661-35728683 CCACATAGAGAGGGAGTAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165422388 19:35728694-35728716 AGTTCAGGCTGGTTTGTGGATGG 0: 1
1: 0
2: 0
3: 14
4: 190
1165422382_1165422387 6 Left 1165422382 19:35728661-35728683 CCACATAGAGAGGGAGTAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165422387 19:35728690-35728712 GGCGAGTTCAGGCTGGTTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1165422382_1165422389 11 Left 1165422382 19:35728661-35728683 CCACATAGAGAGGGAGTAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165422389 19:35728695-35728717 GTTCAGGCTGGTTTGTGGATGGG 0: 1
1: 1
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165422382 Original CRISPR CCCGCTACTCCCTCTCTATG TGG (reversed) Intronic
901884947 1:12216209-12216231 CCCGCTAGTGCCTCTCCTTGTGG + Intergenic
905569550 1:38992350-38992372 CCCTCTACTCCTGCGCTATGAGG - Intronic
913199436 1:116484121-116484143 CCCGCTGCTCCATGTCTAGGTGG + Intergenic
923144053 1:231185503-231185525 CCCACTTCTCACTCTCGATGTGG - Intronic
1063322883 10:5068690-5068712 CCTGCCACCCCCTCTCCATGGGG - Intronic
1063746403 10:8888461-8888483 CCACCTTCTCCCTCTCCATGCGG - Intergenic
1067883044 10:50063286-50063308 CCCCCTACTCCCCGTCAATGAGG + Intergenic
1068276670 10:54808369-54808391 CTCTGTATTCCCTCTCTATGTGG - Intronic
1077477297 11:2796552-2796574 CCCGACACACCCTCTCCATGGGG + Intronic
1078409881 11:11105709-11105731 GCTGCTACTCTCTGTCTATGGGG + Intergenic
1086197406 11:84157388-84157410 CCTGCTACTCCCTATCTGAGAGG + Intronic
1099888053 12:88556110-88556132 CCTGCTACTTCCTCTCTCAGGGG - Intronic
1099995843 12:89777677-89777699 CCTTCTAGTCCCTCTCTATGGGG + Intergenic
1100365867 12:93919860-93919882 ACTGCTACTCCCTCTCTTTGAGG - Intergenic
1101806967 12:108072545-108072567 CCTGCTCCTCCCTCCCCATGGGG + Intergenic
1102883775 12:116506596-116506618 GCTGCTACTCTCTGTCTATGGGG + Intergenic
1103984974 12:124760943-124760965 CCCGCTCCACACTCTCTATGGGG - Intergenic
1105284355 13:18992575-18992597 AACGCTAAGCCCTCTCTATGAGG - Intergenic
1108594176 13:51935990-51936012 CCCGCTCCTCCCACTCCTTGTGG - Intronic
1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG + Intronic
1118074339 14:62281900-62281922 CCCACTCCTCCCTCTCTCTCTGG + Intergenic
1123106704 14:105845172-105845194 CCCTCCGCTCCCTCTCTCTGAGG - Intergenic
1123574515 15:21653912-21653934 AGTGCTTCTCCCTCTCTATGGGG - Intergenic
1123862971 15:24486847-24486869 CCCTCCGCTCCCTCTCTGTGGGG + Intergenic
1124439857 15:29677982-29678004 CCCGCGGCTCCCTCTGCATGGGG - Intergenic
1127354828 15:58188324-58188346 CCCTCAACTCCCTCACTGTGGGG + Intronic
1128808994 15:70556248-70556270 CCCGCTGCTCCCACTCTCTCAGG + Intergenic
1128868428 15:71134228-71134250 CCAGCTGCTCCCTGCCTATGAGG - Intronic
1128941363 15:71790440-71790462 CCTGCTTCTTCCTCTCCATGTGG + Intergenic
1132157746 15:99508372-99508394 TCCCCTACTCCCTCTGAATGTGG + Intergenic
1134066713 16:11233112-11233134 CCCCCTCCTCCCTCTTCATGGGG + Intergenic
1135334915 16:21593144-21593166 GCTGCTACTCTCTCCCTATGGGG + Intergenic
1136088695 16:27903316-27903338 CCCACTTCTCTCTCTCTGTGTGG - Intronic
1137589135 16:49682708-49682730 CCTGCTACTCCCTGACTGTGTGG + Intronic
1138186203 16:54979488-54979510 CCCGCTCCTCCCCCTCCCTGTGG - Intergenic
1138481431 16:57305815-57305837 CCCTCTACTCCCTGCCTATCAGG - Intergenic
1143863685 17:9908916-9908938 CCCCCTTTTCCCTCTCAATGCGG - Intergenic
1160832619 19:1110772-1110794 CCCGCTTGTCCATCTCGATGAGG + Exonic
1161011822 19:1963143-1963165 CACGTTACTCCCTGTCTCTGTGG - Intronic
1163009157 19:14413846-14413868 CCAGCTTCTCCCACTCTCTGTGG + Intronic
1164427648 19:28156599-28156621 CTCGCCACTCACTCTCTCTGTGG + Intergenic
1164939612 19:32242742-32242764 CCCAGTGCTCTCTCTCTATGGGG - Intergenic
1165422382 19:35728661-35728683 CCCGCTACTCCCTCTCTATGTGG - Intronic
1168402421 19:56093061-56093083 TCCGCTACCCCGTGTCTATGGGG - Intronic
925123454 2:1437451-1437473 CCCGCTGATCCCTCTCTCGGGGG - Intronic
926339309 2:11891730-11891752 CCCCCTGCTCCCTCCCCATGAGG - Intergenic
928398803 2:30963454-30963476 GCCGCTCCTCCACCTCTATGTGG - Intronic
931581073 2:63775407-63775429 ACTGCTCCTCCCTCTTTATGAGG + Intronic
931671674 2:64653674-64653696 TCAGCTACTCCCGCTCCATGCGG + Exonic
936089323 2:109490784-109490806 CCTGCATCTCGCTCTCTATGGGG - Exonic
938422423 2:131155525-131155547 CCCGCTACTTCCGCTCTCTGCGG + Intronic
939875984 2:147578246-147578268 CCCACCAGTCCCTTTCTATGGGG - Intergenic
942401990 2:175612667-175612689 CCAGCTGCTCCCTCTATCTGTGG - Intergenic
946183722 2:217964965-217964987 ACCCCTGCTCCCTCTCTCTGGGG - Intronic
946952981 2:224897575-224897597 CCTTCTACTCCCTTTCTCTGTGG + Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG + Intronic
1174228591 20:49025336-49025358 CCTGATCCTCCGTCTCTATGTGG - Exonic
1174536147 20:51253108-51253130 ACTGCTACTGCCTCTCTGTGGGG - Intergenic
1181376774 22:22465067-22465089 AGCCCTTCTCCCTCTCTATGGGG - Intergenic
1182466009 22:30516716-30516738 GCTGCTACTCCCTGCCTATGGGG - Intergenic
1183722084 22:39568560-39568582 CCCGCTCTTCCCTCTCACTGGGG - Intergenic
1184750793 22:46485370-46485392 CCCCCAACTCCCTCTCCCTGAGG + Intronic
949359547 3:3216984-3217006 CCCGCAACTGCCTCCCTGTGAGG + Intergenic
950689897 3:14647331-14647353 CCCTCCCGTCCCTCTCTATGAGG + Intergenic
956483499 3:69696764-69696786 GCCGCTACTCTCTGCCTATGGGG + Intergenic
956620257 3:71214736-71214758 CCCGCTCCTCTCTCTCTTTTGGG - Intronic
960642096 3:119835174-119835196 TCCCCTACTCCCACTCTATGAGG + Intronic
964511105 3:157452912-157452934 TCCTCTACTCCCAATCTATGTGG + Intronic
965062022 3:163796108-163796130 CCCGCTTCTGCCTCTCAAAGTGG + Intergenic
969129634 4:4982039-4982061 CCCCTAACTCCCTCTCTGTGTGG + Intergenic
974424475 4:61723427-61723449 GCCCCCACTCCCTCTGTATGGGG - Intronic
976052456 4:81025274-81025296 CCAGCCACTCCCTCTCCAGGTGG + Intergenic
976367736 4:84248653-84248675 CCAGCAACACCCTCTGTATGTGG + Intergenic
982751662 4:159169182-159169204 CCCTCAACTCCCAATCTATGTGG + Intronic
982924794 4:161321800-161321822 CCTGCTGCTCCCACTCTGTGAGG + Intergenic
986735313 5:10663582-10663604 TCTGCTCCTGCCTCTCTATGGGG - Intergenic
1013906055 6:115221300-115221322 CCCCTTTCTCCCTCTCTCTGTGG - Intergenic
1019578741 7:1749851-1749873 CCCGCTGCTCCCTTTCACTGAGG + Intergenic
1021280145 7:18707117-18707139 CCAGTTCCTCCCTCTCTTTGTGG - Intronic
1033125686 7:138705223-138705245 CCCGTTACTCCCTGGCTCTGTGG - Intergenic
1039396206 8:37227425-37227447 CCCACCTCTCCCTCTCTCTGTGG + Intergenic
1044926115 8:97210154-97210176 CCCCCAACTCCCTCTCAGTGAGG + Intergenic
1049461056 8:142728003-142728025 CCCGCCCCTCCCTCTCTACCGGG + Intronic
1049617496 8:143582068-143582090 CCCGGGGCTCCCTCTCTGTGGGG + Intronic
1056125602 9:83534187-83534209 CCCTTTACTCCCTGTCTATTTGG + Intronic
1056224622 9:84482995-84483017 CCCCTTTCTCCCTCTCTGTGGGG - Intergenic
1058983030 9:110187804-110187826 CCTACTACCCCCTCTTTATGGGG - Intergenic
1186971620 X:14851468-14851490 CCCTATACTGCCTCTCCATGTGG + Intronic
1187825105 X:23327334-23327356 CCCTCTACTGCATCTATATGAGG - Intergenic
1193444184 X:81578743-81578765 CCCTTTTCTCCCTCTCTAAGTGG - Intergenic
1195492549 X:105488323-105488345 TCCTCTAGTGCCTCTCTATGTGG - Intronic
1195643583 X:107204424-107204446 CCCGCTACTTCCTCTACCTGGGG + Intronic