ID: 1165422714

View in Genome Browser
Species Human (GRCh38)
Location 19:35730300-35730322
Sequence AGTGAGGTGGCTGCATTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165422714_1165422726 16 Left 1165422714 19:35730300-35730322 CCCACCAATGCAGCCACCTCACT 0: 1
1: 0
2: 0
3: 26
4: 241
Right 1165422726 19:35730339-35730361 CAGGAAATTGTGAACCCCGATGG 0: 1
1: 0
2: 0
3: 8
4: 69
1165422714_1165422719 -3 Left 1165422714 19:35730300-35730322 CCCACCAATGCAGCCACCTCACT 0: 1
1: 0
2: 0
3: 26
4: 241
Right 1165422719 19:35730320-35730342 ACTTTGCCACCCCCTCTTCCAGG 0: 1
1: 0
2: 2
3: 33
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165422714 Original CRISPR AGTGAGGTGGCTGCATTGGT GGG (reversed) Intronic
900701317 1:4050176-4050198 AGAGACGTGGGTGCATGGGTGGG + Intergenic
900942010 1:5805099-5805121 GGTGAGGTGGCTCCATTTGAAGG - Intergenic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
903003212 1:20281390-20281412 AGTTGGGTGGTGGCATTGGTGGG - Intergenic
903142481 1:21347277-21347299 GGTGAGGAGGCTGTAGTGGTGGG + Intergenic
903295897 1:22342911-22342933 AGTGGGAGGGCTGCATGGGTGGG + Intergenic
903578726 1:24355360-24355382 AAAGAGATGGCTACATTGGTCGG + Intronic
907428538 1:54396881-54396903 ATTAAGGTGGCTGCACTGCTCGG + Intronic
910048957 1:82954742-82954764 AATGAAGTGGCTGTAATGGTTGG + Intergenic
911357509 1:96840556-96840578 AGTGTGGTGGCTGAATTGAAAGG - Intergenic
911675642 1:100655509-100655531 AGAGGAGTGGCTGCATTGCTGGG + Intergenic
912690017 1:111797901-111797923 AGTGTGGTGGATGTATTGGATGG + Intronic
915107653 1:153544532-153544554 AGTGGGGTGGCTGCCTGGGGTGG - Intronic
915321792 1:155060533-155060555 TGTGGGGTGGCTGGATTGCTAGG + Intronic
915854774 1:159371280-159371302 ACTGAGTTGGCTGAAATGGTAGG + Intergenic
915943792 1:160135602-160135624 GGTGAGGAGGCTGCATGGGTTGG + Exonic
917003816 1:170389042-170389064 GGTAAGGTGGCTGCACTGCTGGG + Intergenic
917974895 1:180232186-180232208 AGTGAGGAGACTGCATGAGTGGG + Intronic
919621386 1:199867865-199867887 AGTGAGATGGCTGTCTGGGTAGG - Intergenic
919845799 1:201641427-201641449 AGTGAGATGGGAGCCTTGGTAGG - Intronic
919918760 1:202155507-202155529 AGTGGCCTGGCTGCAGTGGTGGG - Intronic
920342936 1:205286931-205286953 AGTGAGGTGTCTGCAGTCTTGGG - Intergenic
920452950 1:206073989-206074011 AGTGATGAGGCTGCAAAGGTGGG - Intronic
921085792 1:211791431-211791453 AGTGAGATGGCTTCAGTGGAGGG - Intronic
921453341 1:215336583-215336605 AGTGAGGTTGCTGCACTGCATGG + Intergenic
922074061 1:222225070-222225092 ATCGAGGTGGCTGCAGTGGCTGG - Intergenic
922114284 1:222595621-222595643 AGTGAAGTTGCTGCACTGCTGGG + Intergenic
1062951259 10:1505645-1505667 GGGGAGGTGGCTGCCATGGTGGG - Intronic
1064611988 10:17113378-17113400 ACTGTGCTGGGTGCATTGGTAGG - Intronic
1065514005 10:26506722-26506744 AGAGATGGGGATGCATTGGTGGG - Intronic
1067421510 10:46154963-46154985 AGTGAGGTGTGTGCATTACTTGG - Intergenic
1067506816 10:46861056-46861078 AGTGAGGTGTGTGCATTACTTGG - Intergenic
1067557359 10:47282309-47282331 AGGAAGGGGGCTGCATTGGGAGG - Intergenic
1068827983 10:61461135-61461157 AGTGAAGTGTGGGCATTGGTTGG + Intergenic
1068859960 10:61838042-61838064 AGTAAGGGGGCTGCATTGAGTGG + Intergenic
1069080520 10:64083653-64083675 ATTGAAGTAGCTGCATTTGTAGG - Intergenic
1069759535 10:70799136-70799158 AGTGAAGTGGCTTCATTGTCTGG - Intergenic
1070797105 10:79223240-79223262 AGTGAGCAGGCAGGATTGGTGGG + Intronic
1070859000 10:79634102-79634124 AGTGAGGTGTGTGCATTACTTGG - Intergenic
1072231184 10:93415190-93415212 AGTGGGGTGGTTGCAGTGTTAGG - Intronic
1073067700 10:100773344-100773366 AGTGAGGTGGCAGCATTTACTGG - Intronic
1073559850 10:104487356-104487378 AGTGAGGAGGGTGGATTGGAGGG + Intergenic
1074619946 10:115108272-115108294 AGTGAAGTGGCTACATTGTCTGG + Intronic
1074766180 10:116701723-116701745 TGTGAAGTGACTGCGTTGGTTGG + Intronic
1076147220 10:128132741-128132763 AGTGAGATGGATAGATTGGTAGG - Intergenic
1077028782 11:453898-453920 AGTGAAGTGGCTGAATTGCCAGG + Intronic
1078074001 11:8140662-8140684 AGTGAGGTGGCAGCAGTGGAGGG - Intronic
1078438320 11:11343947-11343969 AGGGAGGTGGCTGCAGGGATGGG - Intronic
1078455695 11:11473043-11473065 AGTGAGGTGGGTGCTGTGGATGG - Intronic
1079340860 11:19610826-19610848 ATGGAGGTGGATGAATTGGTGGG + Intronic
1082798566 11:57396413-57396435 AGTGAGGTGGCAGCAGAGATAGG - Intronic
1084020775 11:66416440-66416462 AGTGATATGGCTGCAGTGGCTGG + Intergenic
1084297159 11:68220245-68220267 ACTGAGGTGGCTGAAATGGGAGG - Intergenic
1085187518 11:74589052-74589074 AATGAGGTGGCTACATTGTCTGG - Intronic
1087559899 11:99774914-99774936 AGTGATTTGGCTGCATTTATAGG + Intronic
1087623365 11:100567687-100567709 GATGATGTGGCTTCATTGGTGGG - Intergenic
1087654028 11:100901634-100901656 AGTGAGGTGGCAGCCTGGCTGGG - Intronic
1087780934 11:102301082-102301104 AGTGAGGTGGCAGCCTGGCTGGG - Intergenic
1087891970 11:103545652-103545674 AGAGTGGTGGCTGCAATGGCTGG - Intergenic
1088313003 11:108479980-108480002 AGTTAGCTGGCTGCAGTGGTGGG - Intronic
1088563167 11:111136113-111136135 AGTAAGGACGCTGCACTGGTTGG + Intergenic
1088790588 11:113222796-113222818 AGTGAGGTGTCTGCTTTCATGGG - Intronic
1089710789 11:120313046-120313068 AATGAGGAGGCTGGAATGGTAGG + Intronic
1091161057 11:133420957-133420979 AGTCAGGTGGGTGCATGGCTGGG + Intronic
1091349059 11:134878454-134878476 AGAGAGGTGGCGGCAGTGGTGGG - Intergenic
1096115718 12:49053977-49053999 AGTGAGGGGGCTGCATATCTGGG - Exonic
1096611972 12:52808029-52808051 AGTCTGGTGGAGGCATTGGTGGG - Intronic
1097509066 12:60513468-60513490 AGTGAGATTGCTGGATTGTTTGG - Intergenic
1097955194 12:65477996-65478018 AGTGAGGGGGCTGCCTTGGCTGG - Intronic
1100003380 12:89864578-89864600 ACTGAAGTGGCTCCATTGGTTGG + Intergenic
1100162631 12:91878026-91878048 AGTGAGGTGGCTGCTAAGGGAGG - Intergenic
1100305053 12:93342660-93342682 ATTGAGGTGTCTGCAGAGGTTGG - Intergenic
1100367674 12:93936585-93936607 AGTGAGGTCGCTGGGTTGATGGG - Intergenic
1101032271 12:100672131-100672153 AGGGAGGTGGCCGCAGTGGTGGG + Intergenic
1101228413 12:102713377-102713399 ATTGTGGTGCCAGCATTGGTAGG + Intergenic
1102433096 12:112898761-112898783 AGGGAGGTGGTTACATTTGTCGG - Exonic
1102506088 12:113385314-113385336 AGTGAGGTGGATGCCCTGGAGGG - Intronic
1102968713 12:117149020-117149042 AGGGAGGTGGCAGCAGTGGGTGG - Intronic
1102992907 12:117327651-117327673 AGTGAGGTAGATGCATGCGTGGG - Intronic
1103419801 12:120771294-120771316 AGTGAGGAGGCTGCTGTGGCTGG - Intronic
1105387389 13:19943970-19943992 GGAGATGGGGCTGCATTGGTGGG + Intergenic
1106004725 13:25757977-25757999 ATTGTGGTGGCTTCATGGGTGGG - Intronic
1109358587 13:61267063-61267085 AGTGAGGTGGCAGCCTGGCTAGG + Intergenic
1109909243 13:68888910-68888932 ACTGGGGTGGGTGCTTTGGTGGG + Intergenic
1109910430 13:68904387-68904409 AGTGAGGTGTCTGACATGGTGGG - Intergenic
1113567508 13:111327569-111327591 AGGGATGTGGCTGCCTTGATCGG - Intronic
1116868587 14:50051079-50051101 ACTAAAGTGGCTGCATTGATTGG + Intergenic
1118083924 14:62393942-62393964 AGAGATGTGGCTGCACTGCTGGG + Intergenic
1119610429 14:76057095-76057117 AGTGAGGTGGGAGAATGGGTAGG - Intronic
1121093508 14:91199696-91199718 GGAGAGGTGGCTGCTTTGCTGGG - Intronic
1121456668 14:94042946-94042968 GGTGAGGTGCCTGGATTGGAGGG - Intronic
1122044086 14:99011116-99011138 AGAGGGGTCTCTGCATTGGTGGG + Intergenic
1123147331 14:106145817-106145839 AGGGAGGTGGCAGCAGTGCTAGG - Intergenic
1123417552 15:20104178-20104200 AGTGGGTTGGCTGCCTTGGCTGG + Intergenic
1123526926 15:21111456-21111478 AGTGGGTTGGCTGCCTTGGCTGG + Intergenic
1124462490 15:29905480-29905502 AGTGTGATGGCTGGATGGGTTGG - Intronic
1125185547 15:36925458-36925480 GGTGAGGCGGCTGCTTTGTTTGG + Intronic
1125493182 15:40164325-40164347 ACTGAGGTGGGAGCATTGCTTGG - Intronic
1126066910 15:44832858-44832880 AGTGAGCTGGCTCCCTGGGTTGG + Intergenic
1126092923 15:45067690-45067712 AGTGAGCTGGCTCCCTGGGTTGG - Intronic
1126166021 15:45654602-45654624 AGTGAAGTGGCTACATTGACTGG + Intronic
1126173550 15:45714496-45714518 AGGGAGGAGGCTGCGTTGATTGG - Intergenic
1126645556 15:50871682-50871704 AGAGAGGTGGCTGCAGTGATAGG + Intergenic
1130159987 15:81389167-81389189 AGTGAGGTGACTGCTGTGATGGG + Intergenic
1130711548 15:86286881-86286903 AGTGAGATGGCTGGATTGTATGG + Intronic
1132211954 15:100030435-100030457 CGTGAGGAGGTTGCATTTGTGGG - Intronic
1132312355 15:100866450-100866472 AGTCAGGTGGCGGCAGTGGCTGG + Intergenic
1132853020 16:2033269-2033291 AGTGGGGTGGCAGCCTGGGTCGG + Intronic
1134663631 16:16003106-16003128 AGACAGGTGGATGGATTGGTTGG + Intronic
1136691601 16:32035371-32035393 AGGGAGGTGGCAGCAGTGCTGGG + Intergenic
1136792190 16:32978936-32978958 AGGGAGGTGGCAGCAGTGCTGGG + Intergenic
1136877627 16:33874972-33874994 AGGGAGGTGGCAGCAGTGCTGGG - Intergenic
1137471074 16:48759113-48759135 TGTGAGGTGGCAGCCTTGCTGGG + Intergenic
1138193087 16:55032522-55032544 AGTGAGGTGGCAGCCTTGGGTGG + Intergenic
1138295107 16:55879036-55879058 AGTGATGTGGGTGCAGTGATGGG - Intronic
1138677027 16:58658828-58658850 AGTGTGGTGGCTGCATTCTTGGG - Intergenic
1139187468 16:64823690-64823712 AGTGAGGTGGCTTCTTTGTGGGG - Intergenic
1139560676 16:67739814-67739836 AGAGAAGTGGCTGCATTTCTAGG + Intronic
1203094397 16_KI270728v1_random:1240400-1240422 AGGGAGGTGGCAGCAGTGCTGGG + Intergenic
1144838523 17:18171336-18171358 AGTGAGTTAGCGGCATGGGTTGG - Intronic
1150857738 17:68769241-68769263 AATTAGGTGGGTGCAGTGGTGGG - Intergenic
1151378253 17:73706690-73706712 AGTGAGGCGGCTGCTGTGGGAGG - Intergenic
1153345032 18:4016413-4016435 AGAGAAGTGGCTGGATGGGTAGG + Intronic
1153520376 18:5947130-5947152 AGTGAGGTGTCTGCTTGGTTTGG + Intergenic
1154440055 18:14381653-14381675 AGTGATGTAGCTGGATTGTTGGG - Intergenic
1155787763 18:29922946-29922968 ACTGAGGTGGCTGGGGTGGTAGG + Intergenic
1157128556 18:44981213-44981235 AGTGAGCTGGCTGCAGTTTTGGG - Intronic
1157186275 18:45542759-45542781 AGTGAGGTTTCTGCAGTGGAAGG + Intronic
1157586653 18:48805383-48805405 AGTGAGGGGGCTTCACTGGTGGG + Intronic
1157611445 18:48958921-48958943 AGTGAGGTCCCTGCAGTGGGTGG + Intergenic
1157881800 18:51327978-51328000 AATTAGGTGGCTGCGGTGGTGGG - Intergenic
1160687687 19:444287-444309 ACTGAGGAGGCAGCTTTGGTGGG + Intronic
1160818653 19:1047795-1047817 ATGCAGGTGGCTGCATTGGAGGG + Intronic
1161576484 19:5057266-5057288 TGTGTGTTGGCTGCATTGGAAGG + Intronic
1162348735 19:10136302-10136324 AGTGATGAGGCTGCAGTTGTGGG + Intronic
1162764747 19:12912084-12912106 AGTTAGCTGGGTGCAGTGGTGGG - Intronic
1163007200 19:14404504-14404526 GCTCAGGTGGCTGCATTGGCAGG - Exonic
1163549477 19:17957620-17957642 AGTGAGGAGGCTGCTGTGGCTGG + Intronic
1165061632 19:33207707-33207729 AGCCAGCTGGCTGCACTGGTGGG + Exonic
1165068692 19:33242959-33242981 GGTGAGGTGGCAGCTTTGGTGGG + Intergenic
1165422714 19:35730300-35730322 AGTGAGGTGGCTGCATTGGTGGG - Intronic
1166293271 19:41877057-41877079 TGAGAGGTGGCTGCTTGGGTGGG - Intergenic
1168372716 19:55849659-55849681 AATGAGTTGGCTACATTTGTGGG + Intronic
925132271 2:1502536-1502558 AATGAGCTGGGTGCAGTGGTGGG - Intronic
925317105 2:2934851-2934873 AGTCAGGTGGCTGCAGTGCTGGG - Intergenic
926175178 2:10584443-10584465 AGTGAGCTGTCTGCGTTGCTTGG - Intronic
930154209 2:48089085-48089107 AGTGAGGGGGCAGCAGGGGTGGG + Intergenic
931153668 2:59603635-59603657 AGTGAGGGTGCTGCTTTGCTAGG + Intergenic
931791668 2:65669136-65669158 AGTGAAGTCGCTTCCTTGGTTGG - Intergenic
931825414 2:65995401-65995423 AGAGAGGAGGCTGGCTTGGTAGG - Intergenic
932302099 2:70674736-70674758 AGTGAGTTGGCTGAAGGGGTTGG + Exonic
932334608 2:70922833-70922855 AGAGAGGAGGCTGCAGTGGCAGG + Intronic
933692308 2:85189030-85189052 AGTCAGGTGGCTACTTTGGAAGG - Intronic
935107853 2:100062228-100062250 AGTAAGGTGGCTGCAGTTGGAGG + Intronic
935606141 2:104973914-104973936 AGTATGGTGCCTGCAATGGTAGG + Intergenic
936602992 2:113918100-113918122 AGTGAGGAGGCTGTATAGGTAGG + Intronic
937027306 2:118710366-118710388 AGTGTGGAGTCTGGATTGGTTGG + Intergenic
937915210 2:127095528-127095550 AGTGTGGGGGCTGCCTTTGTTGG - Intronic
940261986 2:151790561-151790583 AGTGAGGTGGCAGTAGTAGTAGG - Intronic
941110534 2:161415558-161415580 CCTGAGGTGGGTGGATTGGTGGG + Intergenic
943441826 2:187935000-187935022 AGTGAGCTGGCTGCTGTGGTGGG + Intergenic
943786083 2:191880536-191880558 AGAGAGGTGGCTGCACTTGCTGG + Intergenic
947642998 2:231717417-231717439 GGTGCCCTGGCTGCATTGGTTGG + Intergenic
947701135 2:232234967-232234989 GGGGAAGTGGCTGCACTGGTTGG + Intronic
948593842 2:239067322-239067344 AGTGATGTGGGTGCAGTGGCGGG - Intronic
948858102 2:240740027-240740049 GGTGTGGGGGCTGCCTTGGTGGG - Intronic
1169724517 20:8714483-8714505 AGAGAAGTGGCTGATTTGGTAGG - Intronic
1170988099 20:21276686-21276708 AGTGTGCTGGCTGCTCTGGTGGG - Intergenic
1172125153 20:32621223-32621245 GGGGAGGAGGCTGGATTGGTGGG + Intergenic
1173002006 20:39111532-39111554 AGGGAGGAGGGTGCATTGGAGGG + Intergenic
1174124096 20:48290003-48290025 CGTGAAGTGGATGCAATGGTTGG - Intergenic
1174403389 20:50288439-50288461 AGTGAGGCGGGAGCATTGGAGGG + Intergenic
1174411499 20:50339581-50339603 AGTCAGGAGGCTGGATTGCTGGG - Intergenic
1174438146 20:50526726-50526748 AGTGAGGAGGCTGCGGTGGGGGG - Intronic
1175952484 20:62590832-62590854 AGTGTGGTGGCTGCATGTGGAGG + Intergenic
1176455690 21:6908118-6908140 AGTGATGTGGCTGGATTGTTGGG + Intergenic
1176833863 21:13773166-13773188 AGTGATGTGGCTGGATTGTTGGG + Intergenic
1179313682 21:40221239-40221261 AGTGTGGTGGTGGCATGGGTGGG - Intronic
1180554760 22:16564980-16565002 GGTGAGTTGGCTGGCTTGGTTGG - Intergenic
1180847135 22:18989928-18989950 AGAGAGCTGGCTGCAATGGAGGG - Intergenic
1181315278 22:21967065-21967087 GGTGACCTGGCTGCATGGGTTGG - Intronic
1181446771 22:22982602-22982624 AGTGAAATGGCTACATTGTTTGG - Intergenic
1182832260 22:33313628-33313650 AGGGAGGGGGCTGCATGGCTAGG + Intronic
1183736419 22:39647230-39647252 AGTGATGTGGCTGCAGTGGGGGG - Intronic
1184530538 22:45052423-45052445 AGGGAGGGGACTGCATTGCTGGG + Intergenic
1185119540 22:48957778-48957800 AATGTGGTGGCTGCAGTGCTGGG - Intergenic
1185312383 22:50163212-50163234 AGTGAGGAGGCTGCCCTGGAGGG + Intergenic
950670160 3:14521150-14521172 AGTGAGGAGGCTGCCGTGGTTGG - Intronic
954905694 3:54060876-54060898 AGAGAGATGGCTGCATTCGTGGG + Intergenic
955231053 3:57098931-57098953 AGTGAGGTGCCTAGATTGGAGGG + Intronic
956419622 3:69073517-69073539 AGAAAGGTGTTTGCATTGGTGGG - Intronic
956959627 3:74383592-74383614 ACTCAGGTGGCTGCAGTGGGAGG - Intronic
958827938 3:99054737-99054759 AGAGAGATGGCTGGATTGATAGG + Intergenic
961453965 3:127015274-127015296 AGTGATGTGGCTGTGTCGGTCGG + Exonic
961619046 3:128208752-128208774 AGTGAGATGGCCACATTGGGAGG + Intronic
962342915 3:134600439-134600461 AGTGAGGAGGCTGTCCTGGTAGG + Intronic
963935717 3:151051114-151051136 AGAGAGGTGGCTGAGTTTGTTGG + Intergenic
963995694 3:151705794-151705816 AGGTAGGTGGCTGCATTCGACGG - Intergenic
964432725 3:156623241-156623263 AGTGAGATGGGTGCATTCATGGG + Intergenic
965147744 3:164928050-164928072 AGTGAGGTGGCAACATCTGTGGG + Intergenic
965872962 3:173282015-173282037 AGTGAGATTGCTGAATTGATTGG - Intergenic
966544573 3:181131365-181131387 AGTGAGGTTGCTGGATTGTATGG + Intergenic
968586416 4:1418766-1418788 AGTGAGGAGGCTGAAGTGGGAGG - Intergenic
968938859 4:3627653-3627675 GGTGAGGCGGCTGCACTGGCAGG + Intergenic
972017136 4:34261812-34261834 AGGAATGTGGCTGCATTGCTGGG - Intergenic
972605240 4:40607596-40607618 ATTCAGGAGGCTGCATTGGGAGG + Intronic
974596128 4:64016280-64016302 AGTGAGCTGGCTACATGGATTGG - Intergenic
977979534 4:103306236-103306258 AGTGAAGTGGCCTCATTGTTTGG + Intergenic
978711646 4:111789706-111789728 AGTGGGGTGGATGCAGGGGTCGG + Intergenic
981488867 4:145318542-145318564 AGTGATGTAACTGCAATGGTAGG - Intergenic
982759011 4:159258310-159258332 ACTCATGTGGCTGTATTGGTAGG + Intronic
983559826 4:169089430-169089452 AGTGAAGTGGCTACATTGTCTGG - Intergenic
987344969 5:16971080-16971102 AGTCAGGAGGCTGAAGTGGTAGG - Intergenic
987821340 5:22970410-22970432 AGTGTGGTGGCAGCAAGGGTGGG + Intergenic
988802014 5:34705026-34705048 GGTGAGGTGGGAGCATTGCTTGG - Intronic
989349914 5:40474475-40474497 TGTGAGGTGGCAGCCTTGTTGGG - Intergenic
989361653 5:40608251-40608273 AGTGTGGTGGCTAGATTAGTGGG + Intergenic
991476787 5:67029736-67029758 AGTGAGGTGGATGGAATAGTAGG + Intronic
993349634 5:86832902-86832924 AATGAAGTGCCTGCAATGGTTGG - Intergenic
993584609 5:89708719-89708741 AGTTATGGGGCTGCATAGGTGGG + Intergenic
995506783 5:112869143-112869165 AGTGAGGTTGCTGTGGTGGTTGG + Exonic
995589676 5:113686602-113686624 GGTGAGGGAACTGCATTGGTGGG + Intergenic
998160274 5:139809194-139809216 GGTGAGGTGGCTGCTTGGGCAGG + Intronic
999481823 5:151955532-151955554 AGTCATGTGGCAGTATTGGTGGG + Intergenic
1002207253 5:177571700-177571722 ACTCAGGAGGCTGCATTGGGAGG - Intergenic
1005491831 6:26354314-26354336 AGTGAGCTGGCTGCACTGACTGG - Intergenic
1007611859 6:43154887-43154909 AGAGAGGCGGCTGCAGTGGTAGG + Intronic
1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG + Exonic
1007679168 6:43622611-43622633 GGTGAGGTGGGTGCATGGGTTGG - Exonic
1011415706 6:87118155-87118177 GGTGAGGTGGCTGCCTTGTTAGG + Intergenic
1014544148 6:122713339-122713361 AGTGAGTCAGCTGCCTTGGTTGG + Intronic
1015123056 6:129722212-129722234 AGTAAGGAGGCTGCAATGATAGG + Intergenic
1016136431 6:140549559-140549581 AGTGAGATTGCTGCATTGTATGG + Intergenic
1017785596 6:157754497-157754519 AGTTGGGTGGCTGCATTTTTTGG + Intronic
1020541715 7:9467387-9467409 ACTGAAGTGGCTACATTGTTTGG + Intergenic
1022459640 7:30593388-30593410 AGTGGGGAGGATGAATTGGTCGG + Intergenic
1022489109 7:30803046-30803068 AGTGAGTTGGCTGGTTTGATTGG - Intronic
1022967551 7:35487526-35487548 AGGGAGGTGGCTGCATTAAACGG - Intergenic
1023636144 7:42212898-42212920 AATGAGGTGGCTCTATTGTTTGG - Intronic
1024894052 7:54236640-54236662 AGTGAGATGGCTGGATTGAATGG - Intergenic
1025783867 7:64626233-64626255 AGTGAAGTGGCTTCATTGTCTGG - Intergenic
1027801561 7:82758030-82758052 AGTGAGGTGGCTGTGTTCTTAGG - Exonic
1029501999 7:100937191-100937213 AGTGGGGTTGCTGGGTTGGTTGG + Intergenic
1032076622 7:128839014-128839036 AGTGACGGGGCTGTATGGGTGGG + Intronic
1035085635 7:156255101-156255123 AGTGAGGCGGCAGGATTGGGTGG - Intergenic
1036653351 8:10660016-10660038 GCTGAGGTGGCTGCTGTGGTTGG + Intronic
1037558087 8:20045795-20045817 AGTGAGATCGCTGCGTTGTTTGG - Intergenic
1047773718 8:128051224-128051246 AGTGAGGAGGTTGCATTATTGGG + Intergenic
1048273214 8:133045872-133045894 TGTGCTGTGGCAGCATTGGTGGG - Intronic
1054451883 9:65407667-65407689 GGTGAGGGGGCTGCACTGGCAGG - Intergenic
1055198306 9:73624941-73624963 AGTGAAGGGGCTGCATTGTCTGG - Intergenic
1056850883 9:90082601-90082623 AGAGAGGTGGATGGACTGGTGGG + Intergenic
1057389491 9:94630887-94630909 TGTCATGTGGCTGCCTTGGTGGG - Intronic
1058770344 9:108224972-108224994 AGTGAAAGGGCTACATTGGTAGG + Intergenic
1058982952 9:110186985-110187007 AATTAGCTGGATGCATTGGTGGG + Intergenic
1059206244 9:112468890-112468912 AGTGGGGTGGGTGGAATGGTAGG + Intronic
1061571220 9:131478515-131478537 AGTGAGGTGGGTTCTATGGTGGG + Exonic
1062732990 9:138119920-138119942 AGAGAGGTGGCTGGCTTGGTTGG - Intronic
1185522018 X:747518-747540 AGAGAGGTGGCCTCTTTGGTGGG - Intergenic
1186320024 X:8414080-8414102 AGTGAAGTGACTTCATTGGAAGG + Intergenic
1186870511 X:13766618-13766640 AGTGAGATGGCTGGAATGGCGGG + Intronic
1187632062 X:21184116-21184138 AGTGAGATGGCTGGATTGTTTGG + Intergenic
1189008067 X:37015302-37015324 ATGGAGGTGGGTGCATTGGTGGG - Intergenic
1189166197 X:38863529-38863551 ATTGAGGTGGTTGAAGTGGTAGG + Intergenic
1190961134 X:55249297-55249319 AGTGGGGTGGCTGGATTGTATGG - Intronic
1199580157 X:149352438-149352460 GTGGTGGTGGCTGCATTGGTGGG - Intergenic
1199771872 X:150980381-150980403 TGTGAGGAGCCTCCATTGGTAGG + Intergenic
1200403721 Y:2787029-2787051 GGTGAGCTGGCTGCGTTGATGGG + Exonic