ID: 1165424975

View in Genome Browser
Species Human (GRCh38)
Location 19:35740570-35740592
Sequence GGGAAAGCTGCGCTCCAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165424972_1165424975 -3 Left 1165424972 19:35740550-35740572 CCCGGAACTCATAGTCTAGCGGG 0: 1
1: 0
2: 6
3: 24
4: 173
Right 1165424975 19:35740570-35740592 GGGAAAGCTGCGCTCCAGTGCGG 0: 1
1: 0
2: 2
3: 14
4: 180
1165424974_1165424975 -4 Left 1165424974 19:35740551-35740573 CCGGAACTCATAGTCTAGCGGGA 0: 1
1: 0
2: 2
3: 5
4: 65
Right 1165424975 19:35740570-35740592 GGGAAAGCTGCGCTCCAGTGCGG 0: 1
1: 0
2: 2
3: 14
4: 180
1165424970_1165424975 7 Left 1165424970 19:35740540-35740562 CCGCAGTTTTCCCGGAACTCATA 0: 1
1: 0
2: 0
3: 13
4: 97
Right 1165424975 19:35740570-35740592 GGGAAAGCTGCGCTCCAGTGCGG 0: 1
1: 0
2: 2
3: 14
4: 180
1165424968_1165424975 22 Left 1165424968 19:35740525-35740547 CCGTGGTCATTGAGTCCGCAGTT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1165424975 19:35740570-35740592 GGGAAAGCTGCGCTCCAGTGCGG 0: 1
1: 0
2: 2
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165424975 Original CRISPR GGGAAAGCTGCGCTCCAGTG CGG Intronic