ID: 1165426188

View in Genome Browser
Species Human (GRCh38)
Location 19:35746681-35746703
Sequence CATGGGAAACAGAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 469}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165426188_1165426196 17 Left 1165426188 19:35746681-35746703 CCTTCCAGCTTCTGTTTCCCATG 0: 1
1: 0
2: 3
3: 64
4: 469
Right 1165426196 19:35746721-35746743 AGCTGTGGGCTTCCTCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 252
1165426188_1165426195 16 Left 1165426188 19:35746681-35746703 CCTTCCAGCTTCTGTTTCCCATG 0: 1
1: 0
2: 3
3: 64
4: 469
Right 1165426195 19:35746720-35746742 CAGCTGTGGGCTTCCTCTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 241
1165426188_1165426193 2 Left 1165426188 19:35746681-35746703 CCTTCCAGCTTCTGTTTCCCATG 0: 1
1: 0
2: 3
3: 64
4: 469
Right 1165426193 19:35746706-35746728 AGATGTCTGGCGCTCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1165426188_1165426194 3 Left 1165426188 19:35746681-35746703 CCTTCCAGCTTCTGTTTCCCATG 0: 1
1: 0
2: 3
3: 64
4: 469
Right 1165426194 19:35746707-35746729 GATGTCTGGCGCTCAGCTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165426188 Original CRISPR CATGGGAAACAGAAGCTGGA AGG (reversed) Intronic
900202432 1:1415894-1415916 TTTGGGAGACGGAAGCTGGATGG + Intergenic
900483917 1:2912585-2912607 CCTGGGAAAAAGCAGCTGGTGGG - Intergenic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
900828871 1:4949639-4949661 CATGGAAATGGGAAGCTGGAAGG - Intergenic
900961399 1:5923370-5923392 GCTGGGAAACAGAAGAGGGAAGG + Intronic
900992037 1:6102538-6102560 CATGGGAGCCAGAAGCCAGATGG - Exonic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902828227 1:18992089-18992111 CAAGGGCAGCTGAAGCTGGAAGG - Intergenic
904811228 1:33164651-33164673 CATGGGATACAGACTCTGAAAGG - Intronic
905011924 1:34753423-34753445 CATTGTAAACAGAAGCTTGCAGG + Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
907814232 1:57902503-57902525 AATGGGAAAGAGATGCTGAAAGG - Intronic
910808020 1:91207980-91208002 GTTGGGAGACAGAAGCTAGATGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911266586 1:95751762-95751784 CATGGGAAACAGAAGATGATAGG - Intergenic
912654798 1:111476725-111476747 CTGGGGAAACTTAAGCTGGAAGG + Intronic
912980359 1:114365607-114365629 GTTGGGAGACGGAAGCTGGATGG + Intergenic
912989270 1:114468047-114468069 AATAGGAAAAAGAAGCTGGATGG + Intronic
913117263 1:115708885-115708907 AATCGGCAACAGGAGCTGGAAGG - Intronic
913120619 1:115737286-115737308 CATGGGAGACAGAAAATGAATGG + Intronic
914704789 1:150161731-150161753 CAGGGGAGCCAGAAGATGGAGGG + Intronic
915408270 1:155679295-155679317 CATCAGTAACAGAAGCTGGCTGG + Intronic
915596318 1:156898308-156898330 CTCAGGAAACAGAAGCTAGAGGG - Intronic
915733799 1:158072069-158072091 CAAGGGAAACAGGCTCTGGACGG - Intronic
916204068 1:162298280-162298302 CATGGGAAACGGGAGCAAGAAGG - Intronic
916227811 1:162507513-162507535 TTTGGGAAACTGAGGCTGGAAGG - Intronic
916247959 1:162707245-162707267 CTTAGGAAAAAGAAGCAGGATGG - Intronic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
917115886 1:171603136-171603158 GTTGGGAGACGGAAGCTGGATGG - Intergenic
918248170 1:182679044-182679066 CATGGGAAAGAATAGGTGGAAGG - Intronic
920450230 1:206055204-206055226 GTTGGGAGACGGAAGCTGGACGG - Intronic
920511547 1:206555951-206555973 CTGGGGAAACATAAGCTGGGTGG - Intronic
920940836 1:210480728-210480750 AAAGGGAAGCAGAGGCTGGATGG - Intronic
921205451 1:212844949-212844971 CATGAGGGACAGAAGTTGGAAGG - Intronic
921676535 1:217982684-217982706 CATGGGGAAAATCAGCTGGACGG - Intergenic
921927208 1:220721279-220721301 GTTGGGAGACAGAAGCTGGATGG - Intergenic
922339144 1:224641498-224641520 AATGGGAAGCAATAGCTGGAAGG - Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922355757 1:224773774-224773796 CATGGGAAAGAAGGGCTGGAGGG + Intergenic
922680704 1:227593034-227593056 GTTGGGAGACGGAAGCTGGATGG + Intronic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
922973318 1:229761343-229761365 CAGAGGGAACAGAAACTGGAAGG - Intergenic
923389567 1:233500642-233500664 CATGGCAAACCCTAGCTGGAAGG + Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924947908 1:248858307-248858329 CATGTGCACCAGAGGCTGGAGGG + Exonic
1063056864 10:2514635-2514657 CAAAGAAAACAAAAGCTGGAAGG + Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1065283368 10:24163719-24163741 AATGGGAGAATGAAGCTGGAAGG - Intronic
1065802354 10:29364121-29364143 GTTGGGAGACGGAAGCTGGACGG + Intergenic
1065931071 10:30479537-30479559 GTTGGGAGACAGAAGCTGGATGG - Intergenic
1066658943 10:37721010-37721032 GGTGGGAAGCAGAGGCTGGATGG - Intergenic
1067037511 10:42931261-42931283 CATGAGAAACAGAGACAGGAAGG - Intergenic
1067043361 10:42970252-42970274 GGTGGGAAACAGAGGCTGGATGG - Intergenic
1068675741 10:59767601-59767623 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1068811742 10:61263317-61263339 CATGGGAAACACAATCTGAATGG - Intergenic
1069222638 10:65903551-65903573 GATGGGAACCAGAAAGTGGATGG - Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069736822 10:70661992-70662014 CATGTTAAACATGAGCTGGAAGG + Intergenic
1069939308 10:71943548-71943570 GTTGGGAGACGGAAGCTGGATGG - Intergenic
1070613759 10:77952977-77952999 CATGGGAGGCTGAAGCAGGAGGG + Intergenic
1071288357 10:84169687-84169709 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1071919276 10:90331207-90331229 CATGGGCATTAGAAGCTGAAAGG + Intergenic
1072334860 10:94388941-94388963 GTTGGGAAACGGAGGCTGGATGG - Intergenic
1072388001 10:94951844-94951866 GATGGGAAAGAGTAGGTGGATGG + Intronic
1072689121 10:97559136-97559158 GTTGGGAGACGGAAGCTGGATGG + Intronic
1072838236 10:98740281-98740303 CTTGGGAGACTGAGGCTGGAGGG - Intronic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1077135460 11:995945-995967 CATGAGAAACATAAGCATGAAGG - Intronic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080220125 11:29893289-29893311 GATGGTAACCAGAGGCTGGAGGG + Intergenic
1081252215 11:40850152-40850174 CAAGGGAAAAAAAAACTGGATGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081538816 11:44015293-44015315 GATGGGAAACTGAGGCTGGGAGG + Intergenic
1081743510 11:45457295-45457317 CAGGAGAAACAGCAGCTGTAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082752242 11:57031557-57031579 CAAGGAAAAAAGAACCTGGAAGG - Intergenic
1082834272 11:57640194-57640216 CCAGAGAAACAGAGGCTGGAGGG - Intergenic
1083998666 11:66284387-66284409 GCTGGGAAAGAGAAGATGGAAGG - Intronic
1084105716 11:66978968-66978990 CAGCGAAAACAGAAGCTGCAAGG - Intergenic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1084394147 11:68897894-68897916 CCTGGGAGACAGAAGCTAGAGGG - Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1085998803 11:81954296-81954318 GTTGGGAGACAGAGGCTGGATGG - Intergenic
1086523236 11:87696474-87696496 CATAGAAATCAGAATCTGGATGG - Intergenic
1086571318 11:88287692-88287714 AATGGTTAACAGAGGCTGGAAGG - Intergenic
1086973403 11:93107165-93107187 GCTGAGAGACAGAAGCTGGATGG + Intergenic
1087639969 11:100746274-100746296 GTTGGGAAATGGAAGCTGGATGG + Intronic
1087684569 11:101248629-101248651 GTTGGGAGACGGAAGCTGGATGG - Intergenic
1089517648 11:119043965-119043987 CTTGGGAGACTGAGGCTGGAGGG - Intergenic
1089615821 11:119694212-119694234 CAGGGGAAGCAGGAGCTGGCAGG + Intronic
1090142398 11:124278332-124278354 CATGGAATTCAGAATCTGGATGG + Intergenic
1090615748 11:128513000-128513022 CATGGAAAAGGGAAGCTGAAAGG + Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1091814454 12:3425998-3426020 GTTGGGAGACGGAAGCTGGATGG + Intronic
1092285781 12:7128631-7128653 CATGGGACCAAGAAGCAGGAAGG + Intronic
1092741063 12:11630091-11630113 GATGGGGCACAGAAGCAGGAAGG - Intergenic
1093641874 12:21536970-21536992 CATGGGAAGAAAAAGCTGCATGG - Exonic
1093673688 12:21908227-21908249 CATGGAAAAGAGAAGATGAATGG + Intronic
1093772358 12:23032692-23032714 GATGAGAAACTGAAGCTGGAAGG + Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094024708 12:25950388-25950410 CATGGGAAACTGAGGTGGGAGGG + Intergenic
1094687637 12:32734458-32734480 CATGCAATTCAGAAGCTGGAAGG + Intronic
1095262604 12:40114058-40114080 CACGGGAGACAAAAGATGGATGG + Intergenic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1095473998 12:42566403-42566425 GATGGCAAACAGAAATTGGAGGG + Intronic
1095587144 12:43862024-43862046 GAAGAGAAAAAGAAGCTGGAGGG - Intronic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096193545 12:49634734-49634756 CAAGGGGAAGAAAAGCTGGAGGG + Intronic
1098306398 12:69107017-69107039 CATGGCAAGAAGAAGCAGGAAGG - Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098639477 12:72821948-72821970 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1098976870 12:76911967-76911989 CAAAGGAAACAAAAGCTGAAGGG - Intergenic
1100942285 12:99737518-99737540 CATGGGGAAAAGAAGTGGGAAGG - Intronic
1100988646 12:100228914-100228936 CTTGGGAAGCAGAAGCTTTAGGG - Intronic
1101014030 12:100481006-100481028 TATGGAAAACAGAAGCTACAAGG + Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1102281631 12:111623196-111623218 CCTGGGAAACAGAGGCTGCAGGG - Intergenic
1102606492 12:114071622-114071644 GTTGGGATACAGAAGCTGGATGG - Intergenic
1102839982 12:116108477-116108499 CATTGTCAACAGAAGTTGGAAGG - Intronic
1104084229 12:125459503-125459525 GATGGTTACCAGAAGCTGGAAGG + Intronic
1104107368 12:125675712-125675734 CATAGGAAACAGAAAAGGGAAGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1109909395 13:68890259-68890281 GTCGGGAGACAGAAGCTGGATGG + Intergenic
1110515233 13:76403918-76403940 CAAGGGAGAGAGAAGCTAGAAGG - Intergenic
1110653654 13:77972077-77972099 GTTGGGAAGCGGAAGCTGGATGG + Intergenic
1110688633 13:78405049-78405071 CAAAGGAAACAGAAGCTGAGTGG + Intergenic
1111319993 13:86614678-86614700 CATGGGAGTTAGAAGGTGGAAGG - Intergenic
1112103738 13:96218240-96218262 TAAGGGACACAGAAGCTGAAGGG + Intronic
1112507473 13:99983596-99983618 CATGGGAAACAGTCCCGGGAAGG - Intronic
1113427115 13:110217445-110217467 CATGGGAAACAGATGATCGAGGG - Intronic
1113551311 13:111195204-111195226 CATTGGAAAGACAATCTGGAAGG - Intronic
1114127313 14:19744010-19744032 AATGGAAAACAGAATCTAGAAGG - Intronic
1114938440 14:27574126-27574148 CATGGAATTCAGAATCTGGATGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1115484457 14:33896897-33896919 CATGGGAAACAGGAAAGGGAAGG + Intergenic
1116623389 14:47235794-47235816 TATGGGAAACAGGAACAGGAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117955140 14:61117016-61117038 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1118435841 14:65770335-65770357 TATGGGACACAGGAGCTAGAAGG - Intergenic
1118674058 14:68163618-68163640 CTTGGGAAACAGAAGAAGGCAGG - Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1119901481 14:78264255-78264277 GTTGGGAAGCAGAAGCTAGAAGG - Intronic
1120061608 14:79989948-79989970 CTTGGGAAACTGAGGCAGGAGGG - Intergenic
1120713412 14:87816126-87816148 CATGGGAAGCAGAAGAGGTAGGG - Intergenic
1120815618 14:88854788-88854810 CTTGGGAGACTGAAGCAGGATGG - Intronic
1120862489 14:89267273-89267295 CATGGGAAACTGCTGCAGGATGG + Intronic
1123570766 15:21605656-21605678 AATGGAAAACAGAATCTAGAAGG - Intergenic
1123606879 15:22041009-22041031 AATGGAAAACAGAATCTAGAAGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124575209 15:30902030-30902052 GCTGGCAAACAGTAGCTGGATGG + Intergenic
1124934347 15:34156238-34156260 GTCGGGAGACAGAAGCTGGATGG + Intronic
1125690431 15:41591706-41591728 GTTGGGAGACCGAAGCTGGATGG - Intergenic
1126377486 15:48010788-48010810 CATGGGAATCAGAAGTGGGTGGG + Intergenic
1126415831 15:48416560-48416582 CAAGTGAGACAGAAGCTGCAGGG + Intronic
1126867409 15:52951343-52951365 GAGTGGAAACAAAAGCTGGATGG + Intergenic
1129095743 15:73205641-73205663 CATGGGAGACATAAACTGGTAGG - Intronic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1129427450 15:75474158-75474180 TATGGGAAACAGAAGGTTAATGG - Intronic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1129727636 15:77909632-77909654 CCTGGAAAACAGGGGCTGGAAGG - Intergenic
1129961957 15:79695014-79695036 CATGGGGCACAGCATCTGGAGGG - Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130709032 15:86261258-86261280 TAAGGGAAACACAACCTGGAAGG - Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1202979119 15_KI270727v1_random:332779-332801 AATGGAAAACAGAATCTAGAAGG - Intergenic
1132571876 16:647791-647813 CAGGTGCAACAGCAGCTGGATGG + Exonic
1132794013 16:1709647-1709669 GGTGGGAAACAGCAGCTGAACGG + Intronic
1133078945 16:3303297-3303319 CATGGGAAAAAGAGGCAGCAAGG - Intronic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1133826199 16:9280428-9280450 CCTTTGAAACAGATGCTGGATGG + Intergenic
1135646067 16:24163082-24163104 CCTGGGAAAGAGAATCTGGTTGG + Intronic
1136254313 16:29028227-29028249 CATGGAAATGAGATGCTGGATGG + Intergenic
1137060422 16:35788219-35788241 CATGGGAAACACAAGCAGGCTGG + Intergenic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1141174149 16:81708202-81708224 TATGGGACACAGAAGGTGGCAGG + Intronic
1142781009 17:2181223-2181245 TATGGGAAACAAAAGAAGGAAGG + Intronic
1143010026 17:3861164-3861186 CACGAGACACAGAACCTGGAGGG - Intronic
1143443525 17:6994159-6994181 AAAGGGAAACAAAAGCAGGAGGG + Intronic
1143663045 17:8339064-8339086 AAAGGGAGGCAGAAGCTGGAGGG + Intergenic
1143949387 17:10620640-10620662 CCTGAGAATCAGAACCTGGAAGG + Intergenic
1144212095 17:13024302-13024324 GATGGGAAACTGAAGCTGAAAGG + Intergenic
1144626335 17:16846127-16846149 CATGGGAAAGCATAGCTGGAGGG - Intergenic
1144880098 17:18426593-18426615 CATGGGAAAGCATAGCTGGAGGG + Intergenic
1145152135 17:20517791-20517813 CATGGGAAAGCATAGCTGGAGGG - Intergenic
1146163494 17:30572010-30572032 CATGGGAAAGCATAGCTGGAGGG - Intergenic
1146501528 17:33368882-33368904 CATGGGTACCAGGTGCTGGATGG + Intronic
1146727302 17:35166717-35166739 CATGGGATGCTCAAGCTGGAGGG + Intronic
1147236303 17:39060037-39060059 AAGGGGAAAGACAAGCTGGAAGG + Intergenic
1147580480 17:41624825-41624847 CATGGGAAAGCATAGCTGGAGGG - Intronic
1147897523 17:43760372-43760394 CAAGGGAAAAGGAGGCTGGAGGG - Intergenic
1149367504 17:55960581-55960603 GCTGGGAGACAGAAGCAGGAGGG + Intergenic
1149634765 17:58157649-58157671 AAAGGGAGACTGAAGCTGGAGGG - Intergenic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1153351367 18:4084042-4084064 GATGGGAGCCAGAAGCGGGATGG + Intronic
1153533003 18:6068870-6068892 CATGGGAAAAAGAATCTGAATGG - Intronic
1155298791 18:24409807-24409829 CATGGGAAGCTGAGGCTGGAGGG + Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158771291 18:60520606-60520628 CAGTGGAAACAGGAGCTTGAAGG + Intergenic
1159555002 18:69936377-69936399 AATGGGAAACTGAAAGTGGATGG - Intronic
1160251024 18:77203530-77203552 CATGGGATAAAGAAGCCAGAAGG - Intergenic
1160310349 18:77784130-77784152 CATAGGAAAGACAAACTGGAAGG - Intergenic
1160429590 18:78802242-78802264 GAGGGGAAACGGAGGCTGGAGGG + Intergenic
1161688008 19:5713126-5713148 CATGGGACACAGAAGGTGGGTGG - Exonic
1162062721 19:8106764-8106786 GATGGGAGATAGAAGATGGATGG + Intronic
1162096812 19:8315055-8315077 TTTGTTAAACAGAAGCTGGAAGG + Intronic
1162262601 19:9545016-9545038 CATGAGGGACAGAAGTTGGAAGG - Intergenic
1162782524 19:13013703-13013725 CATGTGAGACAGAGGCTGAATGG + Intronic
1163799695 19:19356959-19356981 CCTGGGCCCCAGAAGCTGGAGGG - Exonic
1163991911 19:21006719-21006741 GTTGGGAGACAGAAGCTGGATGG - Intergenic
1164216902 19:23158501-23158523 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1166272991 19:41728895-41728917 GTTGAGAAACAGAAGCTGAATGG + Intronic
1166443546 19:42838032-42838054 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166463237 19:43008694-43008716 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166469381 19:43065252-43065274 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166480511 19:43168790-43168812 CTTGAGAAACAGAAGCTGAATGG - Intronic
1167935394 19:52902244-52902266 ATTGGGAGACGGAAGCTGGAAGG + Intergenic
925534336 2:4900501-4900523 CAGGGGCAGCAGAAGCTGGTGGG - Intergenic
925827254 2:7861632-7861654 AATGGCCTACAGAAGCTGGAAGG - Intergenic
926181925 2:10652278-10652300 CATGGGCACCAGAAACAGGAAGG + Intronic
926521437 2:13920513-13920535 GATGGTTACCAGAAGCTGGAAGG + Intergenic
926666817 2:15534104-15534126 GATGGGACACAGTTGCTGGAAGG + Intronic
926690686 2:15731285-15731307 CATGGGTAAGACAGGCTGGAGGG - Intronic
927597850 2:24412960-24412982 CCTGGGAAACAGGAGCGGGAAGG - Intergenic
927840404 2:26438296-26438318 CATAGGAGAAAGAAGCTGCAAGG - Intronic
928217584 2:29375124-29375146 CATGAGAAACAGCAGCAGCAAGG + Intronic
929049365 2:37822708-37822730 CATGGGATGAAGGAGCTGGAGGG - Intergenic
932365804 2:71152629-71152651 GCTGGCAAACAGTAGCTGGATGG + Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934752067 2:96799840-96799862 GATGGGGTCCAGAAGCTGGAGGG + Intronic
935048475 2:99503012-99503034 GTTGGGAGACAGAAGCTGGATGG - Intergenic
935686383 2:105687622-105687644 CATGGTAAACTGAAGCCTGAAGG - Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936577381 2:113667955-113667977 CGTGGGAATCACAAGCTGGGGGG - Intergenic
937216681 2:120317569-120317591 CATGGGCAACTAAACCTGGAGGG - Intergenic
937260195 2:120580647-120580669 TATGGGAAACTGAAGCTGTGGGG - Intergenic
937499519 2:122462809-122462831 CATGGGAACCAGATTCTGGAGGG + Intergenic
939298184 2:140297164-140297186 CATAGGAGAAAGAAGCTGGGGGG + Intronic
941520841 2:166540269-166540291 AATGGAAAACAAAAGTTGGAGGG + Intergenic
941772185 2:169357125-169357147 CATGGAAAAAATAAGCTTGATGG - Intronic
941965303 2:171294883-171294905 GTAGGGAATCAGAAGCTGGAAGG - Intergenic
942143412 2:173001258-173001280 CATTTAAAACAGAATCTGGAAGG - Exonic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943066206 2:183089378-183089400 AATGGGAAACAGGAGCTGACAGG - Intronic
943764721 2:191648388-191648410 CATGGGAAGCCGAAGCAGAAGGG - Intergenic
944486728 2:200214522-200214544 CATAGGAAACCCAAGCTGGGGGG - Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945555010 2:211265844-211265866 CATGAGGGACAGAAGTTGGAAGG - Intergenic
945720346 2:213410920-213410942 GTTGGGAGACGGAAGCTGGATGG - Intronic
947287179 2:228529958-228529980 CATGGCCACCAGAAGCTAGAAGG + Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
947556492 2:231098051-231098073 GTTGGGAGACGGAAGCTGGATGG + Intronic
1168756822 20:324367-324389 CTTGGGAAGCAGGAGCTGGGAGG - Intergenic
1169093372 20:2874617-2874639 CCTGAGAAACAGAAGATGGTGGG + Intronic
1169458149 20:5770872-5770894 CATGGCAAACAGATTCAGGATGG + Intronic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170307823 20:14959453-14959475 GATGGGAAAGAGGAGCTGGCAGG - Intronic
1170401039 20:15983560-15983582 GTTGGGAGACAGAAGCTGGATGG + Intronic
1170468594 20:16645691-16645713 CTTGGAAAACATAAGCTGTAAGG + Intergenic
1170812983 20:19689120-19689142 CATGGGAAAGAAAAACTAGAAGG + Intronic
1170895467 20:20409134-20409156 GATGGGTAACAGCACCTGGATGG + Intronic
1171073780 20:22102258-22102280 CATGGGAATCAGAACTGGGATGG + Intergenic
1172973117 20:38887981-38888003 CAGGGGAAAAAGAAGCTGGTAGG - Intronic
1173132548 20:40408285-40408307 AATGGGAAAAAGGAGATGGAAGG + Intergenic
1173332641 20:42088031-42088053 CTTGGGAACCAGGAACTGGAGGG - Intronic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1175032192 20:55965814-55965836 CAAGGGAAAAGGAAGCTGGCTGG + Intergenic
1175515914 20:59569664-59569686 GATGGGAAATAGATGATGGACGG + Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175784673 20:61705060-61705082 GATGGGAAGCAGCAGCTGGCTGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG + Intergenic
1175963045 20:62646640-62646662 CATGGGAAACAGACTCAGAATGG - Intronic
1176694484 21:9958490-9958512 CATGGAAAAAAGAATCTAGATGG - Intergenic
1176769798 21:13058948-13058970 GTCGGGAGACAGAAGCTGGATGG - Intergenic
1177262515 21:18749290-18749312 AATGGGAAAGAGCAGCAGGAAGG + Intergenic
1177282821 21:19006694-19006716 CATGGGAAACAGTACCAGGGCGG + Intergenic
1178361052 21:31948720-31948742 CCAGGGAAACAGAAGCTGGAAGG + Intronic
1179085228 21:38210542-38210564 CACAGCAACCAGAAGCTGGAAGG - Intronic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1179583990 21:42363476-42363498 CATTGGAGAAGGAAGCTGGATGG - Intronic
1179932453 21:44579525-44579547 CATGGGGCAGAGAAGCTGGGAGG + Exonic
1180916859 22:19494817-19494839 CAGGGGGAACATCAGCTGGATGG - Intronic
1181133093 22:20745828-20745850 CATGGCAAACAGCACCTGGTGGG + Intronic
1181574808 22:23787069-23787091 CGAGGGAAACCGAAGCCGGAAGG - Exonic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1182002014 22:26927314-26927336 GATGGGAAACAGAAGATAGTGGG - Intergenic
1182684352 22:32109945-32109967 TATTGGACACAGAAGCAGGATGG - Intronic
1183662142 22:39227475-39227497 CATGGTAAACACTAGCTGGGGGG - Intronic
1183695863 22:39421867-39421889 CATGGGGCACAGCCGCTGGATGG + Exonic
1184064072 22:42105963-42105985 ATTGGGAGCCAGAAGCTGGATGG + Intergenic
1184718047 22:46293141-46293163 CCTGGGAAACAGAATTTGCAAGG - Exonic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185422850 22:50744709-50744731 CGTGGGAATCACAAGCTGGGGGG + Exonic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949661584 3:6284812-6284834 CATAGTATACAGAATCTGGATGG + Intergenic
949903140 3:8836503-8836525 CCTGGGAAAGAAAATCTGGATGG - Intronic
950552343 3:13674303-13674325 AATGGGAAAAAGAAACAGGATGG - Intergenic
950846036 3:16017056-16017078 GTTGGGAGACGGAAGCTGGACGG + Intergenic
951132361 3:19062816-19062838 GATGGGAAACAAAGGCTAGAGGG - Intergenic
951201171 3:19876445-19876467 GATGGGAATCAGCAGCAGGATGG + Intergenic
951605817 3:24433840-24433862 CATGGGGAAAAGACCCTGGATGG + Intronic
951742404 3:25939070-25939092 CATGGCACACAGAAGCCAGATGG - Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952698488 3:36298724-36298746 CATGGGAAAAAGATGCAGGCTGG + Intergenic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953313841 3:41907402-41907424 CATGGGAAGCTGAAGTGGGAGGG - Intronic
953430015 3:42831487-42831509 CCTGGGCAACTGAAGCTGGAGGG - Intronic
953656188 3:44856617-44856639 CATGAGGGACAGAAGTTGGAAGG + Intronic
954310801 3:49765572-49765594 CATGGGAATCAGAGGTTGCAGGG + Intronic
954486116 3:50853192-50853214 GATGGTTACCAGAAGCTGGAAGG - Intronic
955348991 3:58180286-58180308 CAAGGGAGACAGAGTCTGGAAGG + Intergenic
956545318 3:70394787-70394809 CATGGGACACAAAAGCTGCTGGG + Intergenic
956647925 3:71475139-71475161 CATTGGAAATAGAAGCAGGGGGG - Intronic
957170238 3:76729711-76729733 CATGGGAGGCAGAGGCTGCAGGG - Intronic
957254912 3:77824813-77824835 CATGGAATTCAGAATCTGGATGG - Intergenic
958188406 3:90153119-90153141 CTAGGGAAGCAGAAGCTGAAAGG + Intergenic
958566881 3:95823977-95823999 CATGGGAACCTTAAACTGGACGG + Intergenic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959494308 3:107031278-107031300 CATGGAATTCAGAATCTGGATGG + Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
959934107 3:112012093-112012115 CAGGAGAAACAGAACCTGGGTGG - Intronic
960626253 3:119685121-119685143 GATGGGGATCAGAAGCTGGGAGG - Intergenic
962096687 3:132299722-132299744 GTTGGGAGACGGAAGCTGGATGG + Intergenic
962277124 3:134023964-134023986 GTTGGGAAACGGAGGCTGGATGG - Intronic
963090534 3:141479515-141479537 CATTGGAAAGGGAAGCTGTAAGG - Intergenic
963627159 3:147688386-147688408 CAGGAGAAAAAGAAGCTAGAGGG + Intergenic
964611939 3:158624479-158624501 GTTGGGAAACGGAAGCTGGATGG + Intergenic
967232366 3:187352317-187352339 CATGGAAAACCAAAGCAGGAGGG - Intergenic
967708444 3:192679180-192679202 GATGGGAAATAGAAGCAGCAGGG + Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968263931 3:197347865-197347887 CATTAGAAACATAAGCTGGAAGG - Intergenic
968955292 4:3715968-3715990 CATGGGCAACGGGAGCTGGAGGG - Intergenic
969323419 4:6426711-6426733 CCTGGGAAACGCAGGCTGGATGG + Intronic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
971027359 4:22601742-22601764 GTTGGGAGACGGAAGCTGGATGG - Intergenic
971179930 4:24320250-24320272 GATGTGAAACAGAAGATAGATGG - Intergenic
971417809 4:26449602-26449624 CATTGGAGACAGAAGCAGGGAGG + Intergenic
971727548 4:30333142-30333164 CATGGGAGAAAGATGCAGGATGG - Intergenic
971913007 4:32821173-32821195 CCTGGGAAACAAAGGCTGCAGGG - Intergenic
972016853 4:34257562-34257584 CATGAGAAACAGCAGTTTGAGGG + Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972217111 4:36909712-36909734 GATGGGAGACGGAGGCTGGATGG - Intergenic
972991171 4:44823764-44823786 GTTGGGAGACAGAAGCTTGATGG + Intergenic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
974949775 4:68573869-68573891 GTTGAGAGACAGAAGCTGGATGG + Intronic
975621917 4:76305165-76305187 CATGGGGAACAGATCCTGTAGGG + Intronic
975683915 4:76901078-76901100 GATGGGAATCAGAAGATGAAGGG + Intergenic
975885875 4:78964065-78964087 AATGGGAAACTGAAGATGGGAGG + Intergenic
976045523 4:80942056-80942078 GATGGGAAAAAGAACATGGATGG + Intronic
976226722 4:82799891-82799913 CATGGAATATGGAAGCTGGAAGG - Intergenic
976455043 4:85236670-85236692 CCTAGGAAACAGAAGCAGCAAGG - Intergenic
976990279 4:91356793-91356815 GTTGGGAGACGGAAGCTGGATGG + Intronic
977383039 4:96301302-96301324 GATGGCAAGCACAAGCTGGAGGG + Intergenic
978367855 4:108001348-108001370 TATTGGAAACAGAACCTTGAAGG + Intronic
979580024 4:122347129-122347151 CATGGGAAACAGAAGATGCTGGG + Intronic
980367112 4:131818716-131818738 CATGGAAAAAAGAATCTAGATGG - Intergenic
983708493 4:170687174-170687196 GTTGGGAGACGGAAGCTGGATGG - Intergenic
984184360 4:176524783-176524805 CATAGGAAACAGAAATTGGTAGG - Intergenic
984213590 4:176880304-176880326 CATGGTAACCAGGAGCTGCAAGG - Intergenic
984505468 4:180612381-180612403 TATGAGAAACAAAACCTGGAGGG - Intergenic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
985371251 4:189287252-189287274 CAAGGCAAACAAATGCTGGAAGG + Intergenic
985760194 5:1745001-1745023 CCTGGGAAGCAACAGCTGGAGGG + Intergenic
985806049 5:2044254-2044276 CATTGTACAGAGAAGCTGGAGGG + Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
989095988 5:37781734-37781756 GTTGGGAGACGGAAGCTGGATGG + Intergenic
989557648 5:42816097-42816119 GTTGGGAGACGGAAGCTGGATGG - Intronic
991195851 5:63931202-63931224 CAAAGGAAAGAGAAGCTTGATGG + Intergenic
993301969 5:86222997-86223019 GATAGAAAACAGAGGCTGGAAGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
996828981 5:127719055-127719077 GATGGCTAACAGAAGCTGGAAGG - Intergenic
997395587 5:133557416-133557438 TAAGGGACACAGAAGCAGGAAGG - Intronic
998114774 5:139528071-139528093 GTTGGGAGACAGAAGCTGCATGG - Intronic
998552382 5:143090116-143090138 GTTGGGAGACGGAAGCTGGATGG + Intronic
998938519 5:147256241-147256263 GTTGGGAGACAGAAGCTGGATGG + Intronic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000604839 5:163316719-163316741 GTTGGGAGACGGAAGCTGGATGG + Intergenic
1001203476 5:169740716-169740738 CATGAGAAACAGAATATGTAAGG - Intronic
1001319558 5:170669028-170669050 GATGAGAAAGAGAAGCAGGAGGG - Intronic
1001570888 5:172729855-172729877 TTTGGGTAACACAAGCTGGAAGG + Intergenic
1001823730 5:174729428-174729450 AAAGGGAGACTGAAGCTGGAGGG - Exonic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002190664 5:177475815-177475837 CAGGGGCAACAGCAGCTGAAAGG - Intergenic
1002346188 5:178548626-178548648 GATGGGAAACAGAGGTTGCAGGG - Intronic
1002994293 6:2268476-2268498 CATGGGACACAGAGCCAGGAGGG + Intergenic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1005175074 6:23035468-23035490 CATGGGATATACAAGCTGGGAGG + Intergenic
1005290946 6:24378273-24378295 CATGGCACACAGAAGCGGGAGGG - Intergenic
1006325716 6:33352340-33352362 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1008123527 6:47644516-47644538 GTTGGGAGACAGAAGCTGGATGG - Intergenic
1008150945 6:47950301-47950323 CATGGAAAATATAAGCTGGGTGG + Intronic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1009885078 6:69616059-69616081 CTTGGGAAACAGAAGCTGGGAGG - Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1012516101 6:100061423-100061445 GATGGTGAACAGACGCTGGAAGG - Intergenic
1012924500 6:105254007-105254029 CAAGGGCAAGAGAAGATGGATGG - Intergenic
1012987808 6:105893716-105893738 CATGGGAGACACAAGCTGCCTGG - Intergenic
1013559236 6:111287852-111287874 GTTGGGAGACGGAAGCTGGATGG + Intergenic
1013824764 6:114197965-114197987 CATGGAATTCAGAATCTGGATGG + Intronic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014412605 6:121145440-121145462 AATGGTTACCAGAAGCTGGAGGG + Intronic
1014690820 6:124561314-124561336 CATGGGAAAGAGATGATGAATGG - Intronic
1016919078 6:149273292-149273314 GGTGGGAAAAAGAAGATGGAGGG + Intronic
1017007121 6:150036149-150036171 CATGGGAAACAGCAACCCGAGGG - Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017189165 6:151633601-151633623 CATGGGGTACAGTAGCTGTAAGG + Intergenic
1018145072 6:160878047-160878069 CATGGAATTCAGAATCTGGACGG + Intergenic
1018191271 6:161311167-161311189 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1018252042 6:161881168-161881190 CCTGGAAAACAGATGTTGGAGGG + Intronic
1018484611 6:164228192-164228214 CATGGGAACCGGAAGGTGGGAGG + Intergenic
1018701830 6:166433296-166433318 CATCGGATACAGATGCTGGGCGG - Intronic
1018713177 6:166512296-166512318 CGTGGTGAACAGGAGCTGGAAGG + Intronic
1019655722 7:2193889-2193911 CATGGGAAAGAAAAGCTGCAGGG + Intronic
1020043832 7:5024829-5024851 GTTGGGAGACAGAGGCTGGATGG + Intronic
1020718985 7:11717456-11717478 CATGGAAAGCAGAAAATGGAGGG - Intronic
1021075997 7:16305506-16305528 CCTGGGAAACACATGCTGAAAGG - Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022526650 7:31042344-31042366 TATGGGAAAGAGTATCTGGAAGG - Intergenic
1023045306 7:36205206-36205228 CATGAGAAACAAAAGCCGGAAGG + Intronic
1023086010 7:36570938-36570960 CATGGGGAACAGAAGCCACATGG - Intronic
1023525108 7:41093946-41093968 GCTGGGAAACAGAAGATGAAAGG + Intergenic
1023653763 7:42398678-42398700 CTATGGAAACAGAAGCTGTAGGG + Intergenic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1023911998 7:44562912-44562934 CAAAGGATACAGAAGATGGAGGG - Intergenic
1024991024 7:55234561-55234583 CCTGGGAAACAGGAGCAGGAGGG + Intronic
1026645145 7:72160994-72161016 CAAGTTAAACAGAAGCTGGCAGG + Intronic
1026952243 7:74355304-74355326 CAAGTGAATCAGAAGCTGGATGG + Intronic
1027401422 7:77812099-77812121 GATGAGAAAAAGAACCTGGATGG + Intronic
1028271640 7:88798081-88798103 CATGGGTATCAGAACCTTGATGG + Intronic
1029486152 7:100842937-100842959 GTTGGGAGACGGAAGCTGGATGG - Intronic
1029685173 7:102142288-102142310 AATGGCAAACAGAACCTGAAAGG + Intronic
1030300955 7:107974285-107974307 CAAGGAAAACAAAATCTGGAAGG - Intronic
1031978530 7:128108824-128108846 CATGGGACTCAGTAGCAGGAAGG + Intergenic
1032170607 7:129581571-129581593 GTTGGGAGACAGAAGCTGGGTGG - Intergenic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033097431 7:138443171-138443193 GTTGGGAAACGGAAGCTGGATGG + Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034718047 7:153261941-153261963 AATTGGAAACAGAGGATGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035078801 7:156199334-156199356 CCAGGGAAACTAAAGCTGGAGGG - Intergenic
1035215357 7:157362299-157362321 CCTGGGAATCAGAACATGGAAGG + Intronic
1035646064 8:1222051-1222073 CATGGAATTCAGAATCTGGATGG - Intergenic
1036016495 8:4791037-4791059 AATGGGAAACACAAGCTAGTAGG + Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1038097681 8:24333595-24333617 CATGAGAAACAGCAGCAGGTAGG - Intronic
1040452583 8:47562840-47562862 GATGAGTAAGAGAAGCTGGAGGG - Intronic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041483685 8:58350457-58350479 TGTGGGGAACAGAAGCTGGCAGG - Intergenic
1041876032 8:62688225-62688247 TATGGGTAACAGAAGCTGACGGG + Intronic
1041893814 8:62901360-62901382 CATGGGAAGCTGAGGCAGGAGGG + Intronic
1042179134 8:66067268-66067290 CTTGGAGAACAGAAGCTGAAAGG + Intronic
1042710640 8:71713228-71713250 CATGGGCGATAGATGCTGGATGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1043942991 8:86217105-86217127 GATGGGAAACAGAAGAGGCAAGG - Intronic
1045063344 8:98426567-98426589 GTTGGGGAACAGGAGCTGGAGGG - Intronic
1047301835 8:123620155-123620177 AATGGGAAACTGGAGCAGGAAGG - Intergenic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1047717553 8:127609672-127609694 CAACAGAAACAGAAGCTGCATGG + Intergenic
1048045572 8:130769607-130769629 GATGGGAAACAGAAGTGTGAGGG + Intergenic
1049614204 8:143569149-143569171 CATGGGAAGGAGAAACTAGAGGG + Intronic
1049623769 8:143611099-143611121 CATGGGACGGAGAAGCTGAACGG - Intergenic
1049633938 8:143675778-143675800 GTTGGGAGACAGAAGCTGGATGG - Intergenic
1049840385 8:144767317-144767339 CATGGGAAGCAGAGGTGGGAGGG - Intergenic
1050014365 9:1218475-1218497 CTTTGAAAACAGAAGCTAGAAGG - Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1053621994 9:39828851-39828873 CATGGAAAAAAAAAGATGGAAGG + Intergenic
1053631456 9:39944430-39944452 CATGGAAAAAAGAATCTAGATGG - Intergenic
1053774308 9:41519100-41519122 CATGGAAAAAAGAATCTAGATGG + Intergenic
1053837926 9:42160713-42160735 CATGGAAAAAAAAAGATGGAAGG + Intergenic
1054212431 9:62306268-62306290 CATGGAAAAAAGAATCTAGATGG + Intergenic
1054312556 9:63542564-63542586 CATGGAAAAAAGAATCTAGATGG - Intergenic
1055276642 9:74624921-74624943 TATGGGAAACAGAAGCTAACAGG + Intronic
1056266534 9:84902118-84902140 CCTGGGAGTCAGAAGCTGCAGGG + Intronic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056599929 9:88038920-88038942 ATTGGGAGACGGAAGCTGGATGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057871808 9:98723647-98723669 CCTGGGAAATGCAAGCTGGAGGG + Intergenic
1058776631 9:108290582-108290604 CAATGGAACCAGAAGCTAGAGGG + Intergenic
1059143900 9:111879890-111879912 TATGGCAAGCAAAAGCTGGAAGG + Intergenic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1059665692 9:116444578-116444600 CATGGGAAGTCAAAGCTGGAAGG - Intronic
1060380296 9:123163969-123163991 CATGGGAGGCAGGAGTTGGAAGG + Intronic
1060535868 9:124387541-124387563 CATGGGAAGCAGAATCAGGTTGG - Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061153949 9:128845912-128845934 GGTGGAAAACAGAGGCTGGAGGG + Intronic
1061194229 9:129098727-129098749 GATGGGTACCTGAAGCTGGAGGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061478243 9:130883542-130883564 GATGGGAACAAAAAGCTGGACGG + Intronic
1062266269 9:135687845-135687867 CTTGGGAAACAGAGCTTGGAGGG - Intergenic
1187502086 X:19847293-19847315 CATGTAAAACAGAAGCTGATGGG + Intronic
1187948118 X:24446240-24446262 CAATGGAAACAGAGGTTGGAGGG + Intergenic
1188332699 X:28893939-28893961 CATGAGGGACAGAAGTTGGAAGG + Intronic
1188435467 X:30153494-30153516 CATTGGAGACAGAAGTTGGTGGG + Intergenic
1188565935 X:31526681-31526703 TATGGGCACCAGAAGGTGGAAGG - Intronic
1189034665 X:37483280-37483302 GTTGGGAGACTGAAGCTGGATGG - Intronic
1189233188 X:39468131-39468153 TATGGGAAACAGAGGGTGGGAGG + Intergenic
1189317015 X:40063641-40063663 CAAAGGCAACAGAAGCTGGTCGG - Exonic
1190002849 X:46706324-46706346 CATGGGAAGAGGTAGCTGGAAGG + Intronic
1190270325 X:48858139-48858161 GTTGGGAGACGGAAGCTGGATGG - Intergenic
1191639294 X:63413049-63413071 GTTGGGAGACGGAAGCTGGATGG - Intergenic
1192778361 X:74268589-74268611 CAAAGGAAACTGAAGCTGAAAGG + Intergenic
1192915413 X:75646330-75646352 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1193666172 X:84320555-84320577 AATTGGAAACAGAAACTTGATGG + Exonic
1193699612 X:84744885-84744907 CATGGGAAACATAAACTTTACGG + Intergenic
1193717388 X:84948804-84948826 GTTGGGAGACGGAAGCTGGATGG - Intergenic
1195675997 X:107507398-107507420 GAGGGGAATCAGAAGCTGGGAGG + Intergenic
1196460127 X:115920888-115920910 GTTGGGAGACGGAAGCTGGATGG - Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1197358814 X:125471978-125472000 CATGAGAAAATGAAACTGGATGG + Intergenic
1198265681 X:135006380-135006402 CGTGGGCAACAGTAGCTGGCTGG + Intergenic
1198742537 X:139856303-139856325 GTTGGGAGACGGAAGCTGGATGG - Intronic
1198769826 X:140118640-140118662 CATAGGAAAAAAAAGTTGGAGGG - Intergenic
1199278862 X:145976259-145976281 GTTGGGAGACTGAAGCTGGATGG - Intergenic
1199638410 X:149835588-149835610 GTTGGGAGACAGAAGCTGGATGG - Intergenic
1200752286 Y:6957375-6957397 GTTGGGAGACAGAAGCTGGATGG - Intronic
1200763166 Y:7058373-7058395 GTTGGGAAACGGAGGCTGGATGG + Intronic
1201260027 Y:12149848-12149870 GTTGGGAAACAGAAGCTGGATGG + Intergenic
1201296787 Y:12470575-12470597 GTTGGGAGACAGAAGCTGGATGG + Intergenic
1201372929 Y:13285043-13285065 GTTGGGAGACAGAAGCTGGATGG - Intronic
1201942392 Y:19473938-19473960 CAAAGGCAACAGAAGCTGGTTGG - Intergenic
1202020787 Y:20462905-20462927 CATGGGAAACTCAAACTGGGTGG - Intergenic
1202378903 Y:24259946-24259968 CAAGGGAAACGGATGGTGGAAGG - Intergenic
1202491879 Y:25410175-25410197 CAAGGGAAACGGATGGTGGAAGG + Intergenic