ID: 1165428533

View in Genome Browser
Species Human (GRCh38)
Location 19:35758566-35758588
Sequence TACAAGCCCCAGGATCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165428533_1165428547 30 Left 1165428533 19:35758566-35758588 CCCAGTGGATCCTGGGGCTTGTA 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1165428547 19:35758619-35758641 AGGAATGTATGGGAAATGCTCGG 0: 1
1: 0
2: 1
3: 16
4: 275
1165428533_1165428539 10 Left 1165428533 19:35758566-35758588 CCCAGTGGATCCTGGGGCTTGTA 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1165428539 19:35758599-35758621 CCTTTGCCTTCGTGTCCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 161
1165428533_1165428542 20 Left 1165428533 19:35758566-35758588 CCCAGTGGATCCTGGGGCTTGTA 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1165428542 19:35758609-35758631 CGTGTCCCCCAGGAATGTATGGG 0: 1
1: 0
2: 0
3: 5
4: 70
1165428533_1165428541 19 Left 1165428533 19:35758566-35758588 CCCAGTGGATCCTGGGGCTTGTA 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1165428541 19:35758608-35758630 TCGTGTCCCCCAGGAATGTATGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165428533 Original CRISPR TACAAGCCCCAGGATCCACT GGG (reversed) Intronic
904912961 1:33949254-33949276 TATAAGCCCCTGGATTCCCTGGG + Intronic
904972556 1:34430431-34430453 TCCAGGCTCCAGGATTCACTGGG - Intergenic
907540791 1:55214629-55214651 GAGAAGCCCCAGGCTCCAGTTGG - Intronic
910767230 1:90793853-90793875 AACAAGCCCTAGGTTACACTTGG - Intergenic
916661966 1:166930740-166930762 TACAAGCCCCAGCAACCACCTGG + Intronic
919111782 1:193229187-193229209 TACATACCCCATGATTCACTTGG + Intronic
919930912 1:202221138-202221160 AACAAGCCCCTGGGTCCCCTGGG - Intronic
921643214 1:217581107-217581129 CACCAGCCCCAAGATCCGCTGGG + Intronic
921953539 1:220958417-220958439 TACAATCTCTATGATCCACTTGG + Intergenic
922584406 1:226722842-226722864 TTCTAGCCCCAGGACCCATTAGG - Intronic
923035853 1:230284775-230284797 GTCAAGCCCCAGGATCAACGTGG - Intergenic
923430211 1:233912613-233912635 TACTATCCACAGTATCCACTGGG - Intronic
1063414232 10:5860168-5860190 TACATGCCCCAGGCTCCCCTAGG + Intergenic
1065560994 10:26963602-26963624 TTCATTCCCCAGGATCCACAGGG + Intergenic
1069651879 10:70054435-70054457 CACAGACCCCAGGATCCCCTAGG + Intronic
1070599274 10:77854400-77854422 CACAGGCCCCAGGATTCACACGG + Intronic
1070850202 10:79557139-79557161 TTCCATCCCCAGGATCCACTTGG - Exonic
1075975650 10:126691822-126691844 TAAAATCCCCAGGCTCCACTGGG - Intergenic
1076548751 10:131263992-131264014 TCCAAACCCCAGGAACCACTGGG + Intronic
1078839783 11:15067881-15067903 TTTAAGCCCCAGTATCTACTAGG + Intronic
1080402218 11:31946736-31946758 TCCAAGCCACAGGTCCCACTTGG - Intronic
1084374873 11:68769681-68769703 TTCAAGCCTCAAGATCAACTGGG + Intronic
1087704887 11:101479040-101479062 AACAAGCCTCAGATTCCACTGGG + Intronic
1089311614 11:117561757-117561779 TACTAGCCCCAGAATGCCCTGGG + Intronic
1089518667 11:119049423-119049445 TTCACTCCCCAGGATCCTCTGGG - Intronic
1089822075 11:121237624-121237646 AACAAGCCTCAGATTCCACTGGG - Intergenic
1091263600 11:134253485-134253507 TACAACCCCCAGGGTGCAGTGGG + Exonic
1095859841 12:46904872-46904894 AACAAGCCTCAGATTCCACTGGG + Intergenic
1096086375 12:48867854-48867876 AACAAGGCCCAGGAGACACTGGG - Intergenic
1105636389 13:22219829-22219851 TTCAAGCCACAGGACCCACAGGG + Intergenic
1107651941 13:42553615-42553637 TACAAGCCCCAGGTTCCATGGGG + Intergenic
1109720546 13:66270118-66270140 ACAAAGCCCCAGGATCCATTTGG - Intergenic
1110220216 13:73064420-73064442 TACAAGCCCCAGCCTAAACTTGG + Intronic
1111094900 13:83500316-83500338 TAATAGCCCCAGCATCCAGTAGG - Intergenic
1111842455 13:93467428-93467450 TACAAGCCTCATGCTCCACGAGG - Intronic
1119973323 14:78997177-78997199 TACAAACCCCAGTAGACACTTGG + Intronic
1120216108 14:81682354-81682376 TACAAACCCTAGGATCCTTTGGG - Intergenic
1120636682 14:86961306-86961328 TACGAGCCCCAGTAACCACTTGG + Intergenic
1120907174 14:89630653-89630675 TTCAAGCCTCAGGATCCCCCAGG - Intronic
1121882266 14:97511496-97511518 TACATGCCCCATGCTCAACTGGG - Intergenic
1122131512 14:99606550-99606572 AACAGGCCCCAGGAACCACCAGG - Intergenic
1122571868 14:102709178-102709200 TACATGCCACAGGCTACACTGGG + Intronic
1123138769 14:106055140-106055162 AACACTCCCCAGGTTCCACTGGG + Intergenic
1123220518 14:106851298-106851320 TACCAGCTACTGGATCCACTGGG - Intergenic
1202833293 14_GL000009v2_random:59089-59111 TGCAAGGCCCAGGAGCCATTTGG - Intergenic
1125492810 15:40160960-40160982 TACAAGCCCCAGAATGCCTTGGG + Intergenic
1126827856 15:52569211-52569233 TACAATTCCCAGGAAGCACTCGG - Exonic
1127616089 15:60687203-60687225 TAAAAGCCCTAGGATCCAATGGG + Intronic
1131914656 15:97251782-97251804 TAGAAGCAGCAGGATCAACTAGG + Intergenic
1131975448 15:97941528-97941550 TATAAGCCCCAAGATCAACCAGG - Intergenic
1132671986 16:1105811-1105833 GGCCAGCCCCAGGATCCTCTAGG - Intergenic
1136140063 16:28282660-28282682 TCCAAGCTCCAGGAACCTCTGGG - Intergenic
1136748007 16:32609143-32609165 TAAAATCTCCAGGATCAACTTGG + Intergenic
1138515662 16:57534414-57534436 CACAAGCAACAGGAACCACTGGG - Intronic
1139261861 16:65601834-65601856 TCCAAGCCCGAGGAACCCCTCGG - Intergenic
1139531456 16:67544607-67544629 GACAAGTCCCAGCATGCACTGGG - Intronic
1141892413 16:86935281-86935303 TCCCAGCCCCAGGATCCCCCAGG + Intergenic
1142046758 16:87930475-87930497 TTCAGGCCTCAGGTTCCACTGGG - Intronic
1203050144 16_KI270728v1_random:868350-868372 TAAAATCTCCAGGATCAACTTGG + Intergenic
1143331105 17:6136412-6136434 TAAAACCCACAGGCTCCACTTGG + Intergenic
1146661445 17:34667667-34667689 TACAATCACCAAGATCCTCTTGG + Intergenic
1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG + Exonic
1149155947 17:53630291-53630313 TGCAAATTCCAGGATCCACTAGG + Intergenic
1150300060 17:64040306-64040328 CACAAGGCCAAGGATCCAATGGG + Exonic
1151124325 17:71828441-71828463 CAATAGCCCCAGGATGCACTTGG + Intergenic
1152401619 17:80070033-80070055 AACAAGCCCCAGGCTCAGCTCGG + Intronic
1203165440 17_GL000205v2_random:88983-89005 TTCCAGCCCCAGCATGCACTGGG - Intergenic
1156024945 18:32641875-32641897 CACAAGACACATGATCCACTGGG + Intergenic
1158378414 18:56900650-56900672 TACAAGCCCGATGTTCCCCTAGG - Intronic
1160387193 18:78503818-78503840 TCCAAGCCCCAGGCTCCTCAGGG + Intergenic
1160786405 19:901929-901951 TACAAGGCCCAGGAGCCCCCAGG + Intronic
1162407253 19:10482476-10482498 TACATGTCCCAGGATCCTCCGGG - Intergenic
1163962742 19:20712503-20712525 AACAAGCCTCAGATTCCACTGGG + Intronic
1165428533 19:35758566-35758588 TACAAGCCCCAGGATCCACTGGG - Intronic
1166107938 19:40606582-40606604 TAAAGGCCCCAGGATGCTCTGGG - Intronic
1167501285 19:49850263-49850285 CACAGGCCCCACGGTCCACTGGG - Intergenic
1168281077 19:55305629-55305651 TACAAGTCCCAGCAGCCCCTGGG + Intronic
925253414 2:2461831-2461853 TCCAAGCCCCTGTTTCCACTGGG - Intergenic
926914754 2:17880339-17880361 GCCAGGCCCCAGGATGCACTCGG + Intronic
929769746 2:44881632-44881654 TTCAAGCATCTGGATCCACTGGG - Intergenic
931757651 2:65388439-65388461 TTCAAGGCCCAGGATCAAGTAGG - Intronic
932538068 2:72620259-72620281 TTCAAGCCACAGGATGCAGTGGG + Intronic
936111778 2:109670910-109670932 CCCAAGCCACAGGAACCACTGGG - Intergenic
937886158 2:126901295-126901317 TCCAAGCCCCAGCATCCCCAGGG + Intronic
940841121 2:158583034-158583056 TACATACCCCAGCATCCCCTGGG - Intronic
944440860 2:199742134-199742156 CAGAAGCCCCAGGATGCTCTAGG - Intergenic
946128017 2:217581407-217581429 TAGAAGACCCAGGTTCCATTTGG - Intronic
946888695 2:224251538-224251560 TTTACGCCCCAGGGTCCACTAGG - Intergenic
948126830 2:235570272-235570294 TACAAGCCCCTGCCTCCATTAGG + Intronic
948500639 2:238390836-238390858 TACCAGCCCCTGGAACCACAAGG + Intronic
1170432758 20:16291937-16291959 TACAAGCCCCGGGGTCTACTGGG + Intronic
1171266475 20:23775782-23775804 TTCAAGCCCAAGGATGCTCTTGG - Intergenic
1172464715 20:35147396-35147418 TACAAGCCCCTGAATGCAATGGG + Intergenic
1174176642 20:48649608-48649630 AACAGCCCCCAGCATCCACTGGG + Intronic
1174195425 20:48769429-48769451 TAGGAGCCCCAGCACCCACTAGG + Intronic
1174542694 20:51302509-51302531 TCCAAGCCCCACAGTCCACTGGG - Intergenic
1175281333 20:57806136-57806158 TACAAGTCCTAGGATTCACTTGG + Intergenic
1175477770 20:59288930-59288952 TACAAGCCCGTGGAGCTACTGGG - Intergenic
1176172786 20:63703682-63703704 CAGAAGCCCCAGGAGCCACGTGG - Intronic
1176336246 21:5602469-5602491 TTCCAGCCCCAGCATGCACTGGG + Intergenic
1176391511 21:6218479-6218501 TTCCAGCCCCAGCATGCACTGGG - Intergenic
1176406312 21:6370096-6370118 TTCCAGCCCCAGCATGCACTGGG + Intergenic
1176469908 21:7097695-7097717 TTCCAGCCCCAGCATGCACTGGG + Intergenic
1176493469 21:7479473-7479495 TTCCAGCCCCAGCATGCACTGGG + Intergenic
1176507173 21:7658910-7658932 TTCCAGCCCCAGCATGCACTGGG - Intergenic
1179791428 21:43757928-43757950 CACACGCCCCAGTCTCCACTTGG - Exonic
1184032688 22:41904252-41904274 TACCAGGACCAGAATCCACTTGG + Intronic
949480906 3:4493223-4493245 TACAAGTCCCAGAATCCCCTGGG - Intergenic
953073463 3:39546481-39546503 GACAAGCACCAGAGTCCACTGGG + Intergenic
955419965 3:58726167-58726189 TTTTAGCCCCAGGATTCACTAGG + Intronic
955467488 3:59252274-59252296 TGCAGGCCCCAGGATTCATTGGG + Intergenic
961727818 3:128944449-128944471 CAGATGCCCCAGGACCCACTTGG - Intronic
966135712 3:176695905-176695927 TACAAGGCCCAGGATGATCTGGG - Intergenic
968216915 3:196900184-196900206 TACTTGCCCCAGGATCCAAACGG + Intronic
968790381 4:2656573-2656595 CCCATGCCCCAGGCTCCACTAGG - Intronic
969384011 4:6830884-6830906 TACAAGCACCTGGAACCACAAGG + Intronic
971217088 4:24671757-24671779 TACAGACCCCAGGCTCCAATTGG - Intergenic
976194319 4:82518420-82518442 TACCAGACCCGGGATGCACTGGG + Intronic
980179657 4:129388377-129388399 CACAAGCCCAAGCATCCACCAGG - Intergenic
980199818 4:129641666-129641688 GACAAGACCCAGCATACACTAGG - Intergenic
981255493 4:142656466-142656488 GAAAAGGCCCAGGATCCACAGGG - Intronic
984938633 4:184911998-184912020 AACAAGCCTCAGATTCCACTGGG + Intergenic
985340103 4:188941826-188941848 TACATGCCACAGGAGCTACTAGG - Intergenic
1202766734 4_GL000008v2_random:154476-154498 TCCAAGGCCCAGGAGCCATTTGG + Intergenic
986910419 5:12548955-12548977 TCCAACCCCCAAGACCCACTGGG + Intergenic
987288702 5:16487514-16487536 TACAAGCCCCAGCCTCTACATGG + Intronic
987876562 5:23688273-23688295 AACAAGCCTCAGATTCCACTGGG - Intergenic
987956738 5:24750405-24750427 AACAAGCCTCAGATTCCACTGGG + Intergenic
990182942 5:53182901-53182923 TACAATACCCAGGACCCACATGG - Intergenic
992127186 5:73654120-73654142 TACCAGCCCCTGGCTGCACTGGG + Intronic
996110746 5:119563622-119563644 CCCCAGCCCCAGCATCCACTCGG + Intronic
997242561 5:132318582-132318604 TACCTGCCCCAGGAACCGCTGGG - Intronic
1000867104 5:166527263-166527285 AAAATTCCCCAGGATCCACTGGG - Intergenic
1002080627 5:176735192-176735214 AACAAGCCCCTGGATCCAGCTGG + Intergenic
1003277282 6:4663516-4663538 TACATGCACCAGGATCAAGTGGG - Intergenic
1006916845 6:37600273-37600295 CACAAGCCCCAGGACCCACCTGG + Intergenic
1007497921 6:42274109-42274131 TAGCAGCCCCAGGATCACCTGGG + Intronic
1009305371 6:62083150-62083172 TAAAAACCCCAGGCTTCACTGGG + Intronic
1009957348 6:70471606-70471628 TATCAGGCCCAGCATCCACTAGG - Intronic
1014997780 6:128172969-128172991 TATGAGCACCAGGAACCACTAGG + Intronic
1016692081 6:146949742-146949764 TACCAGCCACAGGATTCATTTGG + Intergenic
1019975962 7:4581786-4581808 TAAAAGCCTCAGGACCCAGTGGG + Intergenic
1021752331 7:23814954-23814976 TAGGAGCCCCAGGAACCATTTGG + Intronic
1022453471 7:30537272-30537294 AACAAGCCTCAGATTCCACTGGG - Intronic
1022623027 7:32004507-32004529 CACAACCCCCAGGACTCACTTGG - Intronic
1023807853 7:43886953-43886975 TACAAGCCCCAGTGTGCTCTGGG + Intronic
1023996519 7:45162076-45162098 TGCAAGCCCCAGGGACCACGTGG - Intronic
1024450982 7:49542588-49542610 TACCACCCCCAGGACCTACTGGG - Intergenic
1024773565 7:52755281-52755303 AACAAGCCTCAGCATCCTCTAGG + Intergenic
1028077959 7:86537877-86537899 TACATGCCAGGGGATCCACTTGG + Intergenic
1028398856 7:90403357-90403379 TACAATTCCCAGAATCCACTGGG - Intronic
1030556876 7:111036532-111036554 TATAAGCATCAGGATCCTCTAGG + Intronic
1032897124 7:136263673-136263695 AACAAGCCTCAGATTCCACTGGG + Intergenic
1033875806 7:145817447-145817469 TGAAAGCCCCAGGCTCCACTGGG + Intergenic
1034372775 7:150614920-150614942 AACAAGCCTCAGATTCCACTGGG + Intergenic
1034852997 7:154513694-154513716 TACAAGGCCCAGACCCCACTGGG - Intronic
1035060360 7:156064711-156064733 TATGAGCCCAAGGATCCACAGGG - Intergenic
1035204924 7:157289142-157289164 TCCCAGCCAGAGGATCCACTGGG + Intergenic
1035922880 8:3696979-3697001 TAGGGGCCCCAGGATCCAGTAGG + Intronic
1037764278 8:21762335-21762357 TCAAAGCCCAAGGATCCAATGGG + Intronic
1039500084 8:38009748-38009770 TACAAAGCCCAGCATCCATTAGG + Intergenic
1044144754 8:88698243-88698265 TAAAATGCCCAGCATCCACTGGG - Intergenic
1048455678 8:134576255-134576277 TATAAACCACAAGATCCACTGGG - Intronic
1049437516 8:142594612-142594634 ACAAAGCCCCAGGAGCCACTTGG - Intergenic
1052987456 9:34498195-34498217 AACAAGCTCCAGCATTCACTGGG + Intronic
1057504877 9:95625872-95625894 TTCAATCCCCAGGATCCAAGAGG + Intergenic
1059756612 9:117299676-117299698 TACAAGTGCCAGGTCCCACTTGG + Intronic
1060326399 9:122620380-122620402 TACACCCCCCAAGATCAACTGGG - Intergenic
1061053138 9:128207747-128207769 AACAATCCCCAGGAAGCACTCGG + Intronic
1203425397 Un_GL000195v1:32433-32455 TTCCAGCCCCAGCATGCACTGGG - Intergenic
1193667249 X:84336737-84336759 TTCAAGCCCAAGTATCCAGTTGG - Intronic
1195308955 X:103611380-103611402 TACTTGCCCAAGGATACACTGGG - Intronic
1195753260 X:108177801-108177823 TGCAAGCCCCAGGATTCAAATGG + Intronic
1196314768 X:114209974-114209996 TACATGCCAGAGGATCCATTTGG - Intergenic
1196687898 X:118528211-118528233 TACAAGCCCTGGGATCAACTGGG - Intronic