ID: 1165428963

View in Genome Browser
Species Human (GRCh38)
Location 19:35761130-35761152
Sequence CAGGGTATGAAATGTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165428963_1165428968 17 Left 1165428963 19:35761130-35761152 CCAAAATCACATTTCATACCCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1165428968 19:35761170-35761192 CACGTGGTCACAAGGCTACAAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1165428963_1165428967 9 Left 1165428963 19:35761130-35761152 CCAAAATCACATTTCATACCCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1165428967 19:35761162-35761184 AACTTAGTCACGTGGTCACAAGG 0: 1
1: 0
2: 2
3: 13
4: 87
1165428963_1165428969 18 Left 1165428963 19:35761130-35761152 CCAAAATCACATTTCATACCCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1165428969 19:35761171-35761193 ACGTGGTCACAAGGCTACAAGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1165428963_1165428970 25 Left 1165428963 19:35761130-35761152 CCAAAATCACATTTCATACCCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1165428970 19:35761178-35761200 CACAAGGCTACAAGGGTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 82
1165428963_1165428966 1 Left 1165428963 19:35761130-35761152 CCAAAATCACATTTCATACCCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1165428966 19:35761154-35761176 TTGTCAAGAACTTAGTCACGTGG 0: 1
1: 0
2: 12
3: 77
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165428963 Original CRISPR CAGGGTATGAAATGTGATTT TGG (reversed) Intronic
907667355 1:56445061-56445083 AAGGTTATGCAATGTGAGTTGGG - Intergenic
908674052 1:66581765-66581787 CATGGCATCAAATGTGAGTTAGG + Intronic
909350371 1:74645538-74645560 CAGGGTGTTAAGTGAGATTTTGG + Intronic
910414262 1:86981622-86981644 CATGGAATCAAATGAGATTTTGG - Intronic
910465695 1:87496889-87496911 CAGGGGATCAATTGGGATTTAGG - Intergenic
911387850 1:97199492-97199514 CATAGTATGAAATTTAATTTTGG - Intronic
911744239 1:101422042-101422064 GAGGGTATGAAATGTACTATGGG + Intergenic
914360506 1:146931971-146931993 CAGGGGATCAATTGGGATTTAGG - Intergenic
914493241 1:148167927-148167949 CAGGGGATCAATTGGGATTTAGG + Intergenic
917005155 1:170406948-170406970 TAGTGTATGAAACATGATTTAGG + Intergenic
921574565 1:216819476-216819498 CATGAAGTGAAATGTGATTTGGG - Intronic
921663663 1:217839639-217839661 CAGTGTATCAAATTTTATTTTGG - Intronic
921807097 1:219467564-219467586 CAGGCACTGAAATGTGTTTTGGG - Intergenic
922875385 1:228936307-228936329 CAGGGTTTGACCTTTGATTTGGG - Intergenic
923007091 1:230058702-230058724 TAGTTTATCAAATGTGATTTAGG - Intronic
923121561 1:230997204-230997226 CAGAGTATGGAATGGGATGTTGG + Exonic
923586552 1:235277966-235277988 CAGGTTTTAAAATCTGATTTTGG - Intronic
1064882721 10:20074659-20074681 AAGAGTATGAAATATTATTTGGG - Intronic
1066179492 10:32946089-32946111 CGGGTTAAGAAATGTGTTTTAGG + Intronic
1067150602 10:43729521-43729543 CAGGATGAGAAGTGTGATTTCGG - Intergenic
1068107397 10:52635871-52635893 CAGGGTATGAAATATTTTTATGG - Intergenic
1070121832 10:73584992-73585014 CATGGTGTGGAATGTGTTTTAGG - Intronic
1070959727 10:80490184-80490206 CAGGTTCTGAGATGGGATTTGGG + Intronic
1071928611 10:90440230-90440252 CAGAGTAAGAAGTTTGATTTTGG + Intergenic
1073041907 10:100613465-100613487 AAGGGTATGCCCTGTGATTTGGG + Intergenic
1073586264 10:104712958-104712980 CAGGGTATGGTATGTGCTATGGG + Intronic
1074730086 10:116362137-116362159 AAGGGTATGAAAAGCGATCTCGG - Intronic
1074994490 10:118744509-118744531 ATGGGTATGGAATGTTATTTTGG + Intronic
1078292673 11:10028888-10028910 CAGAATATTAAATGTGAGTTTGG - Intronic
1078737476 11:14033619-14033641 ATGGGTATGGCATGTGATTTAGG + Intronic
1079553540 11:21731242-21731264 GAGGGGATGAAATGAGATTCAGG + Intergenic
1080924025 11:36737424-36737446 CAGTGTAGGAACTGTGAATTGGG + Intergenic
1081549695 11:44099766-44099788 CAGTGTATGAAAGGTGATGTGGG + Intronic
1081852708 11:46284966-46284988 TAGGGTGTGAAATGGGATGTGGG - Intronic
1087229314 11:95641813-95641835 GAGAGTAAGAAAGGTGATTTAGG + Intergenic
1087348011 11:96996132-96996154 CAATCTATGAAATGTCATTTAGG - Intergenic
1088941120 11:114457333-114457355 CAGGATAAGAAACATGATTTTGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090073684 11:123565379-123565401 CATGATATTAAATGTGATATTGG - Intronic
1090127353 11:124101175-124101197 CAGAAGATGAAATGAGATTTAGG - Intergenic
1093002907 12:14018253-14018275 AAGGGAATGAAATGTGCTATAGG - Intergenic
1093201640 12:16194189-16194211 CAGGGTAAGAAATTTCAATTTGG - Intronic
1095867274 12:46985509-46985531 CAGGATATGAAATTTATTTTTGG - Intergenic
1095871070 12:47028706-47028728 AAAGGTTTTAAATGTGATTTGGG + Intergenic
1096761470 12:53845462-53845484 CAGGGTTAGAATTGGGATTTGGG - Intergenic
1098636279 12:72787842-72787864 AAGGAAATGAAATGGGATTTGGG - Intergenic
1099240627 12:80134488-80134510 GAAGGAATGACATGTGATTTTGG + Intergenic
1100448321 12:94681525-94681547 CTGGGGATGACATGAGATTTGGG - Intergenic
1101065734 12:101018508-101018530 CAGGGCTGGAAATGTGACTTTGG - Intronic
1101782997 12:107852474-107852496 CTGCATATGATATGTGATTTTGG + Intergenic
1104459504 12:128943448-128943470 CAGGTTGAGAAATGTGTTTTAGG - Intronic
1105539641 13:21304424-21304446 CAGGGTATGAAACCTCCTTTTGG - Intergenic
1105798699 13:23883805-23883827 CAGGGTATGAAACCTCCTTTTGG + Intronic
1106214089 13:27678778-27678800 CAGGCAATCAAATGGGATTTTGG + Intergenic
1106984031 13:35323148-35323170 CATGGTTAAAAATGTGATTTAGG - Intronic
1107645197 13:42487301-42487323 AAGGATATAAAATGTAATTTTGG + Intergenic
1108004857 13:45935994-45936016 AAGGCTGAGAAATGTGATTTTGG - Intergenic
1108398746 13:50017065-50017087 AAGAGTTTGAAATGTCATTTTGG + Intronic
1108890906 13:55258016-55258038 CAGGGAATGTAATGCCATTTTGG - Intergenic
1109862540 13:68219202-68219224 CTTTCTATGAAATGTGATTTAGG - Intergenic
1110597499 13:77335348-77335370 CAGAGTCTGAAATGGAATTTTGG + Intergenic
1111085757 13:83373486-83373508 CAGGTTAAGAAATGTCATCTTGG + Intergenic
1111476842 13:88761123-88761145 CATGGTTTGAATTTTGATTTGGG + Intergenic
1111855492 13:93632013-93632035 AAGATTCTGAAATGTGATTTGGG + Intronic
1112466846 13:99652267-99652289 CAGGGGGTGAAGTGTGTTTTGGG + Intronic
1112895308 13:104292437-104292459 CAGGGGAGGAGATGTGACTTTGG - Intergenic
1113121373 13:106926871-106926893 AAGAGAATCAAATGTGATTTAGG - Intergenic
1120930151 14:89839958-89839980 CTGGATATGAGATGAGATTTGGG + Intronic
1122291219 14:100681421-100681443 CTGGGTATGAGCTGGGATTTGGG + Intergenic
1130522536 15:84673539-84673561 CAGTGTATGGAATGGGAGTTTGG - Intronic
1130667245 15:85880030-85880052 CGAGGGATGAAATGTGGTTTTGG + Intergenic
1133153504 16:3854854-3854876 TAAGGAATGAGATGTGATTTAGG + Intronic
1135545841 16:23365880-23365902 CAGGCTGTGAAATGGGATATGGG - Intronic
1138214527 16:55191570-55191592 CTGGGTTTGAAAGGTGAGTTGGG + Intergenic
1139081453 16:63526808-63526830 CATGGTACGGATTGTGATTTTGG - Intergenic
1139557229 16:67719878-67719900 CTGTGTAGGAAATGTGATTGGGG + Intergenic
1144354795 17:14435059-14435081 CAGGCTTTGGCATGTGATTTTGG + Intergenic
1144592663 17:16537627-16537649 CAGGCCATGAACTGTTATTTTGG - Intergenic
1146671632 17:34741899-34741921 AAGGGGATGGAAGGTGATTTGGG + Intergenic
1147683492 17:42271290-42271312 CAGGCTACTAAATGTGAATTTGG - Intronic
1148916232 17:50981608-50981630 TAGGGAAAGAAATGTGATTTGGG + Intronic
1149127576 17:53254450-53254472 CAGTGTAGGAACTATGATTTGGG - Intergenic
1149480632 17:57000509-57000531 CAGGGAATAAATTGTGCTTTGGG - Intronic
1149718284 17:58816507-58816529 ATGGGTATGAAGTCTGATTTGGG - Intronic
1153618402 18:6954373-6954395 TGGGGGATGAATTGTGATTTGGG + Intronic
1155095716 18:22553896-22553918 CAGGGCTTGAATCGTGATTTCGG + Intergenic
1156322406 18:36038787-36038809 CAGGGAGTCAAAGGTGATTTTGG + Intronic
1156812639 18:41271581-41271603 CAAGGTATGTGATATGATTTGGG + Intergenic
1158409557 18:57193403-57193425 CAGGGTATGAGAAGTGAATTTGG - Intergenic
1164661712 19:29978276-29978298 TAGGTGATGAAATGTGATTAGGG - Intronic
1165276507 19:34757065-34757087 CACTGTATGCAATGTTATTTAGG + Intergenic
1165428963 19:35761130-35761152 CAGGGTATGAAATGTGATTTTGG - Intronic
1166219677 19:41356323-41356345 AAGGGTAAGAAGTGGGATTTAGG + Intronic
1166279273 19:41779986-41780008 CAGGGTCTGAAATGAGCCTTAGG + Intergenic
1167140873 19:47649875-47649897 CAGATTCTGAAATGAGATTTAGG + Intronic
925113423 2:1355079-1355101 CACGGTGTGAAATGTGTTGTAGG - Intronic
925737937 2:6980513-6980535 CATGGAATCAAAAGTGATTTTGG - Intronic
926577924 2:14602813-14602835 TAAAGTATGAAATTTGATTTAGG - Intergenic
928243944 2:29611120-29611142 CTGGGAATCAAATGTGATTTGGG + Intronic
928297389 2:30096337-30096359 CAGGGAAAGAAAAGTGATTTTGG - Intergenic
928740150 2:34342054-34342076 CAGGGTTTGGAATGTGGGTTGGG + Intergenic
930309795 2:49726250-49726272 CACAGTTTGATATGTGATTTGGG - Intergenic
932720414 2:74134748-74134770 CTGGGTCTGCAGTGTGATTTGGG - Intronic
933508185 2:83204817-83204839 TAGGGTATCTAATGTGACTTGGG - Intergenic
934153060 2:89168233-89168255 CAGTATATGAAATGAGATTCAGG + Intergenic
934214180 2:90013698-90013720 CAGTATATGAAATGAGATTCAGG - Intergenic
936602253 2:113909341-113909363 CAGCCTAGGAAATTTGATTTTGG + Intronic
936747467 2:115595067-115595089 CAGAATTTGAAATTTGATTTTGG + Intronic
936972970 2:118192421-118192443 AAGGGTATGTAATGTGCTTGGGG + Intergenic
937222168 2:120347912-120347934 CAGAGTTAGAAATGTGATTCTGG + Intronic
938104391 2:128520212-128520234 TAGGAAATGAAATGGGATTTTGG + Intergenic
939034353 2:137113143-137113165 GAGGGTTTGAAATGAGATCTTGG + Intronic
940201325 2:151154160-151154182 CAGAATATGAAGTGTGTTTTCGG + Intergenic
941191956 2:162395749-162395771 CAGGGTATTAAATGGCATCTAGG + Intronic
943400198 2:187399213-187399235 CTGGGCATGGAATGTGCTTTGGG - Intronic
944050967 2:195469346-195469368 CAGGGTGTGAAATCTTATTTTGG - Intergenic
944096710 2:195976105-195976127 CAGAGTATGAAGTGGGATCTCGG + Intronic
944225224 2:197342905-197342927 AAGGGTATGAAATTTCAGTTAGG + Intergenic
946049273 2:216848432-216848454 GAGAATGTGAAATGTGATTTTGG + Intergenic
947240465 2:227988999-227989021 AAGGGTATGAAAAATGAATTAGG + Intronic
947515099 2:230796722-230796744 CAGAGGATAAAATGTGGTTTGGG + Intronic
1169600750 20:7258079-7258101 CAGGGTATGTATTCTGCTTTTGG - Intergenic
1170802185 20:19599677-19599699 CAGGGATTGAAATGTGGTGTGGG + Intronic
1172002304 20:31788736-31788758 GAGGGTGTGAAATGTGAACTTGG + Intronic
1172178004 20:32984291-32984313 GTGGGCATGAAATGAGATTTTGG + Intronic
1172250554 20:33476195-33476217 GGGGTTATAAAATGTGATTTTGG + Intergenic
1172305168 20:33875471-33875493 CTGGGTATGAAATGAGATGATGG - Intergenic
1173366042 20:42386218-42386240 CAGGCTCTAAAATGGGATTTTGG - Intronic
1174151373 20:48488759-48488781 CAGGGCATGAGATGTCATTGGGG + Intergenic
1174876272 20:54229692-54229714 AAAGGCATGAAATGTCATTTGGG + Intergenic
1177350582 21:19935622-19935644 CAGTGTTAGAAATGTCATTTAGG + Intergenic
1177632491 21:23745832-23745854 CAGGTGATGACATGAGATTTGGG - Intergenic
1178587527 21:33882572-33882594 CAGGAGTTGAAATGCGATTTAGG + Intronic
1179043691 21:37827138-37827160 CAGGGAATGATATTTGGTTTGGG + Intronic
1182957614 22:34442066-34442088 CTGGGGATGAAATGTGAGTGTGG - Intergenic
1183494091 22:38132683-38132705 CAGGGTCTGAACTGAGCTTTGGG + Intronic
1184456593 22:44614242-44614264 CAGGGTAGGAAATGTGCTGAGGG + Intergenic
950509069 3:13414755-13414777 CAAGGCATGGAATGTGTTTTGGG - Intronic
951093403 3:18600872-18600894 CAGGGTACTAAATGTGAATTAGG + Intergenic
951215229 3:20017960-20017982 CAGGAAAAGAAATGTGATTGAGG + Intergenic
955343941 3:58147131-58147153 CAGGGGATGGAATGCAATTTTGG + Intronic
957324147 3:78670717-78670739 CAAGTTATGAAATGTCAATTTGG - Intronic
957843257 3:85698737-85698759 CAGGGAATTACATGAGATTTGGG + Intronic
960543185 3:118882981-118883003 GAGGAAAAGAAATGTGATTTGGG + Intergenic
964278042 3:155028880-155028902 TAGTGTTTGAAATTTGATTTGGG + Intronic
967349033 3:188491286-188491308 CTGGGTATGAAAAGAGATGTCGG + Intronic
970044783 4:11839621-11839643 CAGGGTAATAAATGATATTTAGG + Intergenic
971872019 4:32253374-32253396 CAGGAAAAGAAATGTGGTTTTGG - Intergenic
972490936 4:39586593-39586615 AAGGGCATTAAAGGTGATTTTGG - Intronic
973770080 4:54198261-54198283 CAGTATATGAACTGGGATTTTGG + Intronic
974170059 4:58254925-58254947 AAAAGTATGAAATGAGATTTTGG + Intergenic
976443704 4:85106468-85106490 CAGGGAAAGAACAGTGATTTTGG - Intergenic
976706780 4:88027314-88027336 CAGGGGATCAAAGGAGATTTTGG + Intronic
977847979 4:101788695-101788717 CAGGCTATGAAATCAGATCTAGG + Intronic
977864075 4:102002108-102002130 CAGGAAATGAAATGAGAATTTGG - Intronic
978840623 4:113207933-113207955 CAGGGGATGAAGTGTGCTATGGG + Intronic
979786547 4:124722171-124722193 CTGGGTATTACATGAGATTTGGG - Intergenic
980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG + Intergenic
982404869 4:155008374-155008396 CAGGGTTTTAAATGCCATTTAGG + Intergenic
982597054 4:157399718-157399740 CTGGGTCTGAAATGTGGTGTTGG - Intergenic
983160325 4:164405574-164405596 CAGGTTAAGAAATGAGAATTTGG - Intergenic
983471359 4:168159807-168159829 CAGTGTATGAAAGGTGGTGTTGG + Intronic
984781759 4:183532864-183532886 CAGGGTGTGGAATCTGCTTTTGG + Intergenic
986925658 5:12745730-12745752 CAGGAAATAAAATGTGGTTTAGG + Intergenic
987802719 5:22719663-22719685 CAAGGTATTAGATGTCATTTTGG + Intronic
988033394 5:25795813-25795835 CAGGCTCAGAAATGTGATTAAGG - Intergenic
988095095 5:26596763-26596785 TATGGTTTGAAATGTAATTTAGG - Intergenic
988241208 5:28611481-28611503 CATGGTCTGCAATGTGATTGCGG - Intergenic
990065245 5:51705001-51705023 CAGGGTATGATATATAATTCAGG - Intergenic
991429872 5:66533376-66533398 CAGGGTATGAAATGTTATCTAGG - Intergenic
991635481 5:68700101-68700123 CTGGGGATGGAATGTGACTTTGG - Intergenic
992086365 5:73281491-73281513 CAGGGGCTGGAATTTGATTTGGG - Intergenic
993133794 5:83931571-83931593 TAGGGCTTGAAATGTGATATAGG + Intergenic
995261765 5:110112550-110112572 AAGGCTATGAATTGTGGTTTTGG - Intergenic
995633030 5:114154491-114154513 CAGGCTCAGAAATTTGATTTTGG + Intergenic
995993644 5:118272502-118272524 CTTGGTATGATATGTGATTTGGG - Intergenic
998231108 5:140361971-140361993 CAGAATATGAAAGGTTATTTGGG - Intronic
998800806 5:145866862-145866884 CAGGGAATGAACTGTGACTTTGG - Intronic
999614020 5:153402806-153402828 CTGGTTATAAAATGTGATTCTGG + Intergenic
999926504 5:156384697-156384719 AATGGTATCAGATGTGATTTGGG + Intronic
1001346641 5:170906894-170906916 TAAGGTCTGAAGTGTGATTTTGG + Intronic
1003134067 6:3419417-3419439 TATGGTTTCAAATGTGATTTTGG + Intronic
1003219634 6:4147431-4147453 TAGGGTTTTAAATGTGATGTTGG + Intergenic
1004426134 6:15508401-15508423 CAATGTATGGAAGGTGATTTTGG - Exonic
1004919255 6:20360813-20360835 CAGGCTATCCAGTGTGATTTAGG - Intergenic
1007829316 6:44626517-44626539 CAGGAGATGAAGTGTGGTTTGGG + Intergenic
1008029090 6:46672957-46672979 CAGAGTTTGAGATGTTATTTTGG + Intronic
1008356183 6:50556089-50556111 GAGGGTATGAAAAGTGATATAGG + Intergenic
1009919068 6:70034242-70034264 CAGGGTTTGAAAGGTGACTTGGG + Exonic
1010248243 6:73682090-73682112 CTGGTTTTGAAATGAGATTTGGG - Intergenic
1010262101 6:73829374-73829396 CTGGGTATGAAATGGGATCCTGG + Intergenic
1010370533 6:75101862-75101884 CAGGGTATGAAATGGAAATGAGG + Intronic
1010438652 6:75865664-75865686 AAGGGTAAGAAAAGTGATGTTGG - Intronic
1010974551 6:82297488-82297510 CACAGTATGAGATGAGATTTGGG + Intergenic
1011030765 6:82920246-82920268 CAGGCTAACAAATGTGTTTTTGG + Intronic
1011255989 6:85421622-85421644 CAGGATCTGAAATGTCATCTCGG + Intergenic
1015352448 6:132237175-132237197 CAATGAATGAAAGGTGATTTAGG - Intergenic
1016882499 6:148924461-148924483 CAGGGAATGAAAGGGGAGTTGGG + Intronic
1019229666 6:170548792-170548814 CAGGGTACCAAAAGTGCTTTCGG - Intronic
1023765211 7:43504273-43504295 CAAGGTCAGGAATGTGATTTTGG - Intronic
1024301729 7:47892176-47892198 CAGGGTAGGATCTGTCATTTTGG + Intronic
1024894281 7:54239494-54239516 CAGAGTATGAAATGTGACCTAGG + Intergenic
1028357361 7:89925578-89925600 CAGGGGATGAAATGCCATTTGGG - Intergenic
1030526662 7:110662420-110662442 CAGGGTATGAAGTTCGAGTTGGG + Intergenic
1030733275 7:113014818-113014840 GAGGGTTTGAGATTTGATTTTGG + Intergenic
1030840175 7:114341827-114341849 CAGACTATAAAATGTCATTTTGG - Intronic
1031794236 7:126151367-126151389 AAGGGTCTGAAATGGGCTTTTGG - Intergenic
1032563950 7:132921349-132921371 CAGGCTCTGAAATTTCATTTAGG + Intronic
1032984686 7:137324949-137324971 CAGAGTATGAAATATCAATTGGG + Intronic
1033966345 7:146979476-146979498 CATGGAATGAAATGTAATTGTGG - Intronic
1033974826 7:147088141-147088163 AAGGTTTTGAAATGTGAATTAGG - Intronic
1035071297 7:156147029-156147051 CAGGGTATTAAGTGGGATTAAGG + Intergenic
1037090855 8:14916316-14916338 CTGAGTAAGAAATGTGATTTGGG - Intronic
1037640757 8:20740830-20740852 AAGGATATGAAATTTCATTTGGG - Intergenic
1041985053 8:63911432-63911454 AAAGGTATGAAATATGATTCAGG + Intergenic
1042239276 8:66646365-66646387 CAGGGTATTAAATGCATTTTGGG - Intronic
1042716657 8:71780636-71780658 CAGGGGATGAAATGTGCTGATGG - Intergenic
1045350566 8:101334556-101334578 AAGGGTATGAAGTGGGCTTTGGG - Intergenic
1048525555 8:135199169-135199191 TTGGATATAAAATGTGATTTAGG - Intergenic
1048568958 8:135634212-135634234 CAAGCTATAAAATGTGATTTGGG - Intronic
1049481167 8:142823714-142823736 CAGGTTATGAAATGTGCAGTTGG + Intergenic
1050348008 9:4712154-4712176 CAGGTTAAGAAATGTGTTTTAGG - Exonic
1050397852 9:5218498-5218520 CAGGGAATGAAATGTGCAGTAGG + Intergenic
1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG + Intronic
1050987457 9:12101734-12101756 CAGGGCATCAAAAGAGATTTTGG - Intergenic
1052831162 9:33216997-33217019 CAGGGAATGAAGTTTGAGTTTGG - Intergenic
1054360590 9:64111530-64111552 CAGGGTAAGAATTGTGATAAAGG + Intergenic
1055421638 9:76149541-76149563 CAATGAATGAAATGGGATTTTGG - Intronic
1057002737 9:91527719-91527741 ATGGGTATGAAATTTCATTTTGG + Intergenic
1060252826 9:121999850-121999872 CAGGGTATAAAATGTGTGATTGG - Intronic
1189427749 X:40916621-40916643 CAGGGTTTGGGATGGGATTTGGG + Intergenic
1191613119 X:63137699-63137721 CTGGGTAGGAAATATGCTTTGGG + Intergenic
1191623178 X:63241227-63241249 CTGGGTAGGAAATATGCTTTGGG - Intergenic
1193979569 X:88165245-88165267 CAATGTATGAATTGTGAATTGGG - Intergenic
1196692825 X:118578998-118579020 CTGGGTATGAACTGACATTTGGG - Intronic
1199446353 X:147926925-147926947 GAGAGGATGAAAGGTGATTTAGG + Intronic
1199498040 X:148475884-148475906 CTGGGTATGGAAACTGATTTGGG - Intergenic
1200342652 X:155414904-155414926 CATGTTATAAAATGTGATTATGG + Intergenic
1201736356 Y:17266625-17266647 CAGGGTATGAAGAGTGGTGTGGG - Intergenic