ID: 1165429450

View in Genome Browser
Species Human (GRCh38)
Location 19:35764185-35764207
Sequence CAGTGACTCCAGTGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165429441_1165429450 10 Left 1165429441 19:35764152-35764174 CCTTGGGGTCTCTAGGCTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 211
1165429444_1165429450 -8 Left 1165429444 19:35764170-35764192 CCCATGGTCCTGGCTCAGTGACT 0: 1
1: 0
2: 0
3: 24
4: 280
Right 1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 211
1165429445_1165429450 -9 Left 1165429445 19:35764171-35764193 CCATGGTCCTGGCTCAGTGACTC 0: 1
1: 1
2: 0
3: 61
4: 519
Right 1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 211
1165429439_1165429450 20 Left 1165429439 19:35764142-35764164 CCAGGATGGTCCTTGGGGTCTCT 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165429450 Original CRISPR CAGTGACTCCAGTGGGAAGT GGG Intronic
900187239 1:1338139-1338161 CAGTGGCTCCAGTGGGACTTCGG - Exonic
902055458 1:13596909-13596931 CAGTGACTGCAGTGGGTGGCCGG + Intronic
903386647 1:22931199-22931221 CAGTAACTACAGTCGGAAGTTGG - Intergenic
903460449 1:23516959-23516981 CAGCAACCCCAGTGGGAAGGGGG - Intronic
903677677 1:25074638-25074660 TAGTGACTCCAGTGGCCAGGTGG - Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906706189 1:47896497-47896519 CAGAGACCCTGGTGGGAAGTGGG + Intronic
906716307 1:47972233-47972255 CAGTGGCTCCCATGGGTAGTGGG - Intronic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915489726 1:156244339-156244361 CACTGCCTCCAGCTGGAAGTGGG + Exonic
915598979 1:156910521-156910543 TAGTTACTGCAGTGGGAAGGTGG + Intronic
915898560 1:159829867-159829889 CAGTAACTGTAATGGGAAGTAGG - Exonic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
923631964 1:235655813-235655835 AGGTGACTCAAATGGGAAGTGGG - Intergenic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
924637141 1:245798919-245798941 CAGTGAGTCCAGTTGGAAGCAGG - Intronic
1064186955 10:13170192-13170214 AAGTGATTACAATGGGAAGTGGG + Intronic
1065061329 10:21904385-21904407 AAGTGACTCCACTAGGGAGTGGG + Intronic
1065663101 10:28026496-28026518 CAGTGATTGCATTAGGAAGTAGG + Intergenic
1068556042 10:58460129-58460151 CAGTGAGTGCCGTGGGAAATGGG - Intergenic
1068919031 10:62463950-62463972 CACTGACACCAGCGGGATGTAGG + Intronic
1068937704 10:62652085-62652107 CAGGGACCCCAGGTGGAAGTGGG + Intronic
1069581566 10:69570249-69570271 CAGTGACCCAGGTGGAAAGTTGG + Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070313996 10:75294120-75294142 CAGCGTCTCCTTTGGGAAGTGGG + Intergenic
1070461796 10:76677720-76677742 GAGAGACCCCAGTGGGAAATTGG - Intergenic
1070490846 10:76975112-76975134 CAGCGACACCAGTGAAAAGTGGG + Intronic
1071827180 10:89336842-89336864 CCGTGACTCCACTGGTAAGAAGG + Intronic
1072735516 10:97876521-97876543 AACTCACTCCAGTGGGAAGGTGG - Intronic
1074075397 10:110119067-110119089 AAGTGAATAAAGTGGGAAGTGGG + Intronic
1075444350 10:122503426-122503448 CAGTGGCTCCTGTGGGGAGCTGG + Intronic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1076299351 10:129413055-129413077 CGGGGACTCTAGTGGGAGGTAGG - Intergenic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1076992261 11:281578-281600 CAGCAACTCCAGTGGGTAGTTGG - Exonic
1077499937 11:2904743-2904765 CAGGGGCTGCAGTGGGAAGGGGG + Intronic
1081284334 11:41248988-41249010 CAGTGGCTATAGTGAGAAGTGGG - Intronic
1082254031 11:50012697-50012719 TAGTCACTTCAGGGGGAAGTGGG - Intergenic
1083642670 11:64153842-64153864 CAGTGAGTCCTCTGGGAGGTGGG - Intronic
1084153055 11:67300060-67300082 CCGTGACTCCAGGCTGAAGTTGG - Exonic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085074654 11:73580219-73580241 CAGTGACGGCAGCGGGACGTAGG - Intronic
1087136420 11:94725184-94725206 CAGGGACTCCAGTGGCATGCTGG + Intronic
1089616113 11:119695767-119695789 TCATGCCTCCAGTGGGAAGTGGG + Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1090504143 11:127292427-127292449 CAGTGGCGCAAGTGGGAAATTGG - Intergenic
1094553929 12:31479381-31479403 CAGTGACTGCAGAGAGAAATAGG - Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095281969 12:40362600-40362622 CAGTGACACCAGTGGGGAAAAGG + Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1096761590 12:53846082-53846104 CAGTGACTGCAGTGGGAGGGTGG - Intergenic
1097183000 12:57181441-57181463 CAGTGCCTCCAGTAGGATTTTGG + Intronic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1100535962 12:95509472-95509494 AAGTGACGCCAGTCGGAGGTTGG + Intronic
1101994375 12:109514361-109514383 CAGCGACTGCAGTGGACAGTTGG - Intronic
1105811739 13:24001646-24001668 CAGTGACTTGGGTGGGAAGCAGG + Intronic
1107819431 13:44272866-44272888 CAGTACCTCCAGGGGCAAGTAGG + Intergenic
1107854053 13:44597433-44597455 CAGAGACTACAGTTGGACGTTGG - Intergenic
1108693825 13:52885142-52885164 TAGTAACACTAGTGGGAAGTGGG + Intergenic
1109720148 13:66265553-66265575 CAGTGACTCCTGATGGAAGAAGG + Intergenic
1111845987 13:93508997-93509019 AGGTGACTCCACTGGGAAGATGG + Intronic
1113913111 13:113853965-113853987 CACTGCCTCCTGTGGGCAGTGGG - Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1117863293 14:60116234-60116256 CTGGGACTACAGTGGGTAGTAGG - Intronic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119643046 14:76329139-76329161 CAGTAACTCCAGTGTCAAATTGG + Intronic
1119705656 14:76781234-76781256 CATTGACCCCAGGGGGAACTTGG - Exonic
1120247326 14:82022603-82022625 AAGGGACTCCTGTAGGAAGTGGG + Intergenic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1122328109 14:100894880-100894902 CACTGCCCCCAGTGGGCAGTGGG + Intergenic
1202859432 14_GL000225v1_random:72304-72326 CACGGACTCCACTGGGACGTGGG + Intergenic
1125967133 15:43883573-43883595 AAGGGCCTCCAGTGGCAAGTAGG - Intronic
1127377428 15:58397980-58398002 CAGGGCCTCCAGTGGCATGTGGG - Intronic
1129026932 15:72585035-72585057 CTATTACTCCATTGGGAAGTAGG + Exonic
1132385519 15:101397562-101397584 CAGTGACTGCTGTAGGGAGTGGG - Intronic
1132631297 16:918923-918945 CAGAGACACCTGTGGGATGTGGG + Intronic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134915066 16:18062559-18062581 CAGTGAAGCCAGTCGGGAGTTGG + Intergenic
1135005642 16:18819599-18819621 CAGCGACTCAAGTGGGCAGGTGG - Exonic
1138650769 16:58459903-58459925 CAGTTTCTCTAGTGGGAGGTGGG - Intergenic
1138933972 16:61696286-61696308 AAGTGGCTCCAGTGGAAAGTGGG + Intronic
1139409762 16:66750306-66750328 CAGTGATTCCCATGGGAATTGGG + Intronic
1141473516 16:84255609-84255631 CAGGGACTCTGGTGGGAACTGGG - Intergenic
1142047730 16:87936465-87936487 CACTGACTCCAGTCTGAAGAGGG + Exonic
1142067518 16:88071352-88071374 CAGTGGATTGAGTGGGAAGTGGG + Intronic
1144752983 17:17662865-17662887 CAGAGACTCCAGTGGGTGCTGGG - Intergenic
1145250534 17:21294662-21294684 CAGTGACTCCACAAGGGAGTAGG - Intronic
1146376759 17:32299722-32299744 CAGTGACACCAGTGCAGAGTGGG + Intronic
1147162059 17:38574088-38574110 CAGGGAATCCAGTGGGAACAGGG - Intronic
1148694344 17:49550050-49550072 CAGGGACTCCAGAGTGAAGGGGG - Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151880147 17:76889852-76889874 CAGGGACTGCACTGGGAACTTGG - Intronic
1152025133 17:77804041-77804063 TAGTGAGCCCAGTGGGAAGCAGG + Intergenic
1152078924 17:78174667-78174689 CAGCCACTCCAGGAGGAAGTCGG - Exonic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152831798 17:82501855-82501877 CAGTCACTCCAGTGGGTACGTGG - Intergenic
1156379006 18:36540609-36540631 CAGTGATTTAAGTGGGAATTGGG + Intronic
1157491225 18:48125219-48125241 CAGTGACTCAATTAGAAAGTGGG + Intronic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1159737271 18:72115191-72115213 CAGCTACTCCAATGGGAATTGGG + Intergenic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1163689880 19:18732710-18732732 GAGTGCCACCAGTGGGGAGTTGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1165988974 19:39795081-39795103 GGGTGACTTCAGTGGGAAGCGGG + Intergenic
1166981647 19:46635077-46635099 CAGTGGCTCCAGGGAGAACTGGG + Intergenic
925631916 2:5903165-5903187 CTGTGACTCCAGTGGCAGTTTGG - Intergenic
926498612 2:13622788-13622810 CAGTGAGTGGAGTGGGAAGGTGG + Intergenic
927087396 2:19685827-19685849 CAGTCACTGCACTGGGAAGAAGG - Intergenic
928815755 2:35292821-35292843 CAGTGGCCCCAGTGGGGATTGGG + Intergenic
929441834 2:41971034-41971056 GAGGGAAGCCAGTGGGAAGTGGG + Intergenic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
930028248 2:47042954-47042976 CTGTGACTCCTGGGGGAAGCTGG - Intronic
931901317 2:66791540-66791562 CACTGAATGCAGAGGGAAGTTGG + Intergenic
933219803 2:79675928-79675950 CTGTAACTCCAGTGGGACATAGG - Intronic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
935089135 2:99877252-99877274 CAGTGAAGCCACTGAGAAGTGGG + Intronic
935260465 2:101351332-101351354 CTGTGACGCCAGTGGGCTGTTGG + Intronic
936022663 2:109006590-109006612 GAGTGACCTCAGTGGGATGTGGG + Intergenic
936105021 2:109615599-109615621 CAGGGACTACAGTGGGAAAAAGG + Exonic
937104049 2:119293971-119293993 CAGGGACTCCAGCGGGCAGCTGG + Intergenic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
943382606 2:187170596-187170618 CAGTGACTACAGCTGGACGTTGG - Intergenic
943475748 2:188353529-188353551 CAGTGACTACAATGGGTAGATGG - Intronic
944166564 2:196728094-196728116 GAGTGACAGCAGTGAGAAGTTGG + Intronic
944346841 2:198677469-198677491 CAGTCACTCCATTGGAAAGTTGG - Intergenic
945439938 2:209865989-209866011 AAGTGACTACAGTGGGAGGAGGG - Intronic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
948223860 2:236293683-236293705 CAAAGACTCCAGTGGCAAGGGGG - Intergenic
948294761 2:236852313-236852335 GAATGACTCTATTGGGAAGTGGG - Intergenic
948995974 2:241578999-241579021 CGGTGACTTGAGTGGGAAGCAGG + Intergenic
1169777898 20:9276251-9276273 CATTGACTCCAGGGTGAATTTGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171157469 20:22889639-22889661 CTGTGACTTCAGTGGGAAGGTGG - Intergenic
1171429288 20:25070571-25070593 CAGTAACTAAACTGGGAAGTGGG - Intergenic
1171824141 20:29878948-29878970 CACGGACTCCGGTGGGACGTGGG + Intergenic
1172758980 20:37308646-37308668 CATGGAGTGCAGTGGGAAGTGGG + Intronic
1173459759 20:43233771-43233793 CAGTGACTGCATTGGGCAGGTGG - Intergenic
1174270568 20:49365338-49365360 CAGAGCCTCCAGTGAGGAGTTGG + Exonic
1175075472 20:56368862-56368884 CAGTGACACCAGTGAGACTTGGG - Intergenic
1177608062 21:23407919-23407941 CAGGTACCACAGTGGGAAGTTGG + Intergenic
1179600813 21:42476226-42476248 CACTGACTACAGTGGGGACTGGG - Intronic
1181684250 22:24517449-24517471 TAGGGACCCCAGTGGGAAGATGG - Intronic
1182784008 22:32891435-32891457 CAGTGGCTGGAGTGGGATGTGGG - Intronic
1183652062 22:39162224-39162246 CTGTGAATCAAGTGGGAAGATGG + Intergenic
952342414 3:32457283-32457305 CTGTGGATCCAGTGAGAAGTAGG - Intronic
952724657 3:36571375-36571397 CAGTGGATCAAGTGGGGAGTTGG - Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953297046 3:41729448-41729470 CAGTGGCTCCAGTGTCAAGATGG - Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
958056144 3:88414805-88414827 CATAGACTCCAGTGGGGATTAGG + Intergenic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
961783484 3:129335389-129335411 CAGGGAACCCACTGGGAAGTTGG + Intergenic
962273119 3:133992671-133992693 CAGAGACTACAGTTGGATGTTGG + Intronic
962603475 3:137012457-137012479 CATTGAGTCCTGTGGGAATTGGG + Intergenic
963952483 3:151218241-151218263 CAGTGAATCAACTGAGAAGTGGG - Intronic
965310829 3:167126076-167126098 CAGTGACTTCAGGTGGAATTTGG + Intergenic
967822495 3:193851272-193851294 ATGAAACTCCAGTGGGAAGTTGG + Intergenic
969309330 4:6344032-6344054 CAGTGACTCACCTGGGAGGTTGG - Intronic
969712679 4:8853049-8853071 CACTGACCACAGTGGGAGGTGGG - Intronic
975163265 4:71147907-71147929 CTGTGACTCTAGAGGGAACTGGG + Intergenic
975720856 4:77247471-77247493 ATGTGACTCCAGTGGGGATTTGG - Intronic
976486016 4:85606014-85606036 AAATAACTCCAGTGGGAAGAAGG - Intronic
979408226 4:120341070-120341092 CAGTGACTCCACAGTGAAGCAGG + Intergenic
982136791 4:152280015-152280037 CCGTGACTCCAGTGAGAACAAGG - Intergenic
982323255 4:154102597-154102619 GATAGACTCCAGTGTGAAGTTGG + Intergenic
986174688 5:5341719-5341741 CTGTGGCTGCAGTGGGCAGTGGG + Intergenic
991148740 5:63340094-63340116 AAGAGAATCCAGTGGAAAGTAGG - Intergenic
993042884 5:82835581-82835603 CAGTGGCTCCAGTGGTACCTGGG + Intergenic
996191749 5:120552285-120552307 CAGTGATTGCACTGGGAACTAGG + Intronic
996519766 5:124413776-124413798 CACTGACTCCATAGGGTAGTGGG + Intergenic
997239571 5:132296528-132296550 CTGTGGCACCTGTGGGAAGTGGG + Intronic
997241698 5:132312513-132312535 CACTGACCCCACTGGAAAGTGGG + Intronic
1001601170 5:172929491-172929513 CAGTGTCTCCAGTGGGCATTTGG + Intronic
1004651027 6:17608439-17608461 CAGTCACTCCAGTGTGATGCAGG + Exonic
1005991186 6:30903434-30903456 CAGTAAAGCCTGTGGGAAGTGGG + Intergenic
1006011289 6:31045053-31045075 CAGTGATTCCACTGGAAGGTGGG - Intergenic
1006218485 6:32466880-32466902 CTGTGAATCCAATGTGAAGTTGG + Intergenic
1006437321 6:34032828-34032850 CAGGGACCCCACTGGGGAGTGGG + Intronic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1008486871 6:52046081-52046103 CAGTGACTTCACTGTGAAGGAGG - Exonic
1009238760 6:61159121-61159143 CATTGACTCCACTTGGGAGTTGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012630106 6:101455362-101455384 AAGTGACTAGAGTGGGAAGAGGG + Intronic
1015500383 6:133926571-133926593 CGGTGATTCCAGTGGGGAATGGG - Intergenic
1015569065 6:134603435-134603457 CAGTCACTCCAGTGTGATGCAGG - Intergenic
1028213695 7:88106262-88106284 CAGTGGCTCCCCTGGGAATTTGG + Intronic
1029728727 7:102425602-102425624 CACTCACTCCAGTGGGAAGTGGG + Exonic
1030231043 7:107208773-107208795 CAGTGGCTCATGTGGGATGTGGG + Intronic
1035826077 8:2645413-2645435 CAATGAGACCAGTGAGAAGTAGG - Intergenic
1038666792 8:29544345-29544367 AAGTGACTGGAGTGGGAGGTTGG - Intergenic
1042029193 8:64456302-64456324 CAGTGTCTCCAGTGGAGACTTGG - Intergenic
1043485991 8:80699938-80699960 GAGTAACTCCAGTGGAAAGGAGG - Intronic
1043824929 8:84915316-84915338 AAGCAACTCCAGTGGGAGGTGGG - Intronic
1047173037 8:122513314-122513336 CAGTGACTTCAGTGGAATGGAGG - Intergenic
1047818946 8:128497027-128497049 CAGTGCCTTCAGTGGTAATTTGG + Intergenic
1048493666 8:134917625-134917647 TAGTGAATCCAGAGGGAAGGAGG - Intergenic
1049303505 8:141884405-141884427 CAGTGCCTCCCAGGGGAAGTGGG - Intergenic
1051333747 9:16048016-16048038 CATTGCCTGCAGTGGCAAGTTGG + Intronic
1053054985 9:34988833-34988855 CAGGCACTCCAGGGGGAAGCAGG + Intergenic
1053263016 9:36687113-36687135 AAGTAAGTCCAGTGAGAAGTTGG + Intergenic
1053930290 9:43110040-43110062 CAGTGGCTCCCGTGGGATGGTGG + Intergenic
1054337311 9:63818072-63818094 CACGGACTCCGGTGGGACGTGGG + Intergenic
1055240797 9:74183489-74183511 CAGAGACTACAGTTGGATGTTGG - Intergenic
1058657912 9:107241581-107241603 CAGTGACTCCTGTGGGAGCTGGG - Intergenic
1058976063 9:110126643-110126665 CAGTCACTCCTGTAAGAAGTGGG + Intronic
1059503420 9:114776399-114776421 AAGTGGCTGCAGGGGGAAGTGGG + Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1059985974 9:119821012-119821034 CAGTGGCTGAGGTGGGAAGTAGG + Intergenic
1060152668 9:121298866-121298888 CAATGACTCTAGTGGGAGGGTGG + Intronic
1060735990 9:126066888-126066910 CTGAGACTCCAGTGGGTAGGAGG + Intergenic
1061035000 9:128108480-128108502 CAGTGACACAAGTGGAATGTGGG - Exonic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1062672408 9:137719316-137719338 CAGTGACCACAGTGGGTGGTGGG + Intronic
1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG + Intergenic
1187418534 X:19114471-19114493 CAGTGATTCCAGTGGGCAGCGGG + Intronic
1188392679 X:29640564-29640586 CATTTACTCCTGTGGGAAGATGG - Intronic
1188744896 X:33829810-33829832 CATCCACTCCAGTGGGAAGGGGG - Intergenic
1189362237 X:40361872-40361894 CAGTGGCTGCAGGAGGAAGTGGG + Intergenic
1192070575 X:67936245-67936267 CAGTGAACCTATTGGGAAGTGGG + Intergenic
1193049125 X:77082551-77082573 CACTGACTCCAGGAGGAACTTGG - Intergenic
1196733471 X:118963869-118963891 CAGTGACCCCCATGGGATGTGGG - Intergenic
1198601738 X:138291503-138291525 CAGTGAAGCCAGTGGGAACTGGG + Intergenic
1199801093 X:151252181-151252203 CACTGAGTCCATTGGGAACTTGG - Intergenic
1200815668 Y:7529629-7529651 CAGTGACTCCAACAGCAAGTAGG - Intergenic