ID: 1165431666

View in Genome Browser
Species Human (GRCh38)
Location 19:35776442-35776464
Sequence CCCATAAGGTTCCCCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165431666_1165431675 0 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431675 19:35776465-35776487 CTGGAGGGGGACAGACCCTGAGG 0: 1
1: 0
2: 1
3: 40
4: 338
1165431666_1165431677 14 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431677 19:35776479-35776501 ACCCTGAGGGTGAGACCCTGAGG 0: 1
1: 0
2: 3
3: 63
4: 315
1165431666_1165431679 15 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431679 19:35776480-35776502 CCCTGAGGGTGAGACCCTGAGGG 0: 1
1: 0
2: 5
3: 63
4: 321
1165431666_1165431684 25 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431684 19:35776490-35776512 GAGACCCTGAGGGTGACTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 272
1165431666_1165431683 24 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431683 19:35776489-35776511 TGAGACCCTGAGGGTGACTGGGG 0: 1
1: 0
2: 0
3: 40
4: 316
1165431666_1165431681 22 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431681 19:35776487-35776509 GGTGAGACCCTGAGGGTGACTGG 0: 1
1: 0
2: 2
3: 44
4: 248
1165431666_1165431682 23 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431682 19:35776488-35776510 GTGAGACCCTGAGGGTGACTGGG 0: 1
1: 0
2: 1
3: 38
4: 248
1165431666_1165431676 1 Left 1165431666 19:35776442-35776464 CCTGCCTTGGGGAACCTTATGGG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1165431676 19:35776466-35776488 TGGAGGGGGACAGACCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165431666 Original CRISPR CCCATAAGGTTCCCCAAGGC AGG (reversed) Intronic
902492070 1:16790147-16790169 CCTTTAGGGTGCCCCAAGGCAGG - Intronic
904038504 1:27571341-27571363 CCCATCAGACTCCCCAGGGCAGG - Intronic
904543265 1:31248416-31248438 CCCACATGGTTTCCAAAGGCTGG - Intergenic
912858437 1:113192210-113192232 CCCATGAGGAGGCCCAAGGCTGG - Intergenic
913456047 1:119031851-119031873 CCCATCAAAATCCCCAAGGCGGG - Exonic
915166262 1:153949309-153949331 CCCATACAGCTCCCCAAGTCTGG - Exonic
915729577 1:158043618-158043640 CCCATTACCTTCCCCTAGGCTGG + Intronic
916048450 1:161018230-161018252 TCCATTAGGTTCCCCAAGCTGGG + Intronic
916863575 1:168832556-168832578 CCCATGAGGGTCCCCATCGCAGG - Intergenic
917611342 1:176692061-176692083 CCCATCAAGTCCACCAAGGCAGG - Intronic
919839744 1:201600155-201600177 ACCAGAGGGGTCCCCAAGGCTGG + Intergenic
920185813 1:204158660-204158682 CTCAAGAGCTTCCCCAAGGCTGG + Intronic
920425635 1:205872904-205872926 CCCAGAAGCTGCCCCAATGCTGG + Intergenic
923528376 1:234792390-234792412 CCTTTAGGGTGCCCCAAGGCAGG + Intergenic
1063672521 10:8110942-8110964 CCCATCAGTCTCCCCAGGGCCGG - Intergenic
1065236550 10:23658246-23658268 CCCTTTGGGTTCCCCCAGGCAGG + Intergenic
1065752971 10:28905268-28905290 CCCATATACTTCACCAAGGCTGG - Intergenic
1071915341 10:90288984-90289006 CCCTTAAGCTTTCCCAAGGGGGG + Intergenic
1073255408 10:102147628-102147650 CCTAAAAGTCTCCCCAAGGCAGG - Intronic
1073650246 10:105351287-105351309 CTCATAGGGTTCCCCAAGTTAGG + Intergenic
1075849208 10:125573796-125573818 CCCCCAAGTTTCCCCAAGGTGGG + Intergenic
1077075890 11:701996-702018 CCCATTGCGTTCCCCACGGCAGG - Intronic
1079090141 11:17475140-17475162 CACATGAGGATCCCCAAGGCTGG + Intronic
1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG + Intronic
1084979969 11:72823727-72823749 CGCTGAAGGTTCCCCCAGGCTGG - Intronic
1085912870 11:80849296-80849318 CTCATTATGTTTCCCAAGGCTGG - Intergenic
1095808905 12:46350705-46350727 CCCATCAGCTTCCCCAATGTGGG - Intergenic
1097151216 12:56981222-56981244 TCCACTAGGTTCTCCAAGGCTGG - Intergenic
1102037479 12:109780369-109780391 CCCATTAAATTCCCCCAGGCAGG - Intergenic
1105702298 13:22942640-22942662 ACCAGAGGGTTCCCCAGGGCAGG - Intergenic
1105854917 13:24364424-24364446 ACCAGAGGGTTCCCCAGGGCAGG - Intergenic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1108809972 13:54210847-54210869 CACAAAAGGTTACCCAAGACTGG - Intergenic
1113367400 13:109689397-109689419 CCCAGAAGTTTCCAAAAGGCAGG + Intergenic
1113450848 13:110408224-110408246 GCCACAAGGGTCCCCAGGGCGGG + Intronic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1117549894 14:56824489-56824511 CCCAACAGGTTGCCCAAGGAGGG - Intergenic
1121078449 14:91088659-91088681 TCCATAGGGTTCCCCTAAGCAGG + Intronic
1122363700 14:101182239-101182261 CCCATCTGGAACCCCAAGGCTGG + Intergenic
1122843806 14:104479714-104479736 ACCAGAGGGTTCCCCAGGGCAGG - Intronic
1122920163 14:104876662-104876684 CCCAGAAGGCTCCCCCTGGCAGG + Intronic
1127541291 15:59941406-59941428 CTCATAAGGTTATCCATGGCTGG - Intergenic
1128344311 15:66843901-66843923 CACATAAGGATGCCCAAGTCTGG - Intergenic
1129887161 15:79046715-79046737 CCCTAAAGGTTGGCCAAGGCAGG - Intronic
1133446470 16:5865394-5865416 ACCATGAGTTTCCCCATGGCTGG + Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134610530 16:15604841-15604863 CCCATATGCGTCCCCAGGGCGGG + Intronic
1135759346 16:25124479-25124501 CCCATAAGATCCTACAAGGCAGG - Intronic
1137932342 16:52601132-52601154 CCCATTAAGTTCTCCATGGCTGG - Intergenic
1142193135 16:88727001-88727023 CCCAGAAGGTTCCCCGTGGAGGG + Intronic
1143924100 17:10354453-10354475 TCCAGAAGGTTCACCAAAGCAGG - Intronic
1143924180 17:10355272-10355294 TCCAGAAGGTTCACCAAAGCAGG - Intronic
1146526636 17:33572488-33572510 CCCATAGGCTTCCCCAAGCATGG + Intronic
1148131698 17:45266271-45266293 CCCAGAAGGTTCCCCTAGCTTGG - Intronic
1148185935 17:45643737-45643759 CCCAAAACGATCCCCAAGGAGGG + Intergenic
1153583864 18:6601695-6601717 ACCATAAGGTTGCCTAAGGAGGG + Intergenic
1155084893 18:22448482-22448504 CCCATAAAGTTGCCCAGGGCAGG - Intergenic
1158116409 18:54000971-54000993 CCCATAGGCTTCCCCTGGGCAGG + Intergenic
1158956582 18:62546090-62546112 CCCCTAATCTTACCCAAGGCAGG - Intronic
1159163948 18:64679234-64679256 TCCAAAAGGTTCCCTAAGGGTGG + Intergenic
1162520166 19:11174895-11174917 CCCAACACGTTCCCCAAGGAAGG + Intronic
1162595370 19:11624824-11624846 CCCACAAGGTCCGCCCAGGCTGG - Intergenic
1162931698 19:13960835-13960857 CCCAGAAGGTTCCAGAAGGCAGG - Intronic
1163087774 19:14994619-14994641 CCCACCAGATTCTCCAAGGCAGG - Intronic
1165146277 19:33732844-33732866 CTCACAAGGTTCCCTAAGGTAGG + Intronic
1165371391 19:35408585-35408607 CCCAAAAGGTTACCCCAAGCTGG - Intergenic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1166565241 19:43760984-43761006 CCCATCAGCCTCCCAAAGGCTGG + Intergenic
1167098840 19:47391644-47391666 CCCTCAAGGTTCCACCAGGCCGG + Intergenic
1167534520 19:50041280-50041302 TCCACAAGCTTCCCCAAGGAAGG - Intronic
1168689184 19:58366686-58366708 CCAATAGGGTTCCCCAAGTGTGG - Intergenic
925970246 2:9101561-9101583 CCCAGAAGGTTCCCCATGAAAGG + Intergenic
926037437 2:9646514-9646536 CCCATGAGCTCTCCCAAGGCAGG + Intergenic
930710116 2:54542976-54542998 CCCATACAGTTTCCAAAGGCTGG - Intronic
931782015 2:65587045-65587067 CCCTGAAGCTTCCCAAAGGCAGG + Intergenic
932341588 2:70965725-70965747 GCCATTAGGTTCCCTAAGGAGGG + Intronic
933082307 2:78006280-78006302 CCCCTATGCTTCACCAAGGCAGG - Intergenic
935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG + Intronic
939909497 2:147962870-147962892 CCCAGAAGGTTACCCCTGGCAGG + Intronic
945570391 2:211459754-211459776 CTGATAAAGTTACCCAAGGCTGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
948879860 2:240851138-240851160 CCCGTCAGGATTCCCAAGGCAGG + Intergenic
948903850 2:240968645-240968667 CCTATAAAGAGCCCCAAGGCTGG - Intronic
1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG + Intronic
1174719714 20:52798905-52798927 CCCCTAAGGCTCAACAAGGCTGG - Intergenic
1175497038 20:59422422-59422444 CCCCTAAGCTGCCCAAAGGCTGG - Intergenic
1175761907 20:61566968-61566990 CCCATCAGCTCCCCCGAGGCAGG - Intronic
1176087966 20:63306683-63306705 CCCATAAGGCCCCCGTAGGCAGG + Intronic
1179309689 21:40184774-40184796 CCCAGGAGTTTCCCAAAGGCAGG - Intronic
1180039186 21:45267127-45267149 GCCATGAGCGTCCCCAAGGCTGG - Intronic
1183068572 22:35380702-35380724 CCCAGAAGGTTCCAGAAAGCTGG - Intronic
950080113 3:10215948-10215970 ACCATAAACCTCCCCAAGGCAGG - Intronic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
959383891 3:105677144-105677166 CTCATAAGGTTCCACAGGTCAGG + Intronic
959826995 3:110809616-110809638 TCTATAAGGTTCACCAAGACAGG + Intergenic
960403258 3:117229409-117229431 CCTATGAGGTGCCCCAAAGCTGG + Intergenic
962414246 3:135168016-135168038 TCTCTAAGGTTACCCAAGGCGGG + Intronic
964430382 3:156599574-156599596 CCCTTCATGCTCCCCAAGGCAGG + Intergenic
968187523 3:196643466-196643488 CCCAAAAGGTTGCCTAAGGCAGG + Intronic
968782597 4:2594392-2594414 CCCAGAAGCTTCTCCAAGGCCGG - Intronic
982542541 4:156692110-156692132 CCCACCAGGTTCCACAAGGGAGG + Intergenic
986674527 5:10171382-10171404 CCCATTAGATTCTCCAGGGCAGG - Intergenic
988574467 5:32407262-32407284 ACTATAAGGTTCTTCAAGGCAGG - Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
998130659 5:139649651-139649673 CTCAAAAGACTCCCCAAGGCTGG - Intronic
1000300961 5:159955514-159955536 ACCATCTGATTCCCCAAGGCTGG + Intronic
1002190513 5:177475036-177475058 CCCTTAGGGATCCCCATGGCAGG - Intergenic
1002460391 5:179370385-179370407 CCCCCAAAGTCCCCCAAGGCAGG - Intergenic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1007810296 6:44480857-44480879 ACCATAGGTTCCCCCAAGGCTGG - Intergenic
1007924453 6:45640305-45640327 CTCATCAGGTTCCACAGGGCAGG + Intronic
1010215044 6:73394143-73394165 CCCAGTATGTTGCCCAAGGCTGG - Intronic
1011000416 6:82582376-82582398 CCTATAATTTTCCACAAGGCAGG + Intergenic
1011099412 6:83706297-83706319 CCCATCAGTTTCCCCAACTCTGG - Intronic
1016819969 6:148338067-148338089 CCCACAAAGTTCTTCAAGGCAGG - Intronic
1018055205 6:160046383-160046405 CCCAGGAGGTTCCCAACGGCAGG - Intronic
1019992765 7:4703477-4703499 CCCACAAGGCTCCCCCAGGGTGG + Intronic
1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG + Intronic
1024078273 7:45834816-45834838 CACAAAAAGTTTCCCAAGGCCGG + Intergenic
1028091620 7:86709547-86709569 CCCCGAAGGTACCACAAGGCTGG - Intronic
1030275705 7:107719365-107719387 AACATAAGCTTCACCAAGGCAGG + Intergenic
1030412984 7:109204899-109204921 CTCCTAAAGTTCCTCAAGGCAGG - Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038672679 8:29595178-29595200 CACATCAGCTTCACCAAGGCAGG + Intergenic
1042517421 8:69674216-69674238 TCCATAAGCTTCTTCAAGGCAGG + Intronic
1049719296 8:144108247-144108269 CCCTTAGGGGTCCCCTAGGCCGG + Intronic
1050589576 9:7148249-7148271 ACCTTCAGGTTCCCCAAGCCAGG - Intergenic
1058964508 9:110024130-110024152 GCCATATGGTTCCCCCAGGTAGG + Intronic
1061425791 9:130497679-130497701 CCCATCCCGTTCCCCAAGGTGGG - Intronic
1061981794 9:134109500-134109522 CACAAAAGCTCCCCCAAGGCTGG + Intergenic
1189294728 X:39910314-39910336 TCCCAAATGTTCCCCAAGGCTGG + Intergenic
1189406174 X:40726182-40726204 ACCATGAGGTTCTCGAAGGCAGG + Intronic
1189429891 X:40937032-40937054 CACATAAGGTACACAAAGGCGGG + Intergenic
1195335365 X:103848292-103848314 CTCATAAGGTGCCCCAACCCTGG + Intergenic