ID: 1165435583

View in Genome Browser
Species Human (GRCh38)
Location 19:35793027-35793049
Sequence AACTTGGGCCCCTGGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165435574_1165435583 4 Left 1165435574 19:35793000-35793022 CCTAGCTCTCAGGCTTTCTGGGG No data
Right 1165435583 19:35793027-35793049 AACTTGGGCCCCTGGGGATGGGG No data
1165435572_1165435583 5 Left 1165435572 19:35792999-35793021 CCCTAGCTCTCAGGCTTTCTGGG No data
Right 1165435583 19:35793027-35793049 AACTTGGGCCCCTGGGGATGGGG No data
1165435569_1165435583 21 Left 1165435569 19:35792983-35793005 CCTCAGGGGAAGAGAGCCCTAGC No data
Right 1165435583 19:35793027-35793049 AACTTGGGCCCCTGGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165435583 Original CRISPR AACTTGGGCCCCTGGGGATG GGG Intergenic
No off target data available for this crispr