ID: 1165435656

View in Genome Browser
Species Human (GRCh38)
Location 19:35793317-35793339
Sequence CAGGACACAGAGATGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165435656_1165435661 3 Left 1165435656 19:35793317-35793339 CCAGGTTCCATCTCTGTGTCCTG No data
Right 1165435661 19:35793343-35793365 CCCCTGCCCTCCAGCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165435656 Original CRISPR CAGGACACAGAGATGGAACC TGG (reversed) Intergenic
No off target data available for this crispr