ID: 1165442412

View in Genome Browser
Species Human (GRCh38)
Location 19:35837207-35837229
Sequence TGATAGGCACAGTATTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165442412_1165442414 6 Left 1165442412 19:35837207-35837229 CCACTACAATACTGTGCCTATCA 0: 1
1: 1
2: 1
3: 8
4: 142
Right 1165442414 19:35837236-35837258 TAACATATTCATCATATTCAAGG 0: 1
1: 0
2: 6
3: 35
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165442412 Original CRISPR TGATAGGCACAGTATTGTAG TGG (reversed) Intronic
909548234 1:76869906-76869928 AGATATGAACAGTACTGTAGGGG + Intronic
910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG + Intronic
910690433 1:89959907-89959929 AGATAGCCTCAGGATTGTAGGGG - Intergenic
910720604 1:90281974-90281996 TGACAGGCAGGGTATTCTAGGGG + Intergenic
914433086 1:147637261-147637283 CATTAGGCAAAGTATTGTAGAGG - Intronic
915958390 1:160242894-160242916 TGAAAGGCACAGGGTTCTAGAGG - Intronic
916492245 1:165312255-165312277 TGATAGGCACAGTACAGTCTGGG + Intronic
916851475 1:168708765-168708787 TGACAGGCACAGCAATGCAGAGG + Intronic
917139365 1:171819461-171819483 TGCTTGGCACAGTATTCTAAAGG + Intergenic
921292045 1:213667311-213667333 TGATAGTCACTTTATTGTTGTGG - Intergenic
922913856 1:229239726-229239748 TTATAGGCACAGGATGGGAGTGG + Intergenic
923175557 1:231461119-231461141 TGATATTCACTTTATTGTAGTGG - Intergenic
923899651 1:238311876-238311898 TGATAGGCAGAGAATTGTAGAGG + Intergenic
924759437 1:246970470-246970492 TGTGAGGCAGAGTATTGAAGAGG + Intronic
1064277883 10:13923883-13923905 AGGTTGGCACAGTATTGAAGGGG + Intronic
1065899897 10:30197083-30197105 TGATAGTCACTTTATTGTGGTGG + Intergenic
1066462218 10:35621995-35622017 AGACAGGCACAGTTTTATAGTGG + Intergenic
1069769906 10:70891596-70891618 TTATAGGCACAGGATTGGGGAGG + Intergenic
1072208668 10:93226378-93226400 TTATAGGCACAGGATGGTGGGGG + Intergenic
1072325501 10:94294505-94294527 TGATATTCACTTTATTGTAGTGG - Intronic
1073291982 10:102417617-102417639 TGAGAGGCACAGCATGGAAGTGG + Intronic
1076086801 10:127639226-127639248 TGATAACCACAGTATTCTATGGG - Intergenic
1077881854 11:6357053-6357075 TGATGGGGACATTATTATAGGGG - Intergenic
1079819642 11:25109205-25109227 TAATAGTCACAGCATTTTAGAGG - Intergenic
1081097252 11:38953001-38953023 AGATAAGCACAGTATTTAAGAGG + Intergenic
1084083750 11:66845316-66845338 TGAGGGCCACAGTATTGGAGAGG + Intronic
1085557789 11:77441066-77441088 TGAAAGGCAGAGTATGGTACAGG - Intronic
1093498278 12:19781675-19781697 TGATAGGAATAGCATTGTATAGG + Intergenic
1094444758 12:30517728-30517750 TGGTATGCAAAGCATTGTAGAGG - Intergenic
1096060404 12:48693722-48693744 TGATAAGCACAATTCTGTAGAGG - Exonic
1096969551 12:55654848-55654870 TGACTGGCTCAGTATAGTAGGGG + Intergenic
1098483448 12:70993261-70993283 TTATATGCAAAGTATTGTACAGG + Intergenic
1100923194 12:99513339-99513361 TAATAGTCACTGTATTGTGGTGG + Intronic
1104002870 12:124871621-124871643 TGATATTCACAATATTGCAGGGG - Intronic
1104525641 12:129518360-129518382 TGCTAGGCACTGTACTGTATAGG - Intronic
1105253154 13:18719374-18719396 TGACAGGCAGGGTATTCTAGGGG - Intergenic
1106533721 13:30618912-30618934 TGACAGGCTCAGACTTGTAGAGG + Intronic
1106989292 13:35397650-35397672 TGATGTTCACTGTATTGTAGTGG - Intronic
1109354547 13:61221209-61221231 TGTTAGGCACAATATCGCAGGGG - Intergenic
1109982808 13:69932257-69932279 TGATAGGCAAATTATTATAAAGG + Intronic
1110896761 13:80762534-80762556 TGGTTGGCAAAGTTTTGTAGTGG - Intergenic
1111004351 13:82229291-82229313 GGAAAGGCACAGTATTGGGGTGG - Intergenic
1112693266 13:101918338-101918360 TGATAGGCAAAGCAGTGTAAAGG - Intronic
1114950281 14:27742258-27742280 TGATAGATACGGTATTGTTGAGG + Intergenic
1114972145 14:28045907-28045929 TCATAGGGAAAGTAGTGTAGTGG - Intergenic
1115012981 14:28572875-28572897 TTATAGGCACAGGATGGCAGGGG + Intergenic
1119267408 14:73271336-73271358 TGCTAGGTACAGTCTTTTAGTGG + Intronic
1120173214 14:81267333-81267355 TGATAATCACAGTATTGGATTGG - Intronic
1130388973 15:83438116-83438138 TGATAGCCACAGTTGGGTAGTGG + Intergenic
1131186611 15:90279550-90279572 TGATAATCACAGGATTGTTGTGG + Intronic
1131200377 15:90390329-90390351 TGATAATCACAGGATTGTTGTGG + Intronic
1131887208 15:96928968-96928990 TGATAGTCACTTTATTGTAGTGG - Intergenic
1134679480 16:16114148-16114170 TGCTAGGCACAGTATACTAAGGG + Intronic
1135197102 16:20403615-20403637 TGATAGGCACAGTGGTGTGATGG - Intronic
1136487376 16:30582194-30582216 TAATAGGCACTGGAATGTAGGGG + Exonic
1139274297 16:65713292-65713314 TGATGGGAACAGTAAAGTAGGGG - Intergenic
1140650248 16:77080198-77080220 TGATAGGTACTTTATTGTGGTGG - Intergenic
1142900639 17:3009421-3009443 TGATAGGCATAGTATTATATGGG + Intronic
1144787421 17:17839824-17839846 TGATAGGCACACCATTACAGAGG - Intergenic
1145117657 17:20226319-20226341 TAGTAAGCATAGTATTGTAGAGG + Intronic
1146014576 17:29222521-29222543 TGATTGACACAGTGTTGGAGGGG - Intergenic
1148398131 17:47326674-47326696 TGCTATGCACAGTAGTTTAGAGG + Intronic
1156369316 18:36458445-36458467 TGATATGCACACACTTGTAGAGG - Intronic
1158731415 18:60027474-60027496 AGATAGGAACAGAATTGTACAGG + Intergenic
1162690397 19:12425205-12425227 TGATAGGAATAGTAGTTTAGAGG - Intronic
1165442412 19:35837207-35837229 TGATAGGCACAGTATTGTAGTGG - Intronic
1166398499 19:42460468-42460490 TTATAGGCACAGTTTTTTAAAGG + Intergenic
927002270 2:18810374-18810396 TGACAGTGACATTATTGTAGTGG + Intergenic
928131790 2:28656998-28657020 TTATAGCCACAATATTTTAGAGG - Intergenic
929299830 2:40290169-40290191 TGCAAGGCACAGTAATGAAGAGG - Intronic
931062834 2:58549968-58549990 TGACAGGCACAAATTTGTAGAGG + Intergenic
932674216 2:73764645-73764667 TGATAAGCACTCCATTGTAGTGG - Intronic
934487626 2:94731403-94731425 TGACAGGCAGGGTATTCTAGGGG - Intergenic
939601277 2:144193941-144193963 TGATAGGCACAGTGATAGAGCGG - Intronic
940572585 2:155458184-155458206 GGAAAGGGACAGGATTGTAGAGG - Intergenic
941505060 2:166332597-166332619 TGATAGGAACAATATTGAAATGG - Intronic
942215041 2:173710699-173710721 GGAAAGCCACAGTATTGTAATGG + Intergenic
943594967 2:189845257-189845279 TTAAAAGCCCAGTATTGTAGTGG + Intronic
943831599 2:192471131-192471153 TGATTGGAAGATTATTGTAGAGG - Intergenic
943934620 2:193900473-193900495 TGGTAGGAACAATATAGTAGTGG - Intergenic
944131662 2:196353801-196353823 TTATAGGCACAGGATGGGAGAGG - Intronic
946086369 2:217177409-217177431 TGATAGGCACAGTATTGTTGCGG - Intergenic
1176838657 21:13819259-13819281 TGACAGGCAGGGTATTCTAGGGG - Intergenic
1177907523 21:26990073-26990095 TGATTGTCACAGTATTCTAGTGG + Intergenic
1178106610 21:29326416-29326438 TGACTGGCACTGTCTTGTAGAGG - Exonic
1179671348 21:42951188-42951210 TGATAGTCACAGTATATGAGAGG + Intergenic
1184532143 22:45062797-45062819 TGGAGGCCACAGTATTGTAGGGG + Intergenic
949543943 3:5055897-5055919 TGGTTGTCACAGGATTGTAGGGG + Intergenic
950126999 3:10515817-10515839 TGATAGGCAAAGTATTTTACAGG - Intronic
951201239 3:19876969-19876991 TCCTAGGCACAGAATTGAAGGGG + Intergenic
954296306 3:49676276-49676298 TGACAGGCACAGTATGGGAAGGG - Intronic
956301308 3:67775346-67775368 TTATAGGCACAGAATAGTGGGGG + Intergenic
966425139 3:179772853-179772875 TGATAGCAACAGAATTGTAAAGG - Intronic
972228186 4:37039368-37039390 CGATAGGCAAAATATTTTAGAGG - Intergenic
976843719 4:89462422-89462444 TTATAGGCATAATATTTTAGAGG + Intergenic
979903213 4:126249950-126249972 TGAAAGGTACAGTCTTGTGGTGG + Intergenic
981391393 4:144195756-144195778 TGATATTCACATTATTGTGGTGG - Intergenic
981984171 4:150833468-150833490 TGATAGCCACTTTATTGCAGTGG - Intronic
984565820 4:181328937-181328959 TGACAATCACAGTATTGTTGAGG - Intergenic
986802803 5:11279275-11279297 TGAGAGGGACAGTTTTGGAGGGG - Intronic
987427569 5:17791035-17791057 TGATAGGCAGAGTTTTGGGGAGG + Intergenic
990249094 5:53894583-53894605 TGAGAGGCACAGTTATGTATGGG + Intronic
990285299 5:54295805-54295827 TGAGAGGCAGGGTATGGTAGAGG - Intronic
990792395 5:59496317-59496339 TTATAGGCACAGGATGGTAGGGG + Intronic
992691554 5:79245586-79245608 TGATAGGCACAGTGTGGCAAGGG + Intronic
996261266 5:121472624-121472646 TGTTAGGAAGAGTGTTGTAGAGG + Intergenic
996670930 5:126116182-126116204 TTAGAGGCACAGTATTTTAAGGG - Intergenic
1000734259 5:164879441-164879463 TAATAAGCACAGTATCCTAGAGG - Intergenic
1003485717 6:6576882-6576904 TGCTAGGCACTGTATTTTACAGG - Intergenic
1005153258 6:22776583-22776605 TGACAGCCACAGTGTTGTAGTGG + Intergenic
1007941093 6:45782272-45782294 TGGGAGGCACAGTTTTGGAGGGG + Intergenic
1008484551 6:52021551-52021573 TGCTAGGAACAGTGTTGCAGAGG - Intronic
1009363509 6:62840645-62840667 TGTTAGGGACAATATTGTACTGG - Intergenic
1010119048 6:72352421-72352443 TGATAGGCACAGTATTTGTGTGG + Intronic
1011736922 6:90320322-90320344 TGATTGGAACAGTATTGTCATGG + Intergenic
1012481924 6:99676647-99676669 GGAAAAGCACAGTATTGTGGTGG + Intergenic
1014247302 6:119082004-119082026 TTATAGGCACAGGATGGTGGGGG + Intronic
1014292248 6:119572071-119572093 TGATAGCCACAGTAATACAGTGG + Intergenic
1014894125 6:126880447-126880469 TCATAGGCCCAGTGATGTAGAGG - Intergenic
1014913998 6:127122410-127122432 TGATAGCCACAGAATCTTAGTGG + Intronic
1015640862 6:135330573-135330595 TGATATTCACGGTATTGCAGTGG + Intronic
1015708650 6:136115473-136115495 TGAAAGACAAAGTATTCTAGTGG + Intronic
1021799318 7:24287997-24288019 TGAAAGTTACAGCATTGTAGAGG + Intronic
1023935677 7:44738178-44738200 TGACAGGCACAGTCTTGTGAAGG - Intergenic
1030956974 7:115864967-115864989 TGAAAGGCACAGAGTTGTAAAGG - Intergenic
1032472149 7:132186298-132186320 TGATAGGCACAGCAATCCAGTGG - Intronic
1033484561 7:141775786-141775808 GGAAAAGCACAGTATTGGAGTGG + Intronic
1034647988 7:152665382-152665404 TGTTAGGCACAGTTTTCCAGAGG - Intronic
1037447560 8:18981605-18981627 TGATATTCACTGTATTGTTGTGG - Intronic
1037594541 8:20343884-20343906 TTATAGGCACAGGATGGTTGGGG + Intergenic
1038523949 8:28257320-28257342 TGAGAGGCACTGTTTTGGAGTGG + Intergenic
1039245870 8:35607690-35607712 TGATGGGCACATTTTTGTAAAGG + Intronic
1040683462 8:49842055-49842077 TTATAGGCACAGGATGGGAGTGG - Intergenic
1040992390 8:53366691-53366713 AGATATGCACAGAATTCTAGAGG + Intergenic
1043951252 8:86311539-86311561 TTATAGGCACAGGATGGTATGGG - Intronic
1047888961 8:129285937-129285959 TGAAATTAACAGTATTGTAGGGG + Intergenic
1048516655 8:135117309-135117331 TCATAGCCACACTATTCTAGAGG - Intergenic
1048687481 8:136919970-136919992 TCATAGGCACAGAATTGGGGAGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051584038 9:18707854-18707876 TGTTATGAACAGGATTGTAGTGG + Intronic
1053278909 9:36804103-36804125 TGAAATGCACAGTCTTGGAGAGG - Intergenic
1053670177 9:40353011-40353033 TGACAGGCAGGGTATTCTAGGGG + Intergenic
1054381299 9:64492999-64493021 TGACAGGCAGGGTATTCTAGGGG + Intergenic
1054514437 9:66023286-66023308 TGACAGGCAGGGTATTCTAGGGG - Intergenic
1058828007 9:108792435-108792457 TTATAGGCACAGGATTGGGGTGG - Intergenic
1185919546 X:4075160-4075182 TAAAAGGCACAGTATTTTATTGG + Intergenic
1187965087 X:24603828-24603850 TGATAGACACAGAATTTTAGAGG + Intronic
1189951857 X:46240546-46240568 TGATAGACACTTTATTGTGGTGG + Intergenic
1189955092 X:46269718-46269740 AGATAGGCAAAGTAGTTTAGGGG + Intergenic
1190125131 X:47698154-47698176 TTATAGGCACAGGACTGTGGTGG - Intergenic
1191085390 X:56562334-56562356 TGACAGGCACATAATAGTAGTGG - Intergenic
1192342301 X:70274148-70274170 TGATAGGTACAGTATGTTACCGG - Intronic
1199760333 X:150899538-150899560 TGGTCGGCACAGTATCGTATCGG - Intergenic