ID: 1165443349

View in Genome Browser
Species Human (GRCh38)
Location 19:35843534-35843556
Sequence GGTGAACGTCGGGGGTTCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 59}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165443349_1165443364 9 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443364 19:35843566-35843588 TCCTGGAGGGCACGGATGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 293
1165443349_1165443361 1 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443361 19:35843558-35843580 CAGTGGGGTCCTGGAGGGCACGG 0: 1
1: 0
2: 7
3: 99
4: 740
1165443349_1165443358 -5 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 206
1165443349_1165443357 -8 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443357 19:35843549-35843571 CGTTCACCTCAGTGGGGTCCTGG 0: 1
1: 0
2: 16
3: 13
4: 103
1165443349_1165443363 8 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443363 19:35843565-35843587 GTCCTGGAGGGCACGGATGGTGG 0: 1
1: 0
2: 3
3: 34
4: 258
1165443349_1165443367 21 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443367 19:35843578-35843600 CGGATGGTGGGAGCATCTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1165443349_1165443368 25 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443368 19:35843582-35843604 TGGTGGGAGCATCTGGTGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 362
1165443349_1165443359 -4 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443359 19:35843553-35843575 CACCTCAGTGGGGTCCTGGAGGG 0: 1
1: 0
2: 0
3: 33
4: 243
1165443349_1165443366 18 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443366 19:35843575-35843597 GCACGGATGGTGGGAGCATCTGG 0: 1
1: 0
2: 0
3: 5
4: 139
1165443349_1165443362 5 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443362 19:35843562-35843584 GGGGTCCTGGAGGGCACGGATGG 0: 1
1: 0
2: 5
3: 50
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165443349 Original CRISPR GGTGAACGTCGGGGGTTCTG TGG (reversed) Exonic