ID: 1165443358

View in Genome Browser
Species Human (GRCh38)
Location 19:35843552-35843574
Sequence TCACCTCAGTGGGGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165443349_1165443358 -5 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165443358 Original CRISPR TCACCTCAGTGGGGTCCTGG AGG Exonic