ID: 1165443358

View in Genome Browser
Species Human (GRCh38)
Location 19:35843552-35843574
Sequence TCACCTCAGTGGGGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165443349_1165443358 -5 Left 1165443349 19:35843534-35843556 CCACAGAACCCCCGACGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165443358 Original CRISPR TCACCTCAGTGGGGTCCTGG AGG Exonic
900123334 1:1058862-1058884 TTCCCTGAGTGGGGTCCAGGGGG + Intergenic
900337805 1:2173357-2173379 TCACCTCAGCAGGGACCAGGGGG + Intronic
900550962 1:3255340-3255362 ACCCCACAGTGGGGTCCTGAGGG + Intronic
900552028 1:3261647-3261669 CCACCTAACTGGGTTCCTGGGGG + Intronic
901768435 1:11518382-11518404 CCACCACAGCGGGGTCCTGAAGG - Intronic
902262638 1:15238323-15238345 TCACCTCTCTGGGTTTCTGGAGG - Intergenic
902579722 1:17400801-17400823 TCAGCTCAGTGTGGTCCGGCAGG + Intronic
904090539 1:27941897-27941919 CCACCTCCTTGGGGTCCAGGTGG - Intronic
906458592 1:46019936-46019958 TCACATCAGTGGGGGTCTTGGGG + Intronic
906960950 1:50419216-50419238 CCACCACCGTGGGGGCCTGGCGG - Exonic
907457588 1:54585389-54585411 GCACCTGAGTGGAGTCCTGAGGG + Intronic
908102900 1:60809759-60809781 CCACATCAAAGGGGTCCTGGGGG - Intergenic
908657302 1:66401863-66401885 TCTCCTAAATGGAGTCCTGGTGG + Intergenic
909925236 1:81430610-81430632 TAACATCAGTGGGGGGCTGGGGG - Intronic
910232737 1:85003188-85003210 TTATCTCACTGGGGTCCTTGGGG + Intronic
911101118 1:94096517-94096539 AGACCTCAGACGGGTCCTGGGGG - Intronic
912322692 1:108728914-108728936 TGACTTCAGTGGGGTCCTTATGG + Intronic
917437876 1:175039356-175039378 TCACCTCACTGGGCTGCTGTGGG + Intergenic
920379123 1:205525755-205525777 TCACCTCTTTGGGCTCCTGGAGG - Intronic
922534868 1:226372233-226372255 TGACCTCAGCGGGGTCCACGTGG - Intronic
923033375 1:230267365-230267387 TCACCTCTGTGCTGTCCAGGTGG + Intronic
1063021632 10:2134854-2134876 TTACACCAGTGGGTTCCTGGGGG + Intergenic
1067027106 10:42852792-42852814 TCAACTCAGTATGGTGCTGGTGG - Intergenic
1069691849 10:70358821-70358843 TCACCTCTTGTGGGTCCTGGAGG - Intronic
1070318977 10:75340127-75340149 TCACCTGAATGGGGGCCTGGTGG + Intergenic
1070954368 10:80454580-80454602 TCGGCTCAGCGGGGTCCCGGCGG - Intronic
1073101567 10:101009249-101009271 TTTCCTCAGTGGGGCCCTGCAGG - Intronic
1074758515 10:116646580-116646602 TCACCCCAGTGGCTTCCCGGAGG + Intergenic
1075827798 10:125374771-125374793 TCACATCAGTGGAGTTCTGGAGG - Intergenic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1077297429 11:1832649-1832671 GCACCTCCCTGGGGTCCCGGCGG + Intronic
1077453567 11:2664920-2664942 TCACCTCTCTGGGGCCCTGCGGG - Intronic
1077603549 11:3591441-3591463 TCAGATCAGTGGAGTCCAGGGGG + Intergenic
1078949105 11:16108741-16108763 CCACCTCAGTGGGTTGCTGAGGG - Intronic
1079491468 11:20993288-20993310 TCACCACAATGGGTTCCTTGTGG + Intronic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083809641 11:65096418-65096440 TCAGATCAGTCGGGTCCAGGGGG - Exonic
1084113029 11:67025611-67025633 CCACCTCAGTGGGCTCCCGCTGG - Intronic
1084259452 11:67966037-67966059 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
1084531173 11:69728745-69728767 GCCCCTCTTTGGGGTCCTGGGGG - Intergenic
1084531331 11:69729546-69729568 ACAGATCTGTGGGGTCCTGGAGG + Intergenic
1084813319 11:71629213-71629235 TCAGATCAGTGGGGTCCAGGGGG - Intergenic
1085271168 11:75270854-75270876 TCCCCTCATTGGGAACCTGGGGG + Intronic
1086001288 11:81988498-81988520 TCACGTGAGTGGGGTCTTTGAGG + Intergenic
1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG + Intronic
1088835320 11:113573780-113573802 TCACCTCACTCAGCTCCTGGAGG + Intergenic
1089252091 11:117171825-117171847 TCACCTCAGTGGTATACTGTTGG + Intronic
1092430761 12:8407001-8407023 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
1093202030 12:16199371-16199393 TCACCACATTGGTGACCTGGGGG - Intronic
1095724727 12:45439186-45439208 TCACTTCAGTGGTGGGCTGGTGG - Intronic
1101895592 12:108754154-108754176 TCAGCTCAGTGGCCCCCTGGGGG + Intergenic
1103371859 12:120425272-120425294 TCACCTCTGGGTGGGCCTGGTGG - Intergenic
1104133133 12:125913740-125913762 ACACCTGAGTGGGGTCTTGAAGG - Intergenic
1104422089 12:128644750-128644772 TCCCCTCAGTAGGGCTCTGGAGG + Intronic
1104600188 12:130148215-130148237 CTTCCTCAGTGGGGCCCTGGTGG + Intergenic
1104694293 12:130851935-130851957 GCACCTCAGTGAGGCCTTGGTGG + Intergenic
1107460814 13:40600198-40600220 TCAACTCAGTGGGGACCAGTTGG - Intronic
1110218904 13:73052143-73052165 TCACGACAGTGGGGAGCTGGGGG + Intergenic
1111831797 13:93339560-93339582 TAACCTCAGTGTAGACCTGGGGG - Intronic
1112578942 13:100662102-100662124 TATCCTCAGTGGAGGCCTGGAGG - Intronic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1117797518 14:59409556-59409578 TCACCTCACTGGGGGCATGTCGG + Intergenic
1117988001 14:61407537-61407559 CCTCCTCAGTGAGGACCTGGTGG + Intronic
1123426729 15:20177312-20177334 TCAACTCAGTATGGTGCTGGTGG - Intergenic
1123535960 15:21183839-21183861 TCAACTCAGTATGGTGCTGGTGG - Intergenic
1129663217 15:77564907-77564929 TTCCCTCAGAGGGGGCCTGGAGG + Intergenic
1132888544 16:2193450-2193472 CCTCCTGAGTGTGGTCCTGGCGG - Intronic
1133443922 16:5843891-5843913 GCACCTGAGTTGGGTTCTGGAGG + Intergenic
1134446190 16:14333212-14333234 TCACCTCAGTGGACTCCGCGGGG + Intergenic
1136384452 16:29914361-29914383 TCATCTCAGTCAGGTCCAGGTGG + Intronic
1136518300 16:30781048-30781070 TCACTGCACTGGGGTCCTTGGGG - Exonic
1138535237 16:57656452-57656474 TGGACACAGTGGGGTCCTGGAGG + Intronic
1138537580 16:57668070-57668092 CCACCCCAGTGGGGCCCCGGGGG + Intergenic
1139753105 16:69121049-69121071 TCACCTCAGTGGTGTAATGTAGG + Exonic
1141157670 16:81608635-81608657 CCGCCTCTGTGTGGTCCTGGTGG - Intronic
1141464088 16:84195428-84195450 TCACCTCAGCAGGGCCCTGCGGG - Exonic
1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG + Intergenic
1141672208 16:85498035-85498057 ACACCTCAGTGGGGTGGGGGTGG + Intergenic
1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG + Intergenic
1141798933 16:86294320-86294342 TCGCCCCTGTGGAGTCCTGGCGG - Intergenic
1141963007 16:87421802-87421824 GGCCCTTAGTGGGGTCCTGGAGG - Intronic
1142160149 16:88553162-88553184 CCACCTCTGTGGCGTCCTGTGGG - Intergenic
1142171536 16:88625113-88625135 TCACCTCACAGGGCTGCTGGTGG + Intronic
1142391432 16:89803450-89803472 GCAGCTCACAGGGGTCCTGGTGG - Intronic
1142427584 16:90008862-90008884 TGAGCTCAGTGAGGTCCAGGAGG + Exonic
1203119093 16_KI270728v1_random:1520678-1520700 TCAACTCAGTATGGTGCTGGTGG + Intergenic
1146693543 17:34892752-34892774 TCCCCTCAGCAGGGCCCTGGGGG - Intergenic
1148870797 17:50657941-50657963 TCCTCTGAGTGGGGACCTGGAGG + Intronic
1149866964 17:60156483-60156505 TGACTTCAGTGGGGTGGTGGGGG + Intronic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1154325372 18:13387227-13387249 TGCCCACAGTGGGGTCGTGGAGG + Intronic
1155903433 18:31419617-31419639 TCACCTCAGTGGTGACCTAAAGG - Intergenic
1157533937 18:48444753-48444775 TCCTATCAGTGGGGTGCTGGAGG + Intergenic
1158623392 18:59051428-59051450 TCATCTCAGTGGGCACGTGGCGG - Intergenic
1160905649 19:1450545-1450567 TCACCTCAGGGAGGTCCGGATGG - Intronic
1161424423 19:4194932-4194954 ACACCTCAGTGGGCTCCGAGGGG + Intronic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG + Exonic
1166669527 19:44701528-44701550 TCCCCTCCCTGGGGTCCTCGGGG - Intronic
1166702022 19:44887736-44887758 TCCCCTCAGTGGTCTACTGGAGG + Intronic
1167669884 19:50844682-50844704 TCATCTCACAGGGGTCCTTGGGG - Intergenic
1167780623 19:51596536-51596558 TCACCGCAGTTGAGTCCTGAGGG + Intergenic
1167879617 19:52445108-52445130 TTGCCTCACAGGGGTCCTGGGGG - Intronic
1168117973 19:54235677-54235699 CCACCTCAGAGGGGTCCAGGAGG + Intronic
1168354026 19:55691277-55691299 TGACCTGAGTGGGTTCATGGGGG + Intronic
926283024 2:11465819-11465841 TCTCCTCCGTCGGGTCCAGGAGG + Exonic
930422099 2:51166273-51166295 TTATCTCACAGGGGTCCTGGGGG - Intergenic
930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG + Intergenic
931694986 2:64864986-64865008 TCTCCGGGGTGGGGTCCTGGGGG - Intergenic
932384979 2:71323783-71323805 TCGCCTCACAGGGGTCCTTGAGG - Intronic
936959371 2:118057310-118057332 CCACCCCAGTGGGCTCCTGGGGG - Intergenic
937984724 2:127633345-127633367 TCACCTCACTGGTGTCATTGGGG - Exonic
938247569 2:129790870-129790892 TCAGCTCAGAGTAGTCCTGGAGG + Intergenic
939010766 2:136843626-136843648 TGAGCTCAGTGTGGTACTGGTGG + Intronic
939983948 2:148812346-148812368 TCAGCTAATTGGGGTGCTGGTGG - Intergenic
941487919 2:166105006-166105028 TAACCTCAGTGAAGTCCTAGGGG + Intronic
942594001 2:177575048-177575070 TCACATCAGTGAGGTCATGCAGG - Intergenic
943646105 2:190408735-190408757 TCATCTTTGTGGGGTGCTGGGGG + Intronic
947270811 2:228332715-228332737 TCATCTCTCTGGGCTCCTGGTGG + Intergenic
947588386 2:231370775-231370797 TCAGCTCAGTTGGGGCGTGGAGG - Intronic
948609950 2:239160557-239160579 TCCCATCAGTGGAGTCATGGGGG + Intronic
948915038 2:241030181-241030203 TCCCCTCAGAGGGTGCCTGGTGG + Intronic
1172116277 20:32575248-32575270 GAACCACAGTGGGGTCCTGAAGG - Intronic
1172878848 20:38184291-38184313 TCACCTGAGTGAGCTCTTGGAGG - Intergenic
1173023821 20:39289574-39289596 ACACCTGAGGGGGATCCTGGAGG - Intergenic
1175308193 20:57992443-57992465 TCACCTCCCTGGGTTCCTGGAGG + Intergenic
1175947428 20:62565412-62565434 TCACCCCTGTGGGTCCCTGGAGG - Intronic
1176172271 20:63701378-63701400 GCACCTCAGAGGGGTCTTGAGGG + Intronic
1176372665 21:6071747-6071769 AAACCACAGTGGGGTGCTGGAGG - Intergenic
1178104696 21:29304702-29304724 ACACCTCCCTAGGGTCCTGGAGG - Intronic
1179605009 21:42509503-42509525 TCTCCTCACTGGGCTCCTGTAGG + Intronic
1179750811 21:43466496-43466518 AAACCACAGTGGGGTGCTGGAGG + Intergenic
1183900395 22:41001499-41001521 TTAGCTCAGTGGGGTAATGGTGG + Intergenic
1184049602 22:41994627-41994649 TCACTTCCTTGAGGTCCTGGAGG - Exonic
1184852275 22:47127889-47127911 TCACCTCAGGGGGCTCCTCAAGG - Intronic
1185228295 22:49666155-49666177 TCAGCTCAGTAGACTCCTGGAGG - Intergenic
949146116 3:701703-701725 TTACCTCACAGGGGTCCTTGGGG - Intergenic
949519659 3:4838422-4838444 TCACCTCACTGGGGGGTTGGGGG - Intronic
950105995 3:10388972-10388994 TGACCTCAGTGGGATCTTGTGGG + Intronic
953418179 3:42734808-42734830 TCACCTCCCTGGGGTGGTGGTGG - Intronic
954453808 3:50586170-50586192 ACACCTCAGGAGGGCCCTGGGGG - Intergenic
954668788 3:52276656-52276678 TCAGCATTGTGGGGTCCTGGAGG - Intronic
957074404 3:75590466-75590488 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
961279692 3:125756254-125756276 TCAGATCAGTGGGGTCCAGGGGG - Intergenic
961458013 3:127033756-127033778 TCTCCATATTGGGGTCCTGGAGG + Intronic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
961874704 3:130013351-130013373 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
962198102 3:133380418-133380440 GCCCCAGAGTGGGGTCCTGGGGG - Exonic
964432965 3:156624683-156624705 CCACCACAGTGGGGGCTTGGAGG - Intergenic
965600918 3:170454003-170454025 TCCCCTCAGAGTGGTCCTTGGGG + Intronic
967755953 3:193168591-193168613 TCAAATGAGTGGGGTCATGGAGG + Intergenic
968266434 3:197366955-197366977 TCGCCACAGAGGGGGCCTGGAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969018016 4:4118094-4118116 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
969291660 4:6243930-6243952 GCACCTGGGAGGGGTCCTGGAGG - Intergenic
969693529 4:8721765-8721787 TCAGCTCAGGGGGTTCCTCGGGG - Intergenic
969735978 4:8990619-8990641 TCAGATCAGTGGGGTCCAGGGGG - Intergenic
969795186 4:9522078-9522100 TCAGATCAGTGGGGTCCAGGGGG - Intergenic
971650984 4:29273700-29273722 TCAGCTCAGCGGGGTCCTACAGG + Intergenic
972607331 4:40625676-40625698 AGACCACAGTGGGTTCCTGGTGG - Intronic
980519368 4:133910589-133910611 TCATCTCACAGGGGTCCTCGGGG - Intergenic
983095783 4:163559685-163559707 TCACATCAGTGGGGCCCAAGAGG + Intronic
986603717 5:9500534-9500556 TCAGCTCAGTGGGTTCCCTGAGG - Intronic
989065400 5:37455886-37455908 TCACATCAGTGGTTACCTGGGGG - Intronic
992323541 5:75637413-75637435 TCAGGTCAGTGGGGTCCTCTTGG + Intronic
993904856 5:93611681-93611703 TGACCAGAATGGGGTCCTGGTGG + Intergenic
994164837 5:96597872-96597894 TCACCCCAGTGAGGATCTGGAGG + Intronic
996758805 5:126966155-126966177 TCACATCAGTGGTTTCCTGGAGG + Intronic
997265787 5:132494644-132494666 TCACCTTAGTGTGGTCCGTGTGG - Intergenic
1002334900 5:178470807-178470829 GCCGCTCAGTGGGGCCCTGGAGG - Intronic
1002874332 6:1198294-1198316 GCACCTCTGTGGAGTCCTGCTGG + Intergenic
1003908169 6:10720873-10720895 CCACCTCCGTGGGCTCCTGTAGG + Intergenic
1004515822 6:16321506-16321528 GCACCTAGGTGGGGGCCTGGGGG + Intronic
1005003443 6:21265191-21265213 CCACCTCATTGGGTTACTGGGGG + Intergenic
1006454854 6:34125791-34125813 TCACCACAGTGGGGGTTTGGGGG + Intronic
1006681410 6:35799182-35799204 TCACCTCACAGAGGTCCTGGGGG - Intergenic
1007628161 6:43258172-43258194 TAACCTTAGTGGGTCCCTGGGGG + Intronic
1008886291 6:56433760-56433782 TCACCTCACGGGGTTCTTGGGGG + Intergenic
1010021512 6:71165126-71165148 TCACCTCAGTGGTGGCCTTCCGG - Intergenic
1012138106 6:95584470-95584492 TCACCAGGGTGGGGTACTGGAGG - Intronic
1016510160 6:144833758-144833780 GCAGCTCATTGGTGTCCTGGTGG + Intronic
1018941734 6:168312983-168313005 GCCCCTGAGTTGGGTCCTGGAGG - Intronic
1018997663 6:168722609-168722631 TGACCCCTGTGGGGTCCAGGGGG - Intergenic
1019167290 6:170107133-170107155 TCACCAAAGAGGTGTCCTGGGGG - Intergenic
1019636211 7:2077416-2077438 TCAGTACAGTGGTGTCCTGGGGG - Intronic
1019636513 7:2078884-2078906 TCAGTACAGTGGTGTCCTGGGGG - Intronic
1019716391 7:2541358-2541380 CCACCTCTGTGGGACCCTGGCGG - Exonic
1019779370 7:2930489-2930511 CCACCACAGTAGGCTCCTGGCGG + Intronic
1020059962 7:5144441-5144463 GCACTGCACTGGGGTCCTGGGGG - Intergenic
1020140231 7:5607761-5607783 TCACCTCAGCGAGGTTCCGGCGG + Intergenic
1020373620 7:7461271-7461293 TCACATCACTGGGGTCCTTGAGG + Intronic
1020455761 7:8372232-8372254 TCATCTCTCAGGGGTCCTGGGGG - Intergenic
1020699843 7:11466562-11466584 TCACCTCAGTTGGGTATTTGAGG - Intronic
1021488629 7:21194062-21194084 TCACTTAAGTGTGTTCCTGGTGG + Intergenic
1023504322 7:40884446-40884468 TGAACTCAGTGGGGTGCTGTGGG + Intergenic
1026005696 7:66598711-66598733 TCTGCTCAGTGGGATCCTGCAGG + Intergenic
1026968880 7:74455833-74455855 TTTCCTCTGTGGGGTCCTGTGGG - Intronic
1028370549 7:90087184-90087206 CCACCTCAGTGTTTTCCTGGTGG + Intergenic
1028889779 7:95974077-95974099 TCACCTCATTGTGGCCTTGGTGG + Intronic
1029076456 7:97938603-97938625 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
1029330066 7:99845677-99845699 TCACCACAATGTGGTACTGGTGG - Intronic
1030304191 7:108002753-108002775 TCACCTTCGTGGGATCCTGGGGG - Intronic
1031597226 7:123662291-123662313 TCACCACAGTGTTGTCCTTGAGG - Exonic
1033842383 7:145390093-145390115 CCACCACACTGGGGACCTGGGGG + Intergenic
1035047742 7:155980412-155980434 ACCTCTCCGTGGGGTCCTGGAGG - Intergenic
1036035444 8:5013539-5013561 AAACCTCAATGGGGTCATGGAGG + Intergenic
1036241289 8:7083139-7083161 TCAGATCAGTGCGGTCCAGGAGG - Intergenic
1036305827 8:7601090-7601112 TCATATCAGTGGGGTCCAGGGGG - Intergenic
1036356675 8:8049087-8049109 TCATATCAGTGGGGTCCAGGGGG - Intergenic
1036473797 8:9074936-9074958 TCACCTCACTGTGGCGCTGGTGG - Intronic
1036686517 8:10914995-10915017 TCACCTCAGTGGCGCCTTCGTGG + Intronic
1036831668 8:12025407-12025429 TCCGATCAGTGGGGTCCAGGGGG + Intergenic
1036901891 8:12676197-12676219 TCAGATCAGTGGGGTCCAGGGGG + Intergenic
1042176557 8:66042913-66042935 TTGGCACAGTGGGGTCCTGGAGG - Intronic
1042374974 8:68039847-68039869 TCACCAAAGAGGGATCCTGGTGG - Intronic
1044039845 8:87354079-87354101 TCAGTTCAGGGTGGTCCTGGAGG - Intronic
1044907168 8:97017293-97017315 TCACCTCACAGGGGTCCTTGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045383361 8:101648248-101648270 TCACGTCTGTGGGACCCTGGGGG + Intronic
1048043496 8:130752476-130752498 TCAGATCACTGGGGCCCTGGGGG + Intergenic
1050217895 9:3348664-3348686 TCACCTCTGGAGGGTACTGGGGG - Intronic
1053391723 9:37740866-37740888 TCACCTGACGGGGGGCCTGGGGG - Exonic
1055330984 9:75183719-75183741 TAACCCCAGTGGGGACCCGGTGG + Intergenic
1057957076 9:99418704-99418726 TATCCCCAGTGGGGACCTGGTGG - Intergenic
1059381850 9:113933151-113933173 TGACTTCAGTGGAGTCCTGTTGG + Intronic
1060247481 9:121958552-121958574 TGACCTCTGTGAGGTGCTGGAGG - Intronic
1060399303 9:123338839-123338861 TCTCCTCAGTGTGGCCCTTGAGG - Intergenic
1061057479 9:128232226-128232248 CCACCTCAGAGGAGGCCTGGTGG + Intronic
1062069214 9:134546386-134546408 CCTCCTCAGTGGGCTCCCGGGGG + Intergenic
1187929085 X:24277462-24277484 TCTTCTCAGTGCGGTCCTGCAGG - Intergenic
1193773883 X:85620174-85620196 TCACCTCTGTGGCATGCTGGAGG - Intergenic
1198372642 X:136005891-136005913 CAACCTCAGTGGGATTCTGGTGG + Intronic