ID: 1165443384

View in Genome Browser
Species Human (GRCh38)
Location 19:35843644-35843666
Sequence GGTGTGAGAGGGCCCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165443378_1165443384 -9 Left 1165443378 19:35843630-35843652 CCCAGACAGGTCTGGGTGTGAGA 0: 1
1: 0
2: 2
3: 49
4: 539
Right 1165443384 19:35843644-35843666 GGTGTGAGAGGGCCCCAGGTGGG 0: 1
1: 1
2: 2
3: 34
4: 357
1165443379_1165443384 -10 Left 1165443379 19:35843631-35843653 CCAGACAGGTCTGGGTGTGAGAG 0: 1
1: 0
2: 1
3: 40
4: 378
Right 1165443384 19:35843644-35843666 GGTGTGAGAGGGCCCCAGGTGGG 0: 1
1: 1
2: 2
3: 34
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165443384 Original CRISPR GGTGTGAGAGGGCCCCAGGT GGG Intronic
900056428 1:634426-634448 GGGCTGAGAGGGCCCCTGTTAGG - Intergenic
900131269 1:1088279-1088301 GGCGTGGGAGGGTCCCAGGGAGG - Intronic
900524725 1:3122989-3123011 GGTGTGCAAGGGGCCAAGGTGGG + Intronic
900537931 1:3187964-3187986 AGTGTGTGTGGGCCCAAGGTCGG + Intronic
900629723 1:3627926-3627948 GGTGGGGAAGGGCCCCAGCTGGG + Intronic
900824391 1:4914338-4914360 GGAGGGAGAGGGCACCTGGTGGG + Intergenic
900994564 1:6113522-6113544 GGTGTCCAGGGGCCCCAGGTTGG + Intronic
901157180 1:7148731-7148753 GGTGGCAGAGGGCACCATGTGGG + Intronic
901323830 1:8355558-8355580 GGGGTGGGATGGCCCCAGGCAGG + Exonic
901857803 1:12055427-12055449 TGGCTGAGAAGGCCCCAGGTGGG - Intergenic
902413429 1:16225499-16225521 GGGGAGAGAGGGCACAAGGTAGG + Intergenic
902581544 1:17410745-17410767 TGTGTGGGAAGGCCCGAGGTGGG - Intronic
902816091 1:18917585-18917607 GTGGAGAGAGGGCCCCAGGGAGG + Intronic
903654767 1:24942557-24942579 GGGTTGAGAGGGACCCAGGAAGG + Intronic
903706960 1:25292972-25292994 GGAAAGAGAGGGCCCCAGGTGGG + Intronic
903720278 1:25400375-25400397 GGAAAGAGAGGGCCCCAGGTGGG - Intronic
904291702 1:29490407-29490429 GGTGGGAGAGGGCTCCAGGAAGG + Intergenic
904386014 1:30142703-30142725 GTTGTGGGAGGGACCCAGGGGGG - Intergenic
904891780 1:33784623-33784645 GGGGAGGGAGGGCCCTAGGTGGG + Intronic
905775497 1:40665223-40665245 GGTGTGAGAGGGCTCTGGGGAGG - Intronic
906579880 1:46927601-46927623 GGGGTGGGAGGAGCCCAGGTAGG - Intergenic
906603841 1:47151286-47151308 GGGGTGGGAGGAGCCCAGGTAGG + Intergenic
907021183 1:51068095-51068117 GTTGTGGGAGGGACCCCGGTGGG - Intergenic
907310343 1:53535480-53535502 GGACTGAGAGGCCCCAAGGTGGG - Intronic
907432438 1:54421026-54421048 GGAGTCAGAAGGCCCCAGATGGG - Intergenic
907439947 1:54472913-54472935 GGTGAGCTTGGGCCCCAGGTGGG - Intergenic
909392784 1:75135504-75135526 GGTCCGGGAGGCCCCCAGGTTGG + Intronic
910085469 1:83396628-83396650 GTTGTGGGAGGGACCCCGGTGGG - Intergenic
910373999 1:86549556-86549578 GGTGTAGAAGGACCCCAGGTAGG + Intronic
910965669 1:92805755-92805777 CTTGTGGGAGGGACCCAGGTGGG + Intergenic
912382717 1:109255906-109255928 GCTGGGAGAGGGGCCCAGGCGGG + Intronic
912423275 1:109562760-109562782 GATGTTAGAGGGCCCTAGGTAGG + Intronic
912584115 1:110746351-110746373 GGTGAGAGAGGGCACAGGGTTGG - Intergenic
913330318 1:117661847-117661869 AGTGTGAGGTGGGCCCAGGTGGG + Intergenic
913709878 1:121472513-121472535 GGTTTGAGAGGGGCCAAGGGTGG - Intergenic
913966848 1:143383686-143383708 GGAGAGAGAGAGCCACAGGTGGG + Intergenic
914061224 1:144209293-144209315 GGAGAGAGAGAGCCACAGGTGGG + Intergenic
914117926 1:144757076-144757098 GGAGAGAGAGAGCCACAGGTGGG - Intergenic
915191409 1:154154029-154154051 GGTGTGAGAGGACCCAATGATGG - Intronic
915248030 1:154569712-154569734 GGTGTGAGAGGGACCCTGGGTGG + Intronic
915269491 1:154743420-154743442 GCTCAGAGAGGCCCCCAGGTTGG - Intronic
915624553 1:157106731-157106753 GGTATCAGAGGCCCCCAGCTGGG - Intergenic
916064958 1:161128886-161128908 GGTGACAGAGGACCCAAGGTTGG - Intronic
916656222 1:166877694-166877716 GGTGTGTGAGGTACACAGGTAGG - Intergenic
917132515 1:171757193-171757215 GGTGGGGAAGGGCTCCAGGTGGG - Intergenic
917133372 1:171764305-171764327 GGTGGGGAAGGGCCCCAGGTGGG - Intergenic
917211142 1:172633154-172633176 GGTGGGGGAAGGCCCCAAGTGGG - Intergenic
918462012 1:184786588-184786610 TGTGTGAGAGTGACCAAGGTTGG + Intergenic
919407258 1:197201046-197201068 GGTGAGAGACGGCCCCAGGAGGG + Intergenic
920093649 1:203471915-203471937 GGGGTGAGTGGGCCCCTGCTGGG - Intergenic
920674188 1:208027987-208028009 GGTGAGACAGGGCCCCAGCAGGG - Exonic
920695761 1:208180322-208180344 GGTGGGAGAGGGGCTCCGGTAGG + Intronic
921165013 1:212500564-212500586 GAGGGGAGAGGGCCCCAGGCTGG + Intergenic
922293320 1:224227255-224227277 GGAGTGATAGGGCATCAGGTTGG + Intergenic
923325711 1:232878418-232878440 GGTGTGAGAGGAGTCCGGGTAGG - Intergenic
1063034231 10:2269344-2269366 GGTGTGAGTGGACCAGAGGTGGG + Intergenic
1063782937 10:9347770-9347792 GTTGTGAGAGGGACCCAGTGTGG + Intergenic
1063865696 10:10363191-10363213 GGTGTCAGAGTGCCCAAGGGAGG + Intergenic
1064336885 10:14451542-14451564 GTTGTGAGAGGGACCCAAGGGGG + Intronic
1066053572 10:31659967-31659989 GGTGCAAGTGGGCCCCTGGTGGG - Intergenic
1066676983 10:37897710-37897732 GGTGTCAGTGTGCCCCTGGTGGG - Intergenic
1066687730 10:37996174-37996196 GGTGTCAGTGTGCCCCTGGTTGG - Intergenic
1067095040 10:43294607-43294629 GGGGTGAGAGGATCCCAGGAGGG - Intergenic
1067095049 10:43294628-43294650 GGGGTGAGATGACCCCAGGAGGG - Intergenic
1067095057 10:43294649-43294671 GGGGTGAGATGTCCCCAGGAGGG - Intergenic
1067175704 10:43944016-43944038 GTGGTGGGAGGGACCCAGGTTGG + Intergenic
1067281167 10:44874336-44874358 GGCTTGGCAGGGCCCCAGGTAGG + Intergenic
1067781049 10:49207752-49207774 CGGGTCAGATGGCCCCAGGTGGG + Intergenic
1067837872 10:49652757-49652779 GGTGTGGGAGGGCCTCAGGTGGG - Intronic
1067945215 10:50684767-50684789 GGTGTGAGCAGGGCCCAGGGTGG - Intergenic
1069571978 10:69499834-69499856 GCTGTGCAAAGGCCCCAGGTGGG + Intronic
1070866725 10:79711639-79711661 GGTGTGAGCAGGGCCCAGGGTGG - Intronic
1070880514 10:79849760-79849782 GGTGTGAGCAGGGCCCAGGGTGG - Intronic
1071633635 10:87233862-87233884 GGTGTGAGCGGGGCCCAGGGTGG - Intronic
1071647083 10:87366078-87366100 GGTGTGAGCGGGGCCCAGGGTGG - Intronic
1074043674 10:109817696-109817718 GGTGTCAGTGTGCCCCTGGTGGG + Intergenic
1074836647 10:117302702-117302724 GTTGTGGGAGGGACCCAGGGGGG + Intronic
1075551938 10:123399500-123399522 GCTGTCAGAAGTCCCCAGGTTGG - Intergenic
1075625885 10:123964337-123964359 GGTGTGCAAGGCCCCCAGGGAGG - Intergenic
1075636168 10:124031956-124031978 TGTGTGAGGGGGCCTCAGGGTGG - Intronic
1077032370 11:474312-474334 GGTGGGTGAGGGCACCAGATGGG + Intronic
1077032396 11:474392-474414 GGTGGGTGAGGGCGCCAGATGGG + Intronic
1077032410 11:474433-474455 GGTGGGTGAGGGCTCCAGATGGG + Intronic
1077238922 11:1500596-1500618 GGTCTGAGAGGGGTCCAGGGAGG - Intronic
1077305795 11:1868208-1868230 TTTGTGAGAGGGCACCAGGCCGG + Intronic
1077338314 11:2015192-2015214 AGAGTGAGAGGGCCCCAGTGTGG - Intergenic
1077386610 11:2272195-2272217 GGTGTGCTGGGGGCCCAGGTGGG - Intergenic
1077440333 11:2565928-2565950 GGTGTCAGATGGCCCCAAGGCGG - Intronic
1079042079 11:17068242-17068264 GGCCTGAGAGGGGCCCAGCTGGG + Intergenic
1079870704 11:25794607-25794629 AGTGGGAGAGGGCCCCAACTTGG + Intergenic
1080341874 11:31274007-31274029 GTTGTGGGAGGCACCCAGGTGGG - Intronic
1081795129 11:45813475-45813497 GCTCAGAGAGGGCCCCAGGAAGG + Intergenic
1081939281 11:46927182-46927204 GTTGTGGGAGGGACCCAGGGGGG + Intergenic
1083901557 11:65645957-65645979 GGTGTGAGGGGGACCAACGTGGG + Exonic
1084029569 11:66473433-66473455 GGAGTGAGTGAGCCCCAGGAAGG + Exonic
1085417630 11:76329909-76329931 GGAATGAGGGGGCCCCAGGATGG + Intergenic
1087059957 11:93967613-93967635 AGCGTGAAAGGGCCTCAGGTGGG + Intergenic
1087242080 11:95790757-95790779 GGCGCGAGTGGGCCCCACGTCGG + Intronic
1088099644 11:106141803-106141825 GGTCAGATAGGGCTCCAGGTGGG + Intergenic
1088100256 11:106146648-106146670 TGTTTGGAAGGGCCCCAGGTGGG + Intergenic
1088435123 11:109804126-109804148 GTTGTGAGAGAGACCCAAGTAGG - Intergenic
1089468061 11:118698438-118698460 GGTGGGCGAGGAACCCAGGTAGG - Intergenic
1089625481 11:119748340-119748362 GCTGGGACAGGGCCCCAGGATGG - Intergenic
1090629009 11:128629930-128629952 GGTGTGGCAAGGCCCCAGGTGGG + Intergenic
1202821298 11_KI270721v1_random:70374-70396 AGAGTGAGAGGGCCCCAGTGTGG - Intergenic
1091824816 12:3504467-3504489 GGTGTCAGTGTGCCCCTGGTGGG + Intronic
1092907617 12:13116316-13116338 GGCGTGAGAAGGGCCCAGGCTGG - Intronic
1093179555 12:15951440-15951462 GCTGTGAAAATGCCCCAGGTAGG + Intronic
1093213173 12:16331674-16331696 AGTGTGAGATGACCTCAGGTAGG - Intergenic
1093228423 12:16513859-16513881 GGTGTGCGACTTCCCCAGGTTGG - Intronic
1093525165 12:20096917-20096939 CATGTGAGAGGGCCACAGGGAGG + Intergenic
1095954347 12:47797891-47797913 TGTGTGAGAAGGGCTCAGGTGGG + Intronic
1096103225 12:48981790-48981812 GGTTTGAGGAGTCCCCAGGTAGG - Intergenic
1096583003 12:52600496-52600518 GTTGTGGGAGGGACCCAGGGGGG + Intronic
1097372041 12:58796068-58796090 GGTGGGAGAGGGCCACAGCCTGG + Intronic
1098867999 12:75784207-75784229 GTTGTGAGAAGGCCTCAGGGGGG - Intergenic
1098946177 12:76592183-76592205 GTTGTGGGAGGGGCCCTGGTGGG + Intergenic
1101723986 12:107374424-107374446 GGTGTGGGAGGGTCCCAGCCTGG - Intronic
1101951375 12:109178858-109178880 GGTGGGGGACGGCCCCAGGTGGG - Intronic
1103119854 12:118372037-118372059 AGTGTGAGAAGACCCCAGGAAGG - Intronic
1104655575 12:130571838-130571860 TGTGTGAGGGGGCCACAGGGAGG - Intronic
1104958638 12:132477789-132477811 GGGGTGAGAGAGGCCGAGGTGGG + Intergenic
1105072285 12:133241939-133241961 GGTTTGGGAGGGGCCCAGGGTGG + Intergenic
1106124707 13:26890802-26890824 AGTGTGAAATGGCCCCAGGGGGG - Intergenic
1106487417 13:30184773-30184795 GGTGTCAGTGGGGCCCAGGGGGG - Intergenic
1106606693 13:31235121-31235143 GGTGGGAGATGGACCCAGGCTGG + Intronic
1108703553 13:52964607-52964629 GGTGAGAGGGGCCCCTAGGTTGG - Intergenic
1111998230 13:95186010-95186032 GGTTTGAGAGGGACCCAAGCAGG + Intronic
1113251569 13:108458609-108458631 GGTGTGAGAGGGCGCGAGAGTGG - Intergenic
1114485836 14:23061237-23061259 GGTGGGAAAGGGACCCAGATGGG - Intronic
1114635491 14:24184626-24184648 TGAGTGAGAGGTTCCCAGGTGGG - Intronic
1115235540 14:31206702-31206724 GGGGAAAGAGGGCCCTAGGTTGG - Intronic
1116858404 14:49974032-49974054 GGTGGGAGAGTGACCCAAGTTGG + Intergenic
1118955323 14:70475943-70475965 GGTGTCAGTGGGCCCCTGCTGGG - Intergenic
1119424906 14:74528803-74528825 GGAGGGAGGGAGCCCCAGGTTGG + Intronic
1120644560 14:87058100-87058122 GTTGTGGGAGGGACCCAGGGTGG + Intergenic
1121789341 14:96687233-96687255 GGTGTCAGGGAGCCCCAGGCTGG - Intergenic
1122129327 14:99596017-99596039 AATGACAGAGGGCCCCAGGTGGG + Intronic
1122301760 14:100735437-100735459 AGTCAGAGAGAGCCCCAGGTTGG + Exonic
1123947271 15:25244869-25244891 GCTTGGAGAGGGCACCAGGTTGG + Intergenic
1124345025 15:28916499-28916521 GGTGGGAGAGGGAGACAGGTGGG - Intronic
1124955748 15:34359226-34359248 GGTGTGTGGGGGGCGCAGGTAGG + Exonic
1127961810 15:63895824-63895846 GGGGAGAGAGGGCCCCAGGAGGG - Intergenic
1128577027 15:68783289-68783311 GGTGTGAGAGGCCTCCAGAAGGG - Intronic
1129879195 15:78995993-78996015 GGGCTGAGAGGGCCCCAGAAGGG - Intronic
1129924272 15:79348939-79348961 GGTGGGGGAGGGCCCGAGGTGGG - Intronic
1131410873 15:92207474-92207496 GGTGTGGAAGGGACCCAAGTGGG - Intergenic
1132405498 15:101539820-101539842 GGTGGAAGGGGGCCCCTGGTAGG + Intergenic
1132479454 16:159941-159963 GCTGTGAGAGGTGCCCAGGACGG + Intronic
1132479523 16:160197-160219 GTTGTGAGAGGTGCCCGGGTCGG + Intronic
1132496358 16:265273-265295 GGTGTGAGCGGGACCCTGGTGGG - Exonic
1132501997 16:288588-288610 GCTGAGGGAGGGCCCCAGTTGGG - Intronic
1132814430 16:1818989-1819011 GGTGTGAGGGGGCCCAGGGGTGG - Intronic
1133230183 16:4362667-4362689 GGAGAGTGAGGGCCCCAGGCTGG + Exonic
1136160036 16:28413984-28414006 GGTGTCAGAGGGTGCCAGGGTGG + Intergenic
1136203052 16:28701308-28701330 GGTGTCAGAGGGTGCCAGGGTGG - Intronic
1137441757 16:48504131-48504153 GGTGTTGGAGGGGCCCAGGCTGG + Intergenic
1138575263 16:57903651-57903673 GGTGTGAGAGGTGCCCAGTGGGG - Intronic
1140339386 16:74141937-74141959 GGTGGGAGCTGGCCCCAGGGAGG + Intergenic
1140831970 16:78760297-78760319 GTTGTGGGAGGGACCCTGGTGGG - Intronic
1140874105 16:79134514-79134536 GGTAGGAGTGGGCCCCGGGTAGG - Intronic
1141043586 16:80693849-80693871 GGTGTCAGAGGCTCCCAGGATGG + Intronic
1141101433 16:81200266-81200288 GCTATGAGAGGGCTCCAGGTGGG + Intergenic
1143503300 17:7351202-7351224 GGAGCGCGAGGTCCCCAGGTGGG + Intronic
1143893972 17:10122521-10122543 GGTGAGGGAGGGCGCCAGGGAGG - Intronic
1144581044 17:16459795-16459817 GGGGTGGGAGGTCCCCAGGCTGG - Intronic
1144679136 17:17181260-17181282 GGTGGGGGAGGGCCCATGGTGGG + Intronic
1144698272 17:17320617-17320639 GGTGTGTGAGGCGTCCAGGTGGG + Intronic
1144849073 17:18235028-18235050 GGTGGCAGAGGGCACCAGGTGGG - Intronic
1144944475 17:18962765-18962787 CTTGTGAGGAGGCCCCAGGTAGG + Intronic
1145001054 17:19304870-19304892 GGCGTGAGAAGACCCCATGTGGG - Intronic
1145286061 17:21506683-21506705 GCAGGGAGAGGGACCCAGGTCGG - Intergenic
1145391545 17:22459608-22459630 GCAGGGAGAGGGACCCAGGTCGG + Intergenic
1145797457 17:27664116-27664138 GAGCTGAGAGGCCCCCAGGTGGG + Intergenic
1145811854 17:27769052-27769074 GAGCTGAGAGGCCCCCAGGTGGG + Exonic
1146422880 17:32705772-32705794 GTTGTGGGAGGGACCCAAGTGGG + Intronic
1147418907 17:40312326-40312348 GGTGTGGGATGCCCCCAGGATGG + Intronic
1147419634 17:40316068-40316090 GGCAGGAGAGGTCCCCAGGTGGG - Intronic
1147635324 17:41960530-41960552 AGAGTGAGAGAGCCCCAGCTGGG + Intronic
1148132488 17:45270505-45270527 GCTGTGAGAGGGGCGCAGGAGGG + Exonic
1148332491 17:46820740-46820762 GGTGGGACAGGACTCCAGGTAGG - Intronic
1149527259 17:57366336-57366358 GGCGTGAGAAGGGCCCAGGCTGG - Intronic
1149575441 17:57708451-57708473 GGTGGGAGGGTGCCCCAGGATGG - Intergenic
1151431487 17:74066477-74066499 GGTGTGGCTGAGCCCCAGGTGGG - Intergenic
1152409855 17:80117821-80117843 GGTGGGGGAGAGGCCCAGGTGGG + Intergenic
1152458556 17:80429708-80429730 GGTGTGAGGGGGTGTCAGGTAGG + Intronic
1152761127 17:82107516-82107538 GGAGGAAGAGGCCCCCAGGTAGG + Intronic
1152772735 17:82180130-82180152 GTTGTGAGAGGGTCCCTGGAGGG + Intronic
1152781102 17:82227801-82227823 GGGGTGGTTGGGCCCCAGGTAGG + Intergenic
1154212804 18:12394563-12394585 GGCGTGAGAGGCACCCAGGCGGG + Intergenic
1155234542 18:23806196-23806218 GGGGTAATTGGGCCCCAGGTTGG - Intronic
1157684724 18:49632900-49632922 GGTGGGAGAGGACCACAGGCAGG - Intergenic
1158271396 18:55720767-55720789 GGTGTCAGTGTGCCCCTGGTGGG + Intergenic
1158732028 18:60034946-60034968 GGTGTCAGTGTGCCCCTGGTGGG + Intergenic
1160740504 19:683345-683367 GGTGAGGCAGGGCCCCAGGGTGG - Exonic
1160752622 19:741566-741588 GGGGTGAGGGGGAACCAGGTTGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161327624 19:3671196-3671218 GGTGTGGGGGGGCCCCAGAGGGG - Intronic
1161522568 19:4733008-4733030 GGTGTGATCGGACACCAGGTAGG - Intergenic
1161662772 19:5557477-5557499 GAGGTGAGAGGGCCCCAGGAAGG - Intergenic
1161698509 19:5783125-5783147 GGTGGCAGGGGGCCCCGGGTGGG + Exonic
1161716136 19:5877154-5877176 GTGGGGAGAGGGGCCCAGGTGGG + Intronic
1161977820 19:7615848-7615870 GGTGACAGGGGGCCTCAGGTGGG + Intronic
1163795601 19:19336054-19336076 GGTTTGAAAGGGCCACAGCTTGG - Intronic
1163832776 19:19554947-19554969 GGCCTGTGAGGGTCCCAGGTAGG + Intergenic
1165443384 19:35843644-35843666 GGTGTGAGAGGGCCCCAGGTGGG + Intronic
1165724615 19:38104074-38104096 GGAGTGAGAAGGCCCCAAGATGG + Intronic
1166218522 19:41351676-41351698 GGAGTGAGAAAGCCCCACGTGGG - Intronic
1166901545 19:46067718-46067740 GCTCTGACAGGGCCCCAGGTTGG + Intronic
1167696949 19:51020383-51020405 GGTGTGAGATGGCCACACATGGG - Intergenic
1167772158 19:51528138-51528160 GGTGAGAGTGGGCTCCAGGGAGG - Exonic
1168355060 19:55695468-55695490 AGTGTGAGTGGGCCCCAGGAAGG - Intronic
1202700632 1_KI270712v1_random:161181-161203 GGAGAGAGAGAGCCACAGGTGGG + Intergenic
925069676 2:956419-956441 GGTGTGTGAAGGCCCGAGGGAGG - Intronic
925257265 2:2500709-2500731 GTTGTGGGAGGGACCCAGGGGGG - Intergenic
925299332 2:2799401-2799423 GCTGAGACTGGGCCCCAGGTAGG + Intergenic
926228177 2:10983236-10983258 GGTGGGAGAGGGCTGCAGGCTGG - Intergenic
926677746 2:15640454-15640476 GGTGGGAGGGGGCCCCGGGGAGG - Intergenic
927285649 2:21354288-21354310 GGTGGGGGAGGGCCCCAGGTGGG + Intergenic
928838328 2:35575142-35575164 GGTGGCAGCAGGCCCCAGGTAGG + Intergenic
929795422 2:45055202-45055224 GTTGGGCGAGGGGCCCAGGTTGG + Intergenic
930021870 2:47006591-47006613 GGGGTGGGAGGACCCCTGGTGGG + Intronic
931288189 2:60850077-60850099 GGTGTGGGAGGGATCCAGGGTGG - Intergenic
933437023 2:82261148-82261170 GGTGTGGGAGGGCCCCAGGTGGG - Intergenic
934171560 2:89544653-89544675 GGAGAGAGAGAGCCACAGGTGGG + Intergenic
934281868 2:91618971-91618993 GGAGAGAGAGAGCCACAGGTGGG + Intergenic
936055526 2:109259326-109259348 GGTCTCAGAGGGCTTCAGGTAGG - Intronic
937426296 2:121801710-121801732 GGTGTCAGTGGGCCCCAGCCGGG + Intergenic
939341490 2:140901147-140901169 GGTGGGGGAGGGCTCCAAGTGGG + Intronic
941560139 2:167034884-167034906 GTTGCGGGAGGGCCCCAGGTGGG + Intronic
944262467 2:197692804-197692826 GGTGTCAGTGTGCCCCTGGTGGG + Intergenic
944266233 2:197729689-197729711 GGTGTCAGTGTGCCCCTGGTGGG - Intronic
944889212 2:204099694-204099716 TGTGTGAGAGAGCCCCTTGTTGG + Intergenic
945480166 2:210336208-210336230 GTTGTGAGAGGGACCCAGCGGGG + Intergenic
945720718 2:213415501-213415523 GGTGAGAGATGGGCACAGGTTGG + Intronic
946160817 2:217834976-217834998 GGGGTGACAGTGCCCCAGGTGGG - Intronic
946419819 2:219558359-219558381 GCTGTGAGGTGGCCCCAGCTGGG - Exonic
947667939 2:231918836-231918858 CGTGTGTGGGGGCCCAAGGTAGG + Intergenic
948353489 2:237359733-237359755 GGAGTGAGAGGACAGCAGGTGGG - Intronic
948818039 2:240523500-240523522 GGTGTGAGAGCTGCCCAGGCAGG + Intronic
1170395749 20:15923419-15923441 GTTGTGGGAGGGACCCAGGGAGG - Intronic
1170971817 20:21124094-21124116 TGTGTGTGAGCACCCCAGGTGGG - Intergenic
1171973829 20:31581407-31581429 GGTGGGCGTGGGCCGCAGGTCGG - Intergenic
1172031224 20:31983577-31983599 GGTGGGAGAGGGTCCCCGGGAGG + Intronic
1172124341 20:32616430-32616452 GATGTGTGCTGGCCCCAGGTGGG - Intergenic
1172303098 20:33863402-33863424 GGTGGGAGTGGGTCCCAGGCTGG + Intergenic
1172798055 20:37556866-37556888 CCTGTGTGAGGGCCCCAGGGTGG - Intergenic
1173319223 20:41972486-41972508 GGTGAGCAAGGGCCCCAGGGTGG - Intergenic
1173328462 20:42054590-42054612 GGTATGAGGGGGCCCCTTGTAGG + Intergenic
1173848956 20:46205901-46205923 GGGGAGAGTGTGCCCCAGGTTGG - Intronic
1174181976 20:48680662-48680684 AGTGAGGGAGGGACCCAGGTGGG - Intronic
1175198914 20:57265292-57265314 GGGCTGAGAGGGGCCCAGGAAGG + Intronic
1175216140 20:57392475-57392497 TTTGTGGGAGAGCCCCAGGTAGG + Intronic
1175228365 20:57458572-57458594 CGTGTGAAAGGGCCCCAGGAGGG - Intergenic
1176059343 20:63165491-63165513 GGTTCGAGAGTGACCCAGGTCGG - Intergenic
1176061387 20:63174387-63174409 GGTGGAAGAGGGCCCCTGCTAGG + Intergenic
1176744469 21:10639439-10639461 GGAGTAAAAGGGCCCCAGATCGG + Intergenic
1178454091 21:32730644-32730666 GGAGAGAGACAGCCCCAGGTAGG + Intergenic
1178773313 21:35525981-35526003 TTTGGGAGAGAGCCCCAGGTGGG + Intronic
1179473637 21:41629293-41629315 GGTGGGGAAGGGCCCCAGGTGGG - Intergenic
1179582116 21:42350655-42350677 GGTGTCAGCGGGCCCCGTGTCGG - Intronic
1180626078 22:17194366-17194388 GGTGTGGGAGGCCCCTAGGCTGG - Intronic
1180935969 22:19625580-19625602 GGTGTGACAGGCCCCTGGGTGGG - Intergenic
1180970111 22:19810816-19810838 GATGTGAGAGGTCCCCAGACAGG + Intronic
1181055949 22:20260581-20260603 GGTGAGTGAGTTCCCCAGGTAGG + Intronic
1181671545 22:24427744-24427766 GGGGTGAGTGGCCCCCAGGCGGG + Intronic
1182555296 22:31125720-31125742 GGCCTGAGGGGGCCCCAGGCCGG - Exonic
1183282110 22:36937583-36937605 GCTGTGGGGCGGCCCCAGGTAGG - Exonic
1183282984 22:36942773-36942795 GGTTGGGGAGGGCCCCAAGTGGG - Intergenic
1183341459 22:37284093-37284115 TGCGGGAGAGAGCCCCAGGTTGG + Intronic
1183494546 22:38135087-38135109 GGTGAGAGAGGGGCCCCGGTTGG + Intronic
1183723247 22:39574351-39574373 GGTGGGAGAGGGGCCAAGGAGGG + Intronic
1183759764 22:39805433-39805455 GAAGTGAAAGGGCCTCAGGTTGG + Intronic
1183975599 22:41510262-41510284 GGTGTGGGAGGACCCCAGACTGG - Intronic
1184004097 22:41696419-41696441 GGAGTGAGAGGCCCACAGGCAGG + Exonic
1184591044 22:45483474-45483496 GGTCAGGGAGGGCTCCAGGTGGG + Intergenic
1184645186 22:45891484-45891506 GGAGGGAGTGGGCCCCAGGGTGG - Intergenic
1184880244 22:47299999-47300021 GGTGCGTGAGGGCCCTGGGTGGG + Intergenic
950416114 3:12869783-12869805 GGTGGGAAGGGGCCACAGGTGGG - Intronic
950475739 3:13213955-13213977 GTTGGGAGAGGGCCCTAGATGGG - Intergenic
951784826 3:26406281-26406303 GGTGTGGGAGAGCCCCATATGGG - Intergenic
952702857 3:36344126-36344148 GGTAGGGGAGGGACCCAGGTGGG - Intergenic
954451897 3:50576177-50576199 GGCTTGAGAGGCCCCCAGGGAGG - Intronic
954752926 3:52823801-52823823 GGTGCCAGTGTGCCCCAGGTGGG - Exonic
959695547 3:109245759-109245781 GTTGTGAGAGGGATCCAGGGCGG - Intergenic
961831759 3:129626775-129626797 GGGGTGGGAGGGGCCCAGGCTGG + Intergenic
962166872 3:133058609-133058631 GGGGTGAGAGGCCCCCAGAGAGG + Intronic
962746205 3:138398912-138398934 GATGTGAAGGGGCTCCAGGTAGG + Intronic
962754828 3:138459236-138459258 GGTGTGAACGGGATCCAGGTGGG + Exonic
963284091 3:143416281-143416303 GGTTTGAGAGGGCTCCAAATTGG + Intronic
964913199 3:161807375-161807397 ACTGTGAGTGGGCCCCAGGCAGG + Intergenic
964990795 3:162809302-162809324 AGAATGAGAGGGCCCCAGGAAGG + Intergenic
966063392 3:175786977-175786999 GGTGTCAGAGTGCCCCTGCTGGG + Intronic
966204618 3:177394041-177394063 GGTGTCAGAGTGCCCCTGCTGGG + Intergenic
968995237 4:3941234-3941256 GGTGCGAGGGGAGCCCAGGTGGG + Intergenic
969028200 4:4191234-4191256 GGAGAGAGAGAGCCACAGGTGGG - Intronic
969612574 4:8235575-8235597 GATGTGGGTGGGCCCCAGGGGGG + Intronic
969721126 4:8893533-8893555 GGTGTAAGGGGGACCCAGGTAGG - Intergenic
970348274 4:15174744-15174766 GGTGTCAGTGTGCCCCAGCTGGG - Intergenic
971114535 4:23629535-23629557 GTTGAGGGAGGGCCCCTGGTGGG + Intergenic
972136368 4:35899676-35899698 GGTTTGGGAGAGCTCCAGGTTGG + Intergenic
972605620 4:40610729-40610751 GGTGTGGGAGGAACCCAGGGGGG + Intronic
973766532 4:54168245-54168267 TGTATGAGAGGGTCCCAGGATGG + Intronic
984095476 4:175427995-175428017 GGTGGGCGCGGGCTCCAGGTGGG + Intergenic
984478230 4:180264843-180264865 GGTGTGAGAGAGAGCCAGATAGG + Intergenic
985631821 5:1017887-1017909 GGTGTGAGAGAGGCCGAGCTGGG + Intronic
985761515 5:1751536-1751558 GGAGGGCGAGGGGCCCAGGTGGG - Intergenic
987806489 5:22775838-22775860 GTTGTGGGAGGGACCCAGGGGGG + Intronic
989637255 5:43549367-43549389 GTTGTGGGAGGGACCCAGGAGGG + Intronic
990606985 5:57420706-57420728 GCTGTGAGAGGGACCCAGGCAGG + Intergenic
994459191 5:100051845-100051867 GGGCTGAGAGGGCCCCCGTTAGG + Intergenic
996384384 5:122895560-122895582 TGTGTGAGAGGCCCCTAGGCTGG + Intronic
997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG + Intronic
998506730 5:142678448-142678470 GGTGAGGGAGAGTCCCAGGTTGG - Intronic
999314492 5:150575217-150575239 AGTGTGAGGGGACCCCATGTGGG - Intergenic
1001435711 5:171697669-171697691 AGTGAGAGGGGGTCCCAGGTGGG - Intergenic
1002481743 5:179505949-179505971 TGTGGGAGAGGGCTCCAGGTGGG + Intergenic
1004260467 6:14103149-14103171 GGTGTGAGGAGGGCCCAGGAAGG - Intergenic
1004772546 6:18800567-18800589 TGAGTGAGAGGGCACCAGGTAGG + Intergenic
1005186864 6:23172338-23172360 TATGTGAGAGGCCCCCAGTTAGG - Intergenic
1006436220 6:34027398-34027420 GGTGGGGGAGGGCACCAGGCAGG - Intronic
1008763190 6:54879043-54879065 GGTGTCAGAGGCCCCAAAGTTGG + Intronic
1010832735 6:80551110-80551132 GGTGGCGGAGGTCCCCAGGTGGG - Intergenic
1013178956 6:107701909-107701931 CAAGTGAGAGGCCCCCAGGTCGG + Intergenic
1014249100 6:119097937-119097959 CCGGTGAGAGGGCCCCAGTTTGG - Intronic
1016239912 6:141917596-141917618 GGTGTGAGTGTGCCCCTGCTGGG - Intergenic
1018046314 6:159969272-159969294 GGCGGGCGCGGGCCCCAGGTGGG - Exonic
1019732978 7:2637723-2637745 GGTGTGGGAGGGTCACAGGAGGG + Intronic
1020012780 7:4815707-4815729 AGTGGGAGAGGGTCCCAGCTAGG - Intronic
1020948731 7:14648371-14648393 GGTGTGAGTGTGCCCCTGCTGGG - Intronic
1022274532 7:28842357-28842379 GTTGTGGGAGGGCCACAAGTGGG - Intergenic
1022288046 7:28974314-28974336 GGTGTGAGAGAGGGCCAGGTGGG + Intergenic
1022711077 7:32850874-32850896 GTTGTGAGAGGGACCCTGGTGGG - Intergenic
1023875235 7:44283105-44283127 GGTGTGCCAGAGCGCCAGGTGGG - Intronic
1024137792 7:46428960-46428982 GTTGTGGGAGGGACCCAGGGAGG - Intergenic
1025213750 7:57037271-57037293 GGTGTCAGTGTGCCCCAGCTGGG - Intergenic
1025658203 7:63539546-63539568 GGTGTCAGTGTGCCCCAGCTGGG + Intergenic
1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG + Intronic
1026994463 7:74606548-74606570 GGCGGGAGGGGGCGCCAGGTGGG - Intergenic
1027302342 7:76853089-76853111 GTTGTGGGAGGGACCCCGGTGGG - Intergenic
1028849885 7:95526222-95526244 AGTGGGAGAGAGCCCCAGGTGGG + Intronic
1029221671 7:98995255-98995277 GGTAGGAGATGGCACCAGGTGGG + Intronic
1029859698 7:103556545-103556567 ATTGTGGGAGGGACCCAGGTGGG + Intronic
1030168964 7:106582504-106582526 AGTGTGAGAGAGCCCCTGGGGGG + Intergenic
1030798904 7:113825053-113825075 GCTGTGAGGGGGCTGCAGGTAGG - Intergenic
1034429014 7:151031368-151031390 GGTGGGAGAAGGCCTCATGTAGG + Intronic
1035114320 7:156510074-156510096 GGTGTGGGAATGCCCCAGGAAGG - Intergenic
1035312365 7:157977577-157977599 GACGTGAGAAGGCCCCAGGTGGG + Intronic
1035473474 7:159126602-159126624 GGTGTGAGACGGCCACATGCTGG + Intronic
1035492875 7:159295379-159295401 GGTTTGGGAGGGGCCCAGGATGG + Intergenic
1035597267 8:868448-868470 GCTGTGAGAAGGTCCCTGGTTGG + Intergenic
1035840666 8:2809401-2809423 GTTGTGGGAGGGACCCAGTTGGG - Intergenic
1036753585 8:11457776-11457798 AGTGTGAGAGGGCTTCAGGGAGG - Intronic
1037264359 8:17041681-17041703 GATGTGATAAGGACCCAGGTGGG + Intronic
1037801770 8:22039928-22039950 GGCGTGAGACGACCCCAGCTGGG + Intergenic
1037993703 8:23338416-23338438 GGGGTGGGGGGGCCCAAGGTGGG + Intronic
1040301117 8:46188479-46188501 GGTGTGGGTGGGCCGCAGGGTGG - Intergenic
1040305774 8:46211038-46211060 GGTGTGGGAGGGCCACAGTGTGG + Intergenic
1040329533 8:46378791-46378813 GGCGTGGGAGGGCCGCAGGGGGG + Intergenic
1041410117 8:57544334-57544356 TCTCTGAGAGGTCCCCAGGTGGG - Intergenic
1041503107 8:58560526-58560548 GATGGGAAAGGGCACCAGGTTGG + Intronic
1041954576 8:63543263-63543285 GCTCTGAGAGGTCCCCAAGTTGG - Intergenic
1043279484 8:78445586-78445608 GGTGTCAGTTGGCCCCAAGTGGG - Intergenic
1044011572 8:87000149-87000171 GCTGAGAGAGGGACCCAGGTTGG + Intronic
1044926537 8:97214008-97214030 GGTGTTAGAGGGCCACTGGCAGG - Intergenic
1045214034 8:100129422-100129444 GTTGTGGGAGGGACCCAGGAGGG - Intronic
1045305580 8:100953329-100953351 GGTGGGAGTGGGCCACAGGCCGG + Intronic
1045578976 8:103457653-103457675 GGTGTGTGATGGGTCCAGGTAGG + Intergenic
1048973007 8:139655707-139655729 GGTGTGGGAGGAGCCCAGTTTGG - Intronic
1049056210 8:140239319-140239341 AGTGTAAGAGGGCCTCAGATGGG + Intronic
1049225795 8:141449925-141449947 GGTGTGGGAGGGGCCCAAGGCGG + Intergenic
1049340775 8:142111555-142111577 GGACTGAGAGGGCCCTGGGTGGG - Intergenic
1049407970 8:142460156-142460178 GGTGTGAGAAGGCTCCGGGGTGG + Intronic
1052410600 9:28117176-28117198 GGTGTCAGTGTGCCCCTGGTGGG + Intronic
1052429557 9:28348875-28348897 GGTGTCAGTGTGCCCCTGGTGGG - Intronic
1054451044 9:65403836-65403858 GGTGTGTGGGGGCCAAAGGTGGG - Intergenic
1055002136 9:71463549-71463571 GCTGTGGCAGAGCCCCAGGTGGG - Intergenic
1056762885 9:89427463-89427485 AGTGTGAAAGGAGCCCAGGTAGG + Intronic
1057538378 9:95940030-95940052 GGTGTCAGGGGACGCCAGGTGGG - Intronic
1059239188 9:112788555-112788577 GGTGTGTGAGGAGCCCAGGTAGG - Intronic
1061790817 9:133057974-133057996 CGTGTGACAGGGCCCAAGGCTGG + Exonic
1062323612 9:136002490-136002512 GGTCTGAGGGCGCCCCAGGGAGG + Intergenic
1062431744 9:136529481-136529503 AGTGGGAGAGGACCCGAGGTGGG - Intronic
1062451603 9:136618024-136618046 GACATGAGAGGGCCCTAGGTGGG + Intergenic
1062495431 9:136829351-136829373 GGTGTGAGACTGGCCCAGGCTGG - Intronic
1062734584 9:138128213-138128235 GGCGGGAGAGGGCAGCAGGTGGG - Intergenic
1202630086 M:9257-9279 GGGCTGAGAGGGCCCCTGTTAGG - Intergenic
1190708408 X:53048916-53048938 GGCCTGGGAGAGCCCCAGGTTGG - Intergenic
1190777661 X:53566020-53566042 GGTGTTAGTGGGCACCTGGTTGG - Intronic
1192229998 X:69257925-69257947 GGGGTGGGAGGTCCCCAGATGGG + Intergenic
1194917455 X:99723053-99723075 GGTGGCAGAGGACCCCAGTTGGG - Intergenic
1197880058 X:131157534-131157556 GGTGTCAGTGTGCCCCTGGTGGG + Intergenic
1197972915 X:132133496-132133518 GGTGTCAGTGTGCCCCTGGTGGG - Intergenic
1199208685 X:145180395-145180417 GTTGTGGGAGGGACCCAGGGGGG + Intergenic
1199629272 X:149764889-149764911 GTTGTGGGAGGGACCCAGGGGGG + Intergenic