ID: 1165448174

View in Genome Browser
Species Human (GRCh38)
Location 19:35868325-35868347
Sequence GCTATGGGCTCCGCCCGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165448174_1165448178 -8 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448178 19:35868340-35868362 CCCATAGCCGGACTCCTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1165448174_1165448192 28 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448192 19:35868376-35868398 CGGGACGCCTGGAATCTCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1165448174_1165448184 5 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448184 19:35868353-35868375 TCCTGGCTGGGCCCTTCATGGGG 0: 1
1: 0
2: 3
3: 28
4: 197
1165448174_1165448180 -7 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448180 19:35868341-35868363 CCATAGCCGGACTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 82
1165448174_1165448193 29 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448193 19:35868377-35868399 GGGACGCCTGGAATCTCGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1165448174_1165448186 8 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448186 19:35868356-35868378 TGGCTGGGCCCTTCATGGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 190
1165448174_1165448183 4 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448183 19:35868352-35868374 CTCCTGGCTGGGCCCTTCATGGG 0: 1
1: 0
2: 0
3: 23
4: 227
1165448174_1165448191 27 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448191 19:35868375-35868397 GCGGGACGCCTGGAATCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1165448174_1165448182 3 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448182 19:35868351-35868373 ACTCCTGGCTGGGCCCTTCATGG 0: 1
1: 0
2: 0
3: 27
4: 223
1165448174_1165448187 9 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448187 19:35868357-35868379 GGCTGGGCCCTTCATGGGGCGGG 0: 1
1: 0
2: 2
3: 49
4: 332
1165448174_1165448190 17 Left 1165448174 19:35868325-35868347 CCACAACGGGCGGAGCCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1165448190 19:35868365-35868387 CCTTCATGGGGCGGGACGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165448174 Original CRISPR GCTATGGGCTCCGCCCGTTG TGG (reversed) Intronic
908858004 1:68450981-68451003 GTGATGGGCTCCACCCGTTAGGG + Intergenic
913645033 1:120847615-120847637 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
914081696 1:144415937-144415959 GGTAAGGGCACCGCCCGTTTAGG + Intergenic
914099408 1:144570911-144570933 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
914176601 1:145284470-145284492 GGTAAGGGCACCGCCCGTTTAGG + Intergenic
914637063 1:149561791-149561813 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
915815758 1:158963041-158963063 ACTAGGGGCTCAGCTCGTTGAGG - Intronic
1072764861 10:98087073-98087095 GTAATGGGCTCGGCTCGTTGAGG + Intergenic
1077325048 11:1960066-1960088 GCTATGAGCACAGCCCGGTGCGG - Intronic
1082959645 11:58906217-58906239 GAGCTGGGCCCCGCCCGTTGTGG + Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1089738399 11:120564956-120564978 GCGATCGGCTCCGCCGGCTGCGG + Intronic
1202808030 11_KI270721v1_random:15245-15267 GCTATGAGCACAGCCCGGTGCGG - Intergenic
1102882016 12:116492788-116492810 GCTATGGGATCCGGGTGTTGAGG - Intergenic
1104780169 12:131414564-131414586 GCTGCAGGCTCCGCCCCTTGGGG + Intergenic
1114951663 14:27761868-27761890 GCTAGGGGCTCTGCTTGTTGGGG + Intergenic
1120214622 14:81668759-81668781 GCAAGGGGCAGCGCCCGTTGGGG + Intergenic
1125574473 15:40745920-40745942 ACTATGGGCTACTCCTGTTGCGG - Intronic
1129412895 15:75359624-75359646 GCTGTGGGCCCCGCCCGGTTTGG + Exonic
1129558473 15:76539619-76539641 ACTACAGGCTCCGCCCCTTGGGG + Intronic
1137676091 16:50304530-50304552 CCTTAGGCCTCCGCCCGTTGGGG - Exonic
1148705144 17:49623509-49623531 GCCATGGGCTCCTTCCTTTGGGG + Intronic
1164189451 19:22901412-22901434 TCTGTGGGCACCGCCCGTTAGGG + Intergenic
1164733162 19:30520920-30520942 GCTCTGGGCTCCGTCTGGTGAGG - Intronic
1165448174 19:35868325-35868347 GCTATGGGCTCCGCCCGTTGTGG - Intronic
1166140857 19:40804412-40804434 GCGATGAGCTCAGCCTGTTGAGG + Intronic
1167291870 19:48629143-48629165 GCTCTGGGCCCCCACCGTTGAGG - Exonic
927591265 2:24360187-24360209 GCTGTGCGCTCCGCACGATGGGG - Intronic
928617030 2:33051124-33051146 ACTATAGTCCCCGCCCGTTGTGG + Intronic
968881448 4:3302352-3302374 GCTTTGGGCCCTGGCCGTTGTGG + Intronic
969184651 4:5466177-5466199 GCCAGGGGCTCCTCCCGCTGTGG - Intronic
984895677 4:184537549-184537571 GCTTGGGGCTCCGCCCGGTATGG - Intergenic
1007520579 6:42449313-42449335 TCTCTGGGCTCCGCCCTTTTAGG - Intronic
1018867647 6:167758571-167758593 GCTATGGGCTCTGCCCTCTGAGG - Intergenic
1022469262 7:30672130-30672152 GCCATGGGCCCAGCCCATTGAGG + Intronic
1025182178 7:56828794-56828816 GGCAGGGGCTGCGCCCGTTGAGG + Intergenic
1025689751 7:63748201-63748223 GGCAGGGGCTGCGCCCGTTGAGG - Intergenic
1042021977 8:64378212-64378234 GCAGAGGGCTCCGCCCGTAGAGG + Intergenic
1197649853 X:129052570-129052592 GCTTTGGGCTCCGGCTTTTGGGG - Intergenic
1197941646 X:131795978-131796000 GCGAAGGGCTGCGCCCGCTGGGG + Intergenic
1199818750 X:151423921-151423943 GCAATGGGCTCCCCCAGTTCTGG + Intergenic