ID: 1165449470

View in Genome Browser
Species Human (GRCh38)
Location 19:35873836-35873858
Sequence CTGCATGTAGGCATGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165449470 Original CRISPR CTGCATGTAGGCATGGGGCC AGG (reversed) Intronic
900765249 1:4500715-4500737 CTGCATGTGGGCCTGCTGCCTGG - Intergenic
900806527 1:4771387-4771409 CTGCACGAAGGCAAGGGGCAGGG - Intronic
901034953 1:6330864-6330886 CTGAAGCCAGGCATGGGGCCTGG + Intronic
902896440 1:19483725-19483747 CTCCATCAAGGCCTGGGGCCAGG + Intronic
903858642 1:26352142-26352164 CTGCATGTGGGCCTGTGGACTGG - Intronic
904481821 1:30798696-30798718 CATCATGAAGGCATGGGACCAGG - Intergenic
905280249 1:36844446-36844468 CTGCACCCTGGCATGGGGCCTGG + Intronic
905523627 1:38619778-38619800 CTGACTGAAGGCATGGAGCCAGG - Intergenic
906493458 1:46286019-46286041 CTTCATCTCGGGATGGGGCCCGG + Exonic
907241492 1:53083716-53083738 CTGGCTGCAGGCATGGGTCCTGG + Intronic
907393028 1:54171021-54171043 CTGCATGTGAGCATGAGGGCCGG - Intronic
907968277 1:59355038-59355060 CTGCATGCAGCCTTGAGGCCAGG + Intronic
912887258 1:113488436-113488458 CTGCAAGCAGGAATGGGGCCTGG - Intronic
913210117 1:116575471-116575493 CTGCAGGTATGCAGGTGGCCTGG - Exonic
915012299 1:152698997-152699019 CTGGAGGTGGGCATGGGGCTGGG - Exonic
915016342 1:152737637-152737659 CTGGAGGTGGGCATGGGGCTGGG - Intronic
915032659 1:152896844-152896866 CTGCATGTAGGGATGAGGCAAGG - Intergenic
915065286 1:153219804-153219826 TTTCAGGTAGGCCTGGGGCCTGG + Intergenic
915922130 1:159983893-159983915 CTGCATGGCAGCAAGGGGCCAGG + Intergenic
917483311 1:175432050-175432072 CTGCCTGTGGGGAGGGGGCCAGG + Intronic
919796695 1:201325320-201325342 CTCCATGCAGCCCTGGGGCCTGG - Intronic
920207229 1:204301339-204301361 ATGCATGTTGGCATGGGACAGGG + Intronic
921339679 1:214122215-214122237 CTTCATGTAGGCTTGGGGTCTGG - Intergenic
924612682 1:245587074-245587096 CTGCAAGTAGCCATGGGGCTTGG - Intronic
924741104 1:246794583-246794605 CTGCATGGAGACATGGGGAGGGG - Intergenic
1062931003 10:1352567-1352589 CTGCATGCAGACATGAGGGCTGG - Intronic
1064841044 10:19592360-19592382 CTACATTGAGGCATAGGGCCTGG + Intronic
1066702677 10:38146683-38146705 GTGCATGTAGGCCTGGAACCTGG - Intergenic
1067230678 10:44406773-44406795 CTGGATGTAGGCATGGGCAAAGG - Intergenic
1067433670 10:46263034-46263056 CAGCCTGTAGGCCTGGGCCCTGG - Intergenic
1068899839 10:62255374-62255396 CTGACTCTAGGCATGGGGCAGGG + Intronic
1069861823 10:71476231-71476253 CTGCATGAAGGGGTGGGGACGGG - Intronic
1070588030 10:77780892-77780914 CTGCATGTGGGCATGGGCTACGG - Intergenic
1075655996 10:124161751-124161773 GTGCAGATGGGCATGGGGCCAGG + Intergenic
1075777721 10:124999037-124999059 GTGCAAGTAGGCAGAGGGCCAGG + Intronic
1075832115 10:125420131-125420153 CTGCATGTGGGTGTGGGGACAGG + Intergenic
1076160683 10:128242393-128242415 CTGCATGAAGCCGTGGGGCCCGG - Intergenic
1076166273 10:128285112-128285134 ATGCATCTGGCCATGGGGCCTGG + Intergenic
1076445750 10:130512703-130512725 CTGCAATTAGGGATGGGGCCTGG - Intergenic
1076701430 10:132275237-132275259 CTGTGAGTAGCCATGGGGCCTGG - Intronic
1077187193 11:1240671-1240693 CTGCATGAGGGACTGGGGCCTGG - Intronic
1077472792 11:2772094-2772116 CAGCATGGAGGGGTGGGGCCAGG + Intronic
1078093778 11:8283982-8284004 CTGAACGCAGGCCTGGGGCCTGG - Intergenic
1078841049 11:15075769-15075791 GTGCATGTTGTCATGAGGCCAGG + Intronic
1081216831 11:40410590-40410612 CTGCATGGAGGCCTGGGCCAGGG + Intronic
1083263825 11:61537121-61537143 CTGCAAGGGAGCATGGGGCCTGG - Intronic
1083622746 11:64057042-64057064 CTGCAGGGAGGCCTGGAGCCTGG - Intronic
1083715285 11:64571808-64571830 CTGCACTGAGGCATGGGGCGGGG + Exonic
1084127987 11:67113661-67113683 CAGCAAGGAAGCATGGGGCCAGG + Intergenic
1084320440 11:68370442-68370464 CTGCAGGCTGGCAGGGGGCCTGG + Intronic
1084795430 11:71501866-71501888 CCCCATCTAGGCATGGGGCCAGG + Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085502200 11:77034473-77034495 CTGCAGGTAAGCTGGGGGCCTGG + Exonic
1085521283 11:77140338-77140360 CTGCATGTGGGACTGGGCCCAGG + Intronic
1089487135 11:118855214-118855236 CTGCATGGAGGTCTTGGGCCGGG - Intergenic
1090009788 11:123035999-123036021 CCGCATGTGGGCATGTGTCCAGG + Intergenic
1090390308 11:126383523-126383545 CTGTATGTGGGCATGGGGGGCGG + Intronic
1091407733 12:219866-219888 CTGCGTATGGGCATGGAGCCGGG - Intergenic
1093725322 12:22500609-22500631 CTTCATGAAGGCAGGGGGACTGG + Intronic
1094303373 12:28991036-28991058 CTGCATTTTAGCATGAGGCCTGG + Intergenic
1094719999 12:33053121-33053143 CTGCCTGAGGGCAAGGGGCCAGG - Intergenic
1095695628 12:45140771-45140793 CTGAATGTTGGCTGGGGGCCAGG - Intergenic
1100724819 12:97397199-97397221 CTGAATGTCAGCATGGGGCTTGG + Intergenic
1101414742 12:104499358-104499380 CTCCATGAAGGCAGGGGACCAGG - Intronic
1104605680 12:130185770-130185792 CTGCAGGGAGGCATGGAGCCGGG - Intergenic
1107822148 13:44295852-44295874 CTGCACGTGGGCCTGGGGCTTGG - Intergenic
1108407831 13:50123204-50123226 CTGCAGGGAGGCAAGAGGCCAGG - Intronic
1109177277 13:59171951-59171973 CTGCATTTATGCAGAGGGCCAGG - Intergenic
1112475347 13:99726782-99726804 CTTCATGTATGCAGAGGGCCAGG + Intronic
1112900429 13:104351505-104351527 CAGCAAGTAGAAATGGGGCCAGG - Intergenic
1113521126 13:110941892-110941914 TTGCATGTAGGCATGGGTGGGGG + Intergenic
1113714585 13:112493879-112493901 CTGGCTATAGGAATGGGGCCTGG + Intronic
1113879418 13:113615415-113615437 GTGCAGGCAGCCATGGGGCCAGG - Intronic
1114586705 14:23821475-23821497 CTGGATGTAGGCATGGGCAAAGG - Intergenic
1115797023 14:36949568-36949590 CTTTGAGTAGGCATGGGGCCAGG - Intronic
1121301538 14:92875485-92875507 CTCCAAGTAGCCATGGGTCCAGG - Intergenic
1122393684 14:101407821-101407843 CTGCATGCAGGCATGGTGGATGG - Intergenic
1123937128 15:25199412-25199434 CTGGATGCATGCATGGGGCGGGG + Intergenic
1123939486 15:25209882-25209904 CTGGATGTATGCATGGGGAGCGG + Intergenic
1128546873 15:68574276-68574298 CAGCATGTGGGCATGCCGCCTGG + Intergenic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1128784442 15:70384424-70384446 CCGCATGGAGGTGTGGGGCCGGG - Intergenic
1129119689 15:73388481-73388503 CTTCACGTAGGCATGGGGGTGGG - Intergenic
1129463442 15:75711308-75711330 CAGCATGCAGGCATGGTGCTAGG - Intronic
1129721445 15:77880094-77880116 CAGCATGCAGGCATGGTGCTAGG + Intergenic
1132289329 15:100688509-100688531 CTGGCTGTAGGCATGGTGTCAGG + Intergenic
1132394271 15:101460367-101460389 ATGGAGGTAGGCAGGGGGCCTGG - Intronic
1132425960 15:101717512-101717534 CTACATGTGGCCATGTGGCCAGG + Intronic
1133146609 16:3791728-3791750 GTGCATGTATGCAGGGGGCAGGG + Intronic
1133750144 16:8718868-8718890 GTGCATGTAGGAATGCTGCCAGG + Intronic
1133850732 16:9500890-9500912 ATGGATGTAGGCATGGGGAGGGG + Intergenic
1137581073 16:49633860-49633882 CTGCATGTCTGGCTGGGGCCTGG - Intronic
1138727865 16:59160702-59160724 CTGCATTAAGGCCTGGGGCAAGG + Intergenic
1139531485 16:67544721-67544743 CTGCCAGGAGGCATGGGCCCTGG + Exonic
1139647334 16:68341076-68341098 CTGCATCTGGGAATGGGGACTGG + Intronic
1141579181 16:84985401-84985423 CGGCAGGTAAGAATGGGGCCGGG + Intronic
1142108726 16:88319754-88319776 CTGCAGGGAGGCCTGGGGGCCGG - Intergenic
1142411827 16:89920915-89920937 GTGCCTGTGAGCATGGGGCCAGG + Exonic
1146381771 17:32335430-32335452 CTTGATTTAGGCAAGGGGCCTGG - Exonic
1147050008 17:37787186-37787208 CTGCATGTGGGTGTGGGGGCTGG + Intergenic
1147242660 17:39100788-39100810 CTGCCTGCAGCCATGGAGCCAGG + Intronic
1147249373 17:39143967-39143989 CTGCAAGCAGCCCTGGGGCCTGG + Intronic
1152545364 17:80997690-80997712 CTGGATGTGAGCCTGGGGCCAGG - Intronic
1152735782 17:81996207-81996229 CTGCCTGTGGGCGTGGGGGCTGG + Intronic
1152736276 17:81998874-81998896 GTGCATGCAGGCAGGCGGCCAGG + Intronic
1154342459 18:13515272-13515294 CTGCCTGTAGGCATGAGGGAAGG + Intronic
1155253147 18:23970369-23970391 CTGCAGGAAGGAATGGCGCCAGG - Intergenic
1157282218 18:46353667-46353689 CTGCTGGTAGGCAGGGGGCCAGG + Intronic
1157685804 18:49641308-49641330 CTACATGTAGGCAGGTGACCAGG + Intergenic
1158527623 18:58229317-58229339 CTGCAGGTAGGCATGCTCCCGGG + Intronic
1160071565 18:75633481-75633503 CTGCAGGTAGGCAGGGGTGCGGG + Intergenic
1160565798 18:79786054-79786076 CGGCATGTAGGCCTGTGGCTGGG - Intergenic
1160768142 19:817763-817785 TTGCATGCAGGCACGAGGCCCGG + Intronic
1161160162 19:2757318-2757340 CTGCGTGAGTGCATGGGGCCGGG - Exonic
1161316252 19:3618978-3619000 CTCCATGTAGACCTGGGGGCAGG + Exonic
1161793701 19:6374920-6374942 CTCCCTGAGGGCATGGGGCCAGG + Exonic
1162457790 19:10796358-10796380 GAGCATGTAGGCCTGGGCCCAGG + Intronic
1162525068 19:11202114-11202136 CTGGATGTAGGCCTGGGCGCAGG + Exonic
1162797779 19:13095550-13095572 CTGCATGCAGGGCTGGGGGCGGG - Exonic
1163641763 19:18466131-18466153 ATGCGGGTGGGCATGGGGCCAGG + Intronic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1165363835 19:35352058-35352080 CTGCCTGGAGGCCTGGGACCCGG + Exonic
1165449470 19:35873836-35873858 CTGCATGTAGGCATGGGGCCAGG - Intronic
1168191843 19:54744266-54744288 CTGCATGAAGGCCCGCGGCCAGG + Intronic
1168194121 19:54760903-54760925 CTGCATGAAGGCCTGCGGCCAGG + Intronic
925574653 2:5348706-5348728 CAGCAGGTAGGCAGGGGGCCTGG + Intergenic
926296404 2:11572218-11572240 CTGGATGGAGGCATCAGGCCTGG + Intronic
926341628 2:11909151-11909173 CTGCAGGTGGGCTTAGGGCCAGG - Intergenic
927854076 2:26516990-26517012 CTGCCTGCAGGCATGAGGCGCGG + Intronic
933079479 2:77968733-77968755 CTGCATGCAGACATGAGGGCTGG - Intergenic
936080312 2:109428514-109428536 GTGCAGTCAGGCATGGGGCCAGG - Intronic
936384094 2:112013123-112013145 GTACATGTGGGCATGGGGCCAGG - Intronic
937869503 2:126777176-126777198 CTGCGGGTAGGCAGGCGGCCTGG + Intergenic
938165046 2:129018788-129018810 CTGCAGGCAGGAAAGGGGCCTGG + Intergenic
940860885 2:158769710-158769732 CTTCAAGTTGGCATGGGACCAGG - Intergenic
942659836 2:178252891-178252913 CTACATGTAGTCATGGCTCCTGG + Intronic
943480056 2:188405652-188405674 CTGAATGTAAGCTTGGGGCCTGG - Intronic
944581106 2:201133560-201133582 CTGCATGTAGGAGTGGGGTGGGG + Intronic
947229327 2:227869585-227869607 CTGCATGTATGCAGGGAGACTGG - Intergenic
948035619 2:234856007-234856029 CTGAATGTGTGCATGGGGTCGGG + Intergenic
948638846 2:239360438-239360460 CTGCAGGAAGGCAGGGTGCCTGG - Intronic
948989849 2:241548258-241548280 CTGCAGGTGGGCCTGGGGCTGGG - Intergenic
1169206987 20:3746080-3746102 GTGCATGCAAGCATGGGGACAGG - Intronic
1169274845 20:4226780-4226802 CTGCATGCAGACATGTTGCCTGG + Intronic
1170390092 20:15863168-15863190 GTAGATGCAGGCATGGGGCCTGG - Intronic
1171246471 20:23613951-23613973 CTCCATGTTGGCTTGGGTCCTGG + Intergenic
1171398775 20:24858158-24858180 CTGCATGTGGGCACGGGGCTGGG - Intergenic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1172507121 20:35471356-35471378 TTCCATGTAGGAATGGGGGCTGG + Intronic
1175969299 20:62675772-62675794 CTGCATGCTGGCCTGGGTCCTGG + Intronic
1176076839 20:63252503-63252525 CTGCATGGGGGTAGGGGGCCCGG - Intronic
1176150641 20:63589044-63589066 CTGCATGGGGGCCGGGGGCCAGG + Exonic
1178165295 21:29967749-29967771 GTGTGTGTAGGCATGGGGCAGGG + Intergenic
1179961042 21:44767104-44767126 CTGGGTGTTGGCCTGGGGCCTGG - Intergenic
1180049163 21:45323581-45323603 CTGCCTGCAGGCCTGGGGCCAGG + Intergenic
1180056617 21:45362259-45362281 CTGGATGCAGGTAGGGGGCCTGG - Intergenic
1181009109 22:20029834-20029856 CTGCAGGGAGGCAGGGTGCCTGG + Intronic
1181104774 22:20567703-20567725 CTGCATGTTGGAATGTGCCCTGG + Intronic
1181427251 22:22851656-22851678 CTGCATGAGGGCATGGCGCCTGG - Intronic
1181804988 22:25369395-25369417 CTGCAGGCTGGCAGGGGGCCTGG - Intronic
1182320122 22:29473318-29473340 CTGCAAGTGGGCATGGCCCCAGG - Intergenic
949894121 3:8756787-8756809 CCGGATGAAGGCATGGGGCCTGG - Intronic
952594510 3:34999964-34999986 CTTGCTGTAGTCATGGGGCCAGG + Intergenic
952619692 3:35322791-35322813 CTGCATGTATTCAGGGTGCCTGG + Intergenic
954440965 3:50521781-50521803 CTGATTGTAGGCCTGGGGCAGGG + Intergenic
960358340 3:116679948-116679970 CTTCATGGAGCCATGGAGCCAGG + Intronic
961001795 3:123379089-123379111 CTGCATGAAGTCCTGGGGACTGG + Intronic
961861214 3:129918054-129918076 CTGAAGGTAGGACTGGGGCCAGG - Intergenic
962990597 3:140573900-140573922 CTGCATGTTCTCATGGGGGCGGG - Exonic
967113160 3:186313162-186313184 CAGTTTGTAGGCAAGGGGCCTGG - Intronic
968270189 3:197397556-197397578 CTGAATGTAGGCAAGGGACTGGG + Intergenic
968651247 4:1761119-1761141 CTGCATGGTGGGAGGGGGCCCGG - Intergenic
968970777 4:3792409-3792431 CTGAATGTAGGGTTGGGGTCTGG - Intergenic
969457041 4:7306157-7306179 CTGCATGTGGGCTTGGGAGCAGG + Intronic
973034648 4:45390835-45390857 GTGCAGGTAGGCATGGACCCTGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977606660 4:98991883-98991905 CTGCATGCAGGCATGAGGCGAGG - Intergenic
978907746 4:114028271-114028293 TTGCATATAGGCATTGTGCCAGG - Intergenic
981364569 4:143887520-143887542 TTGCAAGTAGGCATGGGGTAAGG - Intronic
981375070 4:144005806-144005828 TTGCAAGTAGGCATGGGGTAAGG - Intronic
981947581 4:150366530-150366552 CTGCATGGAGGAGTGGGGGCTGG + Intronic
982046919 4:151457378-151457400 CTGCATGTAGGGAAGAGCCCTGG + Intronic
982817868 4:159908561-159908583 ATGCAGATAGCCATGGGGCCAGG - Intergenic
985378624 4:189369185-189369207 CTGCATGTTTGCATGAGGCATGG - Intergenic
986332438 5:6727318-6727340 CTGCATGCAGGCCGAGGGCCTGG + Intronic
987016692 5:13827429-13827451 CTGTGTGTAGGCATGGGACTTGG + Intronic
990080729 5:51910577-51910599 CAGTATGTAGACATAGGGCCTGG + Intergenic
995758441 5:115538267-115538289 ATTCATGTAGGCATGTGGCAAGG - Intronic
995896170 5:117013644-117013666 CTACATGTAGGCAGGTAGCCTGG - Intergenic
997338441 5:133123904-133123926 CTGCATGTATGGGTGGGGACAGG + Intergenic
1000916379 5:167087140-167087162 CAGCATCTGGGCATGGGGGCAGG - Intergenic
1001455647 5:171857991-171858013 CTGCATTTAGGAAAGGGGCACGG - Intergenic
1001709249 5:173764652-173764674 CTCCTGGTAGGCAGGGGGCCAGG - Intergenic
1001794899 5:174493696-174493718 GTGGATGTGGGCGTGGGGCCAGG + Intergenic
1004032016 6:11879882-11879904 CACCAAGTAGGTATGGGGCCAGG + Intergenic
1004160495 6:13208636-13208658 GTGCATGTAGACATGGGGTTGGG - Intronic
1006037562 6:31225422-31225444 CTGCATGTATGCATTCAGCCAGG - Intergenic
1006619038 6:35349553-35349575 CTGCATGCAGTCATGGGCCATGG + Intronic
1009957867 6:70477703-70477725 CTCAATGTTGGAATGGGGCCTGG - Intronic
1010445704 6:75946210-75946232 CCGCCTGTAGGCATTGAGCCTGG - Intronic
1012551887 6:100470462-100470484 CTGCCTGGATGCATTGGGCCAGG + Intergenic
1012948700 6:105494987-105495009 CTGCATGTTTGCTTGGGGCAGGG - Intergenic
1013289304 6:108707012-108707034 CTGTATGTGGGCAGGGGGCTTGG - Intergenic
1015202299 6:130596440-130596462 ATGTATGTATGTATGGGGCCTGG + Intergenic
1016991645 6:149933846-149933868 CTGCAGGAAGGCATGAAGCCAGG - Intergenic
1017515082 6:155149156-155149178 CTGCATGGAGGCAGGGTGGCCGG + Intronic
1019165228 6:170094107-170094129 CTGCAGAGAGGCCTGGGGCCAGG - Intergenic
1019738387 7:2661346-2661368 CGGCATTTGGGCATTGGGCCAGG - Intronic
1021309356 7:19073870-19073892 CTACATGGAGGCCTGGGGACTGG + Intronic
1022320869 7:29286434-29286456 CTGCATGTGGGGATGGGGTGGGG + Intronic
1023938816 7:44757372-44757394 CTGCAGGTATGCAGGCGGCCCGG + Exonic
1023985114 7:45089429-45089451 TTGCATGGAGGCATCGGGCTGGG - Intergenic
1031580510 7:123468558-123468580 CTGAATTTAGGCAAGGGGCCAGG - Intronic
1032679189 7:134164354-134164376 CTGCATGGTGGCTTGGGGACTGG + Intronic
1035108705 7:156462851-156462873 CTCCATGGGAGCATGGGGCCAGG + Intergenic
1035409771 7:158630122-158630144 CTACATGTGGGCATGTGTCCAGG - Intergenic
1036223649 8:6940887-6940909 CTGCTCTTAGGCCTGGGGCCTGG - Intergenic
1039475667 8:37838142-37838164 CTGGATATAGGCATGGAGGCCGG - Intronic
1046896542 8:119479463-119479485 CTGCAAGTCGGCATGGAGGCCGG - Intergenic
1047462178 8:125077223-125077245 CTGCAGGCAGGTATGTGGCCAGG + Intronic
1048983485 8:139715927-139715949 CAGCATGTAGGCCTGGCCCCAGG - Intergenic
1053054286 9:34985053-34985075 GTCCATGAAGGCATGGGTCCTGG + Intergenic
1055076443 9:72220433-72220455 TTGCATGTAGGCATGGGGTTTGG - Intronic
1056043749 9:82695369-82695391 CTGCCTGCAGGCCTGGGGTCTGG - Intergenic
1056043758 9:82695405-82695427 CTGCCTGCAGGCCTGGGGTCTGG - Intergenic
1057879905 9:98785502-98785524 GTGCAGGTAGGCATGGGGTCCGG - Intronic
1058829460 9:108802357-108802379 CTGGATGGAGCCATGGGTCCAGG - Intergenic
1059093824 9:111391056-111391078 CTGCTTTGAGGCATGGAGCCTGG - Intronic
1059331462 9:113538305-113538327 CAGCCTATAGGCATGGGGACAGG - Intronic
1060060365 9:120454256-120454278 CTGGATGTAGAAATGGGGCCAGG - Intronic
1061060150 9:128246170-128246192 CTGCATATATGCCGGGGGCCAGG - Intronic
1061324271 9:129853509-129853531 CTGCATGCAGGCATGTTCCCAGG + Intronic
1061545820 9:131303762-131303784 CTGCCTGCAGGCATGGTGCCTGG + Intronic
1061767086 9:132888267-132888289 CTGCAGGACGGCAGGGGGCCAGG - Intronic
1062418953 9:136469828-136469850 CTGCTGGGTGGCATGGGGCCCGG + Intronic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1186028134 X:5336665-5336687 CTGAATGTAGGAATGAGGCAGGG + Intergenic
1186495848 X:10012715-10012737 CTGCGTGTAGGCATGCTGCAGGG - Intergenic