ID: 1165449553

View in Genome Browser
Species Human (GRCh38)
Location 19:35874230-35874252
Sequence CTGACCAATGTTAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165449553_1165449559 30 Left 1165449553 19:35874230-35874252 CCTTTCACCTTAACATTGGTCAG 0: 1
1: 0
2: 1
3: 21
4: 103
Right 1165449559 19:35874283-35874305 TACAGTTTACATCCTCACATTGG 0: 1
1: 0
2: 0
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165449553 Original CRISPR CTGACCAATGTTAAGGTGAA AGG (reversed) Intronic
904150780 1:28437760-28437782 ATGACCAATGTGATGGTGATAGG - Intronic
906327037 1:44853122-44853144 CTGATCAATGATGCGGTGAAAGG + Intronic
907594614 1:55708000-55708022 GTGACCTTTGTTAAGGTGAAAGG - Intergenic
908687208 1:66734968-66734990 CTGAAAAATGCTAAAGTGAATGG - Intronic
908782666 1:67705785-67705807 CTGACCATTGTTAAGTTGCTTGG - Intronic
909479845 1:76119391-76119413 CTGACCAATGTCCAGTAGAATGG - Intronic
910927218 1:92409844-92409866 CTGCTCAATGTCAAGGTGACTGG + Intergenic
912173399 1:107128371-107128393 ATGACCAAGGTTAAATTGAAAGG - Intergenic
915058239 1:153157306-153157328 CTGACAAATTTATAGGTGAAAGG + Intergenic
916004428 1:160646585-160646607 CTGACCAGTCTTAGGGTGACAGG - Intronic
919391701 1:196993250-196993272 CTAATAAATGTTAAGTTGAAGGG - Intronic
919733985 1:200933253-200933275 CAGACCACTGATAAGTTGAAGGG + Intergenic
921139601 1:212294488-212294510 CTGACCAATTTAAAGAAGAATGG - Intronic
1064078592 10:12289889-12289911 CTCACCAATGTCAAGGGGACAGG + Intergenic
1064894681 10:20221536-20221558 CTGACTAGTGTTAAGATAAACGG + Intronic
1065742498 10:28809814-28809836 CTGACAAATTTTTAGCTGAAAGG - Intergenic
1066980253 10:42406569-42406591 CTGACAAATGTTATGGGGCAAGG - Intergenic
1072441210 10:95457156-95457178 CTAACAAATGTTAAAGAGAATGG + Intronic
1072877478 10:99188428-99188450 TTGACCAATTTAAAGGTGATAGG + Intronic
1073228898 10:101950070-101950092 GTGTCCAATCTTAAGGTGAAAGG - Intronic
1073961090 10:108929719-108929741 CTGCCCAATGTTGATGAGAATGG + Intergenic
1076078040 10:127553109-127553131 TTAACCAAAATTAAGGTGAATGG + Intergenic
1078319944 11:10325348-10325370 CTGACCAATATTATTTTGAAAGG + Intronic
1078675653 11:13410567-13410589 TTGAACAATGTTAAGTTTAATGG - Intronic
1081451754 11:43177600-43177622 CTGACCAACGATAAGTTGGAAGG - Intergenic
1081814057 11:45928862-45928884 CTGCCCAATGCTAAGATGAGGGG - Exonic
1082214378 11:49550055-49550077 CTGACCACTGTTACTATGAATGG - Intergenic
1083829815 11:65224511-65224533 CTGACAAATCCTAAGGGGAAGGG + Intergenic
1085973378 11:81621880-81621902 CTGAACAATGTTAGGGTTAAAGG - Intergenic
1086635213 11:89074437-89074459 CTGACCACTGTTACTATGAATGG + Intergenic
1087250192 11:95890376-95890398 CTGATCAAAGTTAGGGAGAAAGG - Intronic
1089689587 11:120178991-120179013 CTGACCAATGCCAAGGCCAAGGG + Intronic
1095815003 12:46411757-46411779 CTGACGAATGAAAAGGAGAAGGG + Intergenic
1096814098 12:54190865-54190887 CTGACCAAAAATAAGGTGAAGGG + Intergenic
1096948613 12:55439437-55439459 CAGATGAATGTTAAAGTGAATGG + Intergenic
1098802819 12:74984043-74984065 CTTACCAATTTCAAGGTCAATGG + Intergenic
1101136871 12:101752778-101752800 TTGACCAATGTGTAAGTGAAGGG - Intronic
1105582220 13:21709310-21709332 CTGACCAAAATTCAAGTGAAGGG + Intergenic
1105654007 13:22414900-22414922 CTCACCAATGTTAGGGTCAGAGG - Intergenic
1106008982 13:25799685-25799707 CAGACAAATGTTCAGGGGAAAGG - Intronic
1106914930 13:34503200-34503222 ATAGCCAATGTTAAGGTGAAGGG + Intergenic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1110739909 13:78982542-78982564 CTGATAAATGTTAAGGTGACAGG - Intergenic
1111625587 13:90781104-90781126 CTGAAAAGTGTTAAGGTGAAAGG - Intergenic
1118506330 14:66416212-66416234 CTGAACAATGAAAAGTTGAAAGG + Intergenic
1122095182 14:99365374-99365396 ATAACCAATGTTAATGTGAAAGG + Intergenic
1130351561 15:83096687-83096709 CTGAACAAAATTAAGGTAAAAGG - Intergenic
1130785606 15:87092417-87092439 CAGACCAGTGGAAAGGTGAAAGG + Intergenic
1131212127 15:90506981-90507003 CTGAACAATGATAAGATGAATGG - Intergenic
1142289799 16:89188271-89188293 CTGTCCATTGTGAAGGTGAGCGG + Exonic
1143125001 17:4636376-4636398 CTGGCCAATGTTGAGGTAACGGG - Intronic
1143403512 17:6660781-6660803 CTGGCCAATGTTGAGGTAACGGG + Intergenic
1144951537 17:18997022-18997044 CTGATGAATGTCAAGGGGAACGG - Intronic
1153125243 18:1783718-1783740 CTGTCCAGTGTTAAGATAAAGGG + Intergenic
1155273808 18:24166803-24166825 CTGACCATTGTTACCATGAAAGG - Intronic
1156040541 18:32815811-32815833 CTTAACTATGTTAAGGTGAATGG - Intergenic
1158149601 18:54353037-54353059 CTGATCATTGTTAAAGTGAGTGG + Intronic
1159360758 18:67399398-67399420 CTGACCACTGTTGAGTGGAATGG - Intergenic
1161055156 19:2187251-2187273 CTGCCCCAGGTTAATGTGAAAGG - Intronic
1162219428 19:9163640-9163662 CTGACCAATGACCAGGTGTATGG - Intergenic
1165449553 19:35874230-35874252 CTGACCAATGTTAAGGTGAAAGG - Intronic
926406831 2:12562209-12562231 CTGATCAATTTCAAGGTCAAGGG - Intergenic
931427412 2:62183830-62183852 GTGACCAAGGTTTAGCTGAAGGG - Intergenic
933048566 2:77572182-77572204 CTGACAATTTTGAAGGTGAATGG - Intronic
941658164 2:168166852-168166874 CTGAACAATGTTAAAAAGAAAGG + Intronic
942037685 2:172026723-172026745 CTGAGACATGTTAAGATGAATGG + Intronic
943546903 2:189292344-189292366 ATGGCCAATGTCAAGGTGTAAGG - Intergenic
944036536 2:195301351-195301373 CTGGCAAATGTTAAGAAGAAAGG + Intergenic
944041657 2:195362599-195362621 TTGACCAATTTAAAGGTGCAGGG - Intergenic
945542037 2:211099876-211099898 CTGGCCATTGTTAAAGTGGAGGG + Intergenic
946227509 2:218271945-218271967 TTGACCAATATTAAAGAGAAAGG + Intronic
946661928 2:222010230-222010252 CTGAACAATGATGAGGTGAGAGG + Intergenic
1168871180 20:1129923-1129945 CTGTCCATTGATAAGATGAATGG + Intronic
1170383014 20:15782623-15782645 TTGACCAATTTGAAGGTGAAAGG - Intronic
1173501358 20:43556445-43556467 CTGAGGAATGTCAAAGTGAAGGG + Intronic
1178789248 21:35683519-35683541 CTGACCAGAGTTGGGGTGAAGGG - Intronic
1179197796 21:39182586-39182608 CTGAAAAATGTAGAGGTGAAAGG + Intronic
1179530828 21:42018291-42018313 CTGAGCAATGTTATTCTGAAGGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1182030622 22:27156788-27156810 CTGATCAATTTTAAGGTGAAAGG + Intergenic
1182968256 22:34545155-34545177 CTTACCAATGTTCAGGAGAATGG - Intergenic
950859520 3:16135386-16135408 CTGGCCACTGTTAAGGGGAAGGG + Intergenic
951843573 3:27061459-27061481 AAGACCAATGTAAAGGTGGAGGG - Intergenic
953714101 3:45301293-45301315 CAGACCAATCTTAAGTTGAATGG + Intergenic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
961096069 3:124157963-124157985 CAGAGCACTGTTAAGGAGAAAGG + Intronic
963107498 3:141659739-141659761 CTGGGGAATGTTAAGGAGAAAGG - Intergenic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
971348614 4:25836118-25836140 CTTTCCAATGTTAAGGTATATGG - Intronic
971819522 4:31533335-31533357 CTGACCAAGAATAAGCTGAAAGG - Intergenic
974098481 4:57391057-57391079 CTGAAAAATGTGCAGGTGAATGG - Intergenic
974302654 4:60088364-60088386 CTGACCAATATTAAAGTAAATGG - Intergenic
976656593 4:87495606-87495628 CTGACCAACGTTAAGGCCAATGG - Intronic
983958632 4:173726379-173726401 CTGACCAAGGTTGAAATGAAGGG - Intergenic
987013597 5:13794281-13794303 CTAACCAATGTGAATTTGAATGG + Intronic
987493594 5:18614434-18614456 CTAACCAGAGTAAAGGTGAAAGG + Intergenic
988324490 5:29744564-29744586 CTGACCTATGTTAAGCTCATAGG - Intergenic
994540772 5:101093421-101093443 CTGACCCATATTTAAGTGAAGGG + Intergenic
995064500 5:107844652-107844674 TTGGCCAATGTCATGGTGAATGG - Intergenic
996769255 5:127068648-127068670 CTGACAAATGTAAAGTGGAAGGG + Intronic
998749653 5:145305625-145305647 CTGACCAATGAAAAGCTGGATGG - Intergenic
1001124272 5:169005432-169005454 CTGGCCCATGGCAAGGTGAACGG + Intronic
1011647252 6:89471656-89471678 CTGAGCAAAGTTAAGGAGAAAGG + Intronic
1011664327 6:89620286-89620308 CTGACTAATGATATGGTGAATGG + Intronic
1011798671 6:90984508-90984530 CTGACAAACATTAAGGTGAAGGG - Intergenic
1016047487 6:139495764-139495786 CTGATCAATGTTGAGGTTAAGGG + Intergenic
1016072722 6:139759852-139759874 CATAACAATCTTAAGGTGAAAGG - Intergenic
1018753290 6:166825939-166825961 CTCACAAATGTTGACGTGAAAGG - Intronic
1030644968 7:112050328-112050350 CTATCCAATGTTAAGGTCACTGG + Intronic
1033567794 7:142596457-142596479 CTGGCCAGTGTTAAGGTAACAGG - Intergenic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1039811599 8:41054078-41054100 CTGACGAATGTTTTGGTAAAAGG - Intergenic
1042206189 8:66332081-66332103 CTTTCCAGTGTTAAGATGAATGG - Intergenic
1045741295 8:105363078-105363100 TTGACCCATGTAAAGGTGAGTGG - Intronic
1048638431 8:136325540-136325562 CTGACCACTGCTATGGTGAAAGG + Intergenic
1056355493 9:85797606-85797628 CTGCCCTAGGTGAAGGTGAAGGG - Intergenic
1057436718 9:95047324-95047346 CTGAACAAAGTTTACGTGAAAGG - Intronic
1060897848 9:127229963-127229985 CTGATGAATGTAAAGGCGAAGGG + Intronic
1188060642 X:25596990-25597012 CTAACCAATGCTATGGTAAAAGG + Intergenic
1194112523 X:89853118-89853140 GTGACCAATGTTAACATCAATGG + Intergenic
1197169640 X:123417423-123417445 CGGACCAATGTTATAGTGAGTGG - Exonic
1199518662 X:148709290-148709312 CTGACCACTTTTAACTTGAATGG + Intronic
1201186224 Y:11405857-11405879 CTCACCAAGGTTGAAGTGAAAGG + Intergenic