ID: 1165451872

View in Genome Browser
Species Human (GRCh38)
Location 19:35888507-35888529
Sequence TCCCGCAGGACGGTGGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165451865_1165451872 22 Left 1165451865 19:35888462-35888484 CCACATACATTATCATGGGTTTG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1165451872 19:35888507-35888529 TCCCGCAGGACGGTGGGGACTGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165451872 Original CRISPR TCCCGCAGGACGGTGGGGAC TGG Exonic
900366944 1:2315256-2315278 GCCCGCGGCACGGTGGGGGCGGG + Intergenic
900526746 1:3133128-3133150 GCCCGAAGGACGGTGGTAACCGG + Intronic
901203988 1:7483620-7483642 TCCCTCAGGACGCTGGGCCCCGG - Intronic
901474641 1:9481126-9481148 TCCCCCAGGACAGTGTGGAAAGG - Intergenic
902674698 1:18000608-18000630 TCCCCCAGGAAGCTGGGGTCAGG + Intergenic
902837940 1:19058698-19058720 TGCTGGAGGACGGAGGGGACAGG - Intergenic
903450630 1:23451660-23451682 TGCAGCAGGACTGTGGGGGCAGG - Intronic
903783044 1:25834777-25834799 TCCCTCAGGAAGGTGGTGGCTGG - Exonic
904293125 1:29500301-29500323 CCACGCAGGAGGGTGGGGCCTGG + Intergenic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
905262953 1:36732021-36732043 TCCTGCAAGACAGTGGGGATCGG + Intergenic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
908796160 1:67833158-67833180 TCCTGCTGGAGGGCGGGGACTGG - Intronic
922731677 1:227951834-227951856 ACCCGCTGGATGGAGGGGACTGG + Intergenic
923391059 1:233515080-233515102 GCCCGCAGGACGGGGGGCTCCGG - Intergenic
1062852861 10:759206-759228 TGCCCCAGGACTGTGGGGGCTGG + Intergenic
1062855011 10:775710-775732 GCCCGCAGGAAGCTGGGGGCCGG + Intergenic
1064340986 10:14484955-14484977 TCCCGTAGGACCGTGTGGCCTGG - Intergenic
1066201147 10:33143654-33143676 TCCCTCAGGGCTGTGGGGAAGGG + Intergenic
1067945099 10:50684263-50684285 AGCCCCAGGAGGGTGGGGACGGG + Intergenic
1070866604 10:79711135-79711157 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1070880394 10:79849256-79849278 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1071633516 10:87233358-87233380 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1071646963 10:87365574-87365596 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1075441756 10:122485440-122485462 TCCTGCAGCACGCTGGGGAGAGG + Intronic
1076891172 10:133284235-133284257 GCCAGCTGGACGGTGGAGACTGG + Intronic
1077006977 11:363076-363098 TCTCTCCGGACGGTGGGGGCCGG - Intergenic
1077169988 11:1161803-1161825 TCCTGCAGGACCCTGGGGAGGGG + Intronic
1077510698 11:2960302-2960324 TCCCCCAGCAGGGTGGGGGCTGG - Intronic
1083902222 11:65649206-65649228 TGATGCAGGACGCTGGGGACTGG + Intronic
1084196172 11:67524425-67524447 TCCCGCAGGACTGGGGAGGCCGG - Intergenic
1087076303 11:94129501-94129523 TCGCCCAGGACGGAGGGGAGTGG + Intronic
1091973929 12:4810124-4810146 TCCCGGAGGCCGGCGGGGGCGGG + Exonic
1092959530 12:13582772-13582794 TCCAGCAGGAGGGTGATGACAGG - Intronic
1096867806 12:54575645-54575667 TCCTGCAGGAAGGGGAGGACTGG + Intronic
1104619580 12:130301318-130301340 TGCCGGAGGACGGTGGAGGCGGG - Intergenic
1104660765 12:130610121-130610143 TCCCCCAGAACGGGAGGGACTGG - Intronic
1104660780 12:130610164-130610186 TCCCCCAGAACGGGAGGGACCGG - Intronic
1104660794 12:130610207-130610229 TCCCCCAGAACGGGAGGGACCGG - Intronic
1105299063 13:19117101-19117123 TCACGGGGGACAGTGGGGACAGG - Intergenic
1107140274 13:36991275-36991297 TCCCGGGGGAAGGTGGGGATGGG - Intronic
1114634897 14:24181923-24181945 GCTCGCAGGACGGGAGGGACTGG - Intronic
1119796894 14:77406722-77406744 ACCAGCAGGACTGTAGGGACAGG + Exonic
1121434668 14:93911171-93911193 TCCTGCTGGATGGTGGGGAAGGG - Intergenic
1125006647 15:34824353-34824375 TCTTGCAGGAAGGTGGGCACTGG + Intergenic
1128506742 15:68278083-68278105 TCCCGCAGGAAGGAGGGGTCCGG + Exonic
1128564998 15:68695273-68695295 TCCCGGAGGAGGGTGGGCTCAGG + Intronic
1129788340 15:78323754-78323776 GCTCACAGGACAGTGGGGACAGG + Intergenic
1129803948 15:78438543-78438565 TCGCGCAGGAGGGTGGGGATCGG - Intronic
1129833426 15:78685639-78685661 TCCCCCAGGACGGGAGGGAAAGG - Intronic
1132584741 16:701191-701213 GCCCACAGGAGGGAGGGGACAGG + Intronic
1135564298 16:23499914-23499936 TCCCGCATCACGATGGGAACAGG + Intronic
1136451819 16:30357980-30358002 GCCCCCATGATGGTGGGGACAGG - Exonic
1141184943 16:81780083-81780105 TCCAGCAGGACGGTGGGGCGGGG + Intronic
1141698962 16:85633718-85633740 TCCAGCTGGACTCTGGGGACGGG + Intronic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1148450822 17:47777042-47777064 TCCCCCAGGACACTGGGGAGAGG + Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148855366 17:50576140-50576162 TCCGGCAGGACTGTGGGCAGCGG + Exonic
1150452229 17:65278713-65278735 TCCAGCAGGCCTGTGGGCACAGG + Intergenic
1152573864 17:81131781-81131803 TCCCACAGGACTGTGGGGCAGGG - Intronic
1156289456 18:35733241-35733263 TCCTGCAGGACAGTGTGGCCAGG - Intergenic
1156455861 18:37293644-37293666 TCCTGCAGGAAGGAAGGGACAGG + Intronic
1159166581 18:64710086-64710108 TCCTGGAGGATGGTGGGGATGGG + Intergenic
1160229035 18:77032521-77032543 AGCCTCAGGAGGGTGGGGACGGG + Intronic
1161566834 19:5007101-5007123 TCACGAGGGATGGTGGGGACAGG - Intronic
1161724067 19:5918401-5918423 TCAGGCAGGACGGTGGGGAGGGG - Intronic
1162057466 19:8073259-8073281 TCCCGCAGGTGGGGGGCGACAGG + Exonic
1162461199 19:10815449-10815471 TCCCGCAGTCCAGAGGGGACAGG - Intronic
1162966610 19:14159206-14159228 ACCTCCAGGACTGTGGGGACAGG + Exonic
1163608346 19:18288001-18288023 CCCCGCAGGGCGGTCGGGAGTGG + Intergenic
1164687116 19:30174150-30174172 TGCCACAGGAGAGTGGGGACTGG + Intergenic
1165451872 19:35888507-35888529 TCCCGCAGGACGGTGGGGACTGG + Exonic
1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG + Exonic
1166862110 19:45816709-45816731 TCCCTCTGGTTGGTGGGGACTGG - Intronic
1167279498 19:48558579-48558601 TCCCTAAGGAAGGTGGGGCCGGG - Intronic
1168116549 19:54224098-54224120 TCAGACAGGAGGGTGGGGACGGG + Intronic
1168119532 19:54243884-54243906 TCAGACAGGAGGGTGGGGACGGG + Intronic
1168168691 19:54572544-54572566 TCAGACAGGAGGGTGGGGACGGG - Intergenic
925082324 2:1080080-1080102 TCCCCCAGGGCGGTGGCGAGGGG + Intronic
925497078 2:4463819-4463841 TCCAGCAAGAAGGTGGGGAAGGG - Intergenic
927864072 2:26577612-26577634 ACTCACAGGACGGTGGGGAGGGG - Exonic
931432292 2:62217670-62217692 TTCCGCCGCACGCTGGGGACCGG - Intronic
935360916 2:102245657-102245679 TCCCGCTGGCCCGTGGGGAGGGG + Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
937216637 2:120317386-120317408 TCCAGCAGGAGGATGAGGACTGG - Intergenic
938066002 2:128282443-128282465 TGCCGCGGGCCGGTGGGGGCTGG - Intronic
941003674 2:160226045-160226067 TCCCGCAGGCTGGTGAGGCCTGG - Intronic
942454857 2:176130585-176130607 TCCCGGAGGGCGGCGGGGACGGG - Exonic
946195983 2:218033360-218033382 TTCCCCAGGATGGTGGGGACAGG - Intergenic
948593611 2:239066087-239066109 TCCAGCATGACGCTGGGGCCCGG - Intronic
948723918 2:239920205-239920227 TTCAGCAGGAAGGTGGGGAGAGG + Intronic
948860946 2:240752370-240752392 CCCAGCAGGACTGTGGGGAGGGG - Intronic
1172097964 20:32469825-32469847 TCCTCCAGGGAGGTGGGGACAGG + Intronic
1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG + Intronic
1178087863 21:29130722-29130744 TCCCGTGGGACGCTGGGGTCTGG + Intronic
1178707886 21:34889713-34889735 GCCCGCAGCACCGCGGGGACCGG - Intronic
1183074764 22:35419863-35419885 TCCTGCAGGACAGTGGGGAGAGG - Exonic
1183668685 22:39259513-39259535 TCCTGCTGGATGGTGGGCACAGG + Intergenic
1185330732 22:50251091-50251113 TCCCGGCCGAAGGTGGGGACAGG - Exonic
1185421221 22:50735408-50735430 TCACGGAGGGTGGTGGGGACAGG + Intergenic
954493199 3:50927262-50927284 TCCCACAGGGCAGTGGGGAGTGG + Intronic
954707373 3:52488331-52488353 TCCAGCAGCACGGTGGAGAGCGG - Exonic
955325718 3:58008322-58008344 TCCCGCGGGAGGGTCGGGACGGG + Intergenic
961458386 3:127035414-127035436 GCCCGCAGGTCGGGGGGCACAGG - Exonic
963068214 3:141280689-141280711 TCCCCCAGGACTGTGGGATCTGG + Intronic
968332492 3:197883669-197883691 ATCCCCAGGACGGTGGGCACTGG + Intronic
976651697 4:87441832-87441854 TCCTGCAGGACGGACTGGACTGG + Exonic
977399787 4:96518419-96518441 TCGCCCAGGACGGTAGGGCCGGG - Intergenic
980977075 4:139621365-139621387 TTCCCCAGGAAGATGGGGACTGG - Intergenic
984765100 4:183394291-183394313 TCCCGCTGGCCTGTGGGGAGTGG - Intergenic
985744833 5:1640588-1640610 TCCTCCAGGAAGGTGGGGAGGGG - Intergenic
985779481 5:1862686-1862708 TCCCGGAGGACTGTGAAGACAGG - Intergenic
986353646 5:6903554-6903576 TCCCTCTGGACAGTGAGGACAGG - Intergenic
988503044 5:31799313-31799335 GCCTGCAGGAAGGTGGGGATGGG + Exonic
989229736 5:39073604-39073626 CCCCACAGGACGGTGGGCAAAGG + Intronic
992452290 5:76885519-76885541 TCCCCCAGGAAAGTGGGAACGGG + Intronic
992452356 5:76885704-76885726 TCCCCCAGGAAAGTGGGAACGGG + Intronic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1002321779 5:178380789-178380811 CTCAGCAGGACGCTGGGGACAGG - Intronic
1006457899 6:34142543-34142565 CCCCGCAGCAGGGTGGGGATGGG + Intronic
1011228733 6:85136372-85136394 CCCAGCAGGAGGGAGGGGACAGG + Intergenic
1017754055 6:157514752-157514774 CCCCGCTGGGCGGTGGGGAGTGG + Intronic
1019186858 6:170225508-170225530 TCCCACAGCACAGTGGGGCCAGG - Intergenic
1019286659 7:226594-226616 TCTCGCAGGTCTGTGGGGACGGG + Intronic
1019536695 7:1533176-1533198 TCCCACAGGCCGGTGGGGTCTGG + Intronic
1023911693 7:44560969-44560991 TCCCACATCAAGGTGGGGACAGG + Intergenic
1028135574 7:87220139-87220161 TCCCGCAGGGCGGCGGGTTCAGG + Intronic
1029814044 7:103075428-103075450 TCCGGCAGGTGGGCGGGGACTGG + Intronic
1033637404 7:143225138-143225160 TCCCGCAGGGCTGTGGGGCGAGG - Intergenic
1034435559 7:151061323-151061345 TCCCCCAGGTCCTTGGGGACCGG - Intronic
1037524470 8:19711321-19711343 TCCTGCAGGAGGGTGGGGCAAGG + Intronic
1037768117 8:21784128-21784150 TGCCTCAGGAGGGAGGGGACAGG + Intronic
1037977560 8:23224523-23224545 TCCCGCAGGAGGCTGGGCCCGGG - Intronic
1039955302 8:42202734-42202756 CCACGCAGCAGGGTGGGGACGGG + Intronic
1049240543 8:141535528-141535550 TCCCCCAGGAGTGTGGGGTCAGG - Intergenic
1050216418 9:3330386-3330408 TCCCACAGTATGGTGGGCACTGG - Exonic
1050512996 9:6413803-6413825 TCCCGCCGAATGGTGGGGAGTGG + Intronic
1051049483 9:12914292-12914314 TCCCGCATAAAGGTGGGCACTGG - Intergenic
1053509807 9:38678109-38678131 TCCATGAGGAGGGTGGGGACAGG + Intergenic
1056665048 9:88574894-88574916 GCCCCCAGGATGGTGGGGACAGG - Intronic
1061800240 9:133109572-133109594 TCCCACTGTTCGGTGGGGACAGG + Intronic
1061825531 9:133256231-133256253 CCCCGCGTGACGCTGGGGACCGG - Exonic
1062561520 9:137144303-137144325 GTCCCCAGGATGGTGGGGACAGG + Intronic
1186844681 X:13518771-13518793 TCCCACAGTACGCTGGGTACAGG - Intergenic
1187199039 X:17117236-17117258 TCCCGCATGAGGCAGGGGACTGG - Intronic
1189137239 X:38562100-38562122 TCCCGCAGCCCCGTGGGGTCAGG - Intronic
1189709440 X:43794396-43794418 TCAAGCAGGAAGGTGGGGAGAGG - Intronic
1195159396 X:102156070-102156092 TGCGGCAGGAGGGTGGGGGCGGG + Intergenic
1199635022 X:149806073-149806095 TCGGGCAGGACTGTGGGGAACGG + Intergenic
1200151657 X:153954230-153954252 TCCCACAGGACCGTGGAGTCTGG - Exonic