ID: 1165458740

View in Genome Browser
Species Human (GRCh38)
Location 19:35931556-35931578
Sequence GGCGCCGCGCCCGAAAAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165458740_1165458756 26 Left 1165458740 19:35931556-35931578 CCGCCCTTTTCGGGCGCGGCGCC No data
Right 1165458756 19:35931605-35931627 CGCCGTTCCGGAGGCGCGCTAGG No data
1165458740_1165458750 14 Left 1165458740 19:35931556-35931578 CCGCCCTTTTCGGGCGCGGCGCC No data
Right 1165458750 19:35931593-35931615 CACAATCCCCCGCGCCGTTCCGG No data
1165458740_1165458751 17 Left 1165458740 19:35931556-35931578 CCGCCCTTTTCGGGCGCGGCGCC No data
Right 1165458751 19:35931596-35931618 AATCCCCCGCGCCGTTCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165458740 Original CRISPR GGCGCCGCGCCCGAAAAGGG CGG (reversed) Intergenic
No off target data available for this crispr