ID: 1165459599

View in Genome Browser
Species Human (GRCh38)
Location 19:35936677-35936699
Sequence CGGCGTCCCGGCTGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165459599_1165459611 12 Left 1165459599 19:35936677-35936699 CCAGGAAGCCAGCCGGGACGCCG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1165459611 19:35936712-35936734 CCGCGCCCTAACCTCCACCTCGG 0: 1
1: 0
2: 0
3: 7
4: 78
1165459599_1165459612 13 Left 1165459599 19:35936677-35936699 CCAGGAAGCCAGCCGGGACGCCG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1165459612 19:35936713-35936735 CGCGCCCTAACCTCCACCTCGGG 0: 1
1: 0
2: 1
3: 9
4: 239
1165459599_1165459614 15 Left 1165459599 19:35936677-35936699 CCAGGAAGCCAGCCGGGACGCCG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1165459614 19:35936715-35936737 CGCCCTAACCTCCACCTCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 562
1165459599_1165459613 14 Left 1165459599 19:35936677-35936699 CCAGGAAGCCAGCCGGGACGCCG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1165459613 19:35936714-35936736 GCGCCCTAACCTCCACCTCGGGG 0: 1
1: 0
2: 0
3: 8
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165459599 Original CRISPR CGGCGTCCCGGCTGGCTTCC TGG (reversed) Intronic
900227749 1:1540765-1540787 AGGGGTCCCGGCCGGCGTCCGGG - Intergenic
900579071 1:3399458-3399480 AGGTCTCCCGGCTGTCTTCCAGG - Intronic
900662143 1:3790133-3790155 TGGCATACCGGCTGCCTTCCGGG + Intronic
901696664 1:11012839-11012861 CGGTCTCACGGCTGACTTCCCGG - Intronic
902292488 1:15444561-15444583 GGGCTTCCCGGCTGCCTCCCTGG + Intronic
902834079 1:19035581-19035603 CAGACTCCCAGCTGGCTTCCTGG + Intergenic
904008462 1:27376200-27376222 CTGCGTCCTCCCTGGCTTCCCGG - Intergenic
904215445 1:28914938-28914960 CCGCGTCCCGGCTGGCGACTCGG - Intronic
906676399 1:47696766-47696788 CGGGGGCCAGGCTGGCTCCCAGG + Intergenic
912716867 1:111989508-111989530 CGGGGCCCGGGCTGGCTTCGCGG - Intergenic
917510471 1:175665350-175665372 CAGCTCCCCGACTGGCTTCCAGG + Intronic
918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG + Exonic
919642606 1:200060069-200060091 GGGCGCCCTGGCTGGCTTCATGG + Intronic
920560549 1:206935555-206935577 CGGCGTCCCGGCTGGTGAGCTGG + Exonic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
923199055 1:231694223-231694245 CTGCCTCCCAGCTGGCGTCCAGG - Exonic
1064015145 10:11765793-11765815 TGGCCTCCAGTCTGGCTTCCCGG + Intergenic
1070544741 10:77443232-77443254 AGTGGTCCCGGCAGGCTTCCAGG + Intronic
1072141564 10:92593211-92593233 CGGCGTCCCCGCTCTCTACCCGG - Intergenic
1072638898 10:97196271-97196293 CGGAGTGCCGGCTGGGTTCGCGG + Intronic
1074065383 10:110008325-110008347 CGTCGTCCCGCCTCTCTTCCGGG + Intronic
1074363452 10:112840125-112840147 CGTCATTCCAGCTGGCTTCCTGG - Intergenic
1076706934 10:132307461-132307483 CGGTGTCCGGGACGGCTTCCCGG - Intronic
1080207973 11:29753121-29753143 CAGCATCCCAGCTGGCTTCCCGG - Intergenic
1084502223 11:69541545-69541567 CAGAGGCCAGGCTGGCTTCCAGG - Intergenic
1084914041 11:72414366-72414388 AGGCCTCCTGGCTGGCTGCCAGG + Intronic
1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG + Intergenic
1085774068 11:79349931-79349953 CGTCCTCCGGTCTGGCTTCCTGG - Intronic
1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG + Exonic
1092820560 12:12350096-12350118 CGGCGCCCCTGCTGCCATCCAGG + Exonic
1097153180 12:56994527-56994549 TGGCTTCCCTGCTGGCTTCACGG - Exonic
1097227664 12:57488111-57488133 TGGCGTCCCGGGTTGCTTGCCGG + Exonic
1098268338 12:68746172-68746194 CGGCGTCCTAGCTGGCTTACAGG + Exonic
1104833170 12:131768707-131768729 CGGCGTCCCGGGGGGCTGCTGGG - Intronic
1113784341 13:112994636-112994658 CGGCCTCACCGCAGGCTTCCCGG - Intronic
1113936913 13:113999704-113999726 CGCTGTCCCGGCTGGGGTCCGGG + Intronic
1119777893 14:77259586-77259608 GGGCTGCCCTGCTGGCTTCCTGG - Intergenic
1124427002 15:29570826-29570848 CGGCCTCCCAGCCGGCTGCCAGG + Intergenic
1128062036 15:64741317-64741339 CGGTGTCCCCGCTGGAGTCCTGG + Intronic
1129170737 15:73805982-73806004 CGGCAACCCGGCTGGCTGCCTGG + Intergenic
1130076627 15:80695387-80695409 CGCCGGCCCGGCTGGCTGGCTGG - Exonic
1132547298 16:539286-539308 TGGCGTCCCGGCAGGCTGGCCGG - Intronic
1133164826 16:3939057-3939079 CGGCGTCCTGCCTGGGGTCCAGG - Intergenic
1133188425 16:4116271-4116293 GGGCGTCCCGGCCGGCGTCGCGG - Intergenic
1133283863 16:4681606-4681628 CGGCCTCCGGGCTGTCTCCCCGG + Exonic
1136522420 16:30805670-30805692 TGGCGTCCGGGCCGGCGTCCGGG + Intergenic
1136656730 16:31713584-31713606 CGGGGTCCCGGCTGCCGGCCCGG - Intronic
1136672937 16:31874139-31874161 CGGGGTCCCGGCTGCCGGCCTGG - Intronic
1137617309 16:49855643-49855665 CGGCGAGCGGGCTGGCTGCCGGG - Intronic
1137756401 16:50905847-50905869 CCTCCTCCCTGCTGGCTTCCTGG - Intergenic
1138229097 16:55324690-55324712 CGGGGTCCCGTCTGGCGGCCCGG + Exonic
1138550401 16:57744586-57744608 CGTAGTCCAGGCAGGCTTCCTGG - Intronic
1141631127 16:85288701-85288723 TGGGGTCCAGGCAGGCTTCCTGG + Intergenic
1141749149 16:85946709-85946731 CAGCTTCCCAGCTGGCCTCCAGG + Intergenic
1142187409 16:88701108-88701130 AGGCGCCGGGGCTGGCTTCCTGG + Intronic
1143335594 17:6169479-6169501 CGGTGTCTGGGCTGGCATCCCGG - Intergenic
1144695905 17:17303679-17303701 CGGCGTGCTGGCTGACTTCGAGG + Exonic
1146457919 17:33021572-33021594 AGGAGTCCTGCCTGGCTTCCAGG + Intronic
1146942215 17:36851176-36851198 CTGCGTCCAGGCTGTCTTCCGGG - Intergenic
1151565100 17:74893311-74893333 CGGCGTCCCGGCCGGGCTGCGGG - Intronic
1151605294 17:75131650-75131672 CGGCGTCCTGGCCGACTTCGAGG - Exonic
1160019201 18:75167337-75167359 GGGTGTCCCGGCTGGGGTCCGGG + Intergenic
1160754851 19:751736-751758 CCGAGTCCCTGCTGGCTGCCCGG - Intronic
1163033702 19:14560151-14560173 CGGGGTCCCGGCTAGCTGCTGGG - Intronic
1165255475 19:34575308-34575330 AGGTGACCCGGCTGTCTTCCTGG + Intergenic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
1168714579 19:58519437-58519459 CGGCGCCCAGGCCAGCTTCCCGG + Intronic
925037175 2:697143-697165 CGGCGTCCCGGATGGGGTCCTGG - Intergenic
930177288 2:48314466-48314488 CTGGGTTCCGGCTGGCTGCCTGG - Intergenic
932843315 2:75105940-75105962 TGGCGTCCCGGATGGGATCCTGG + Intronic
934188859 2:89767251-89767273 CGATGTCCAGGATGGCTTCCAGG + Intergenic
934307734 2:91840702-91840724 CGATGTCCAGGATGGCTTCCAGG - Intergenic
938454043 2:131446151-131446173 CGGCCTCCCGACAGGCTTCGGGG - Intergenic
940847439 2:158656896-158656918 TGGTGTCCAGGCTGGCTTCTTGG + Intronic
947729332 2:232419474-232419496 TGGCGTCCAGGTTGGCTGCCAGG + Intergenic
948055867 2:235008941-235008963 CGGGGTTCCAGCTGGCTTACAGG + Intronic
948940855 2:241195613-241195635 CTGCGTCCCGGCTGGGATGCTGG + Intronic
1175913775 20:62416353-62416375 CGGCGCCCCTGCTGCCTGCCAGG - Intronic
1176141672 20:63547644-63547666 CGGCGTCCGGGCTGGCGTTGGGG + Intergenic
1180534813 22:16387784-16387806 CGATGTCCAGGATGGCTTCCAGG - Intergenic
1181051838 22:20241623-20241645 CGGCCGCCCGGCTGGCTTGGCGG + Exonic
1181535054 22:23537482-23537504 CCGGGTCCCCGCTGGCTGCCTGG + Intergenic
1183104449 22:35606300-35606322 TGGAGTCCCTGCTGCCTTCCAGG + Intergenic
1183393782 22:37560502-37560524 GCGCGTCCCGGCTGGCAGCCCGG - Exonic
1183634432 22:39052444-39052466 CGCCATCCCTGCAGGCTTCCCGG - Intronic
1184734356 22:46389301-46389323 CGGCGTCCTGCGTGGCTGCCAGG + Exonic
950128798 3:10527772-10527794 CGGTGTCCCCGCTGGGTTTCAGG + Intronic
950796720 3:15516299-15516321 TGGTGGCCTGGCTGGCTTCCAGG + Intronic
955911504 3:63863685-63863707 TGGCCTCCCGGCCCGCTTCCGGG - Intronic
961452344 3:127008078-127008100 AGGCCTCCCAGCTGGCATCCAGG - Intronic
961518989 3:127456069-127456091 CGGCCTCCCTGCTGGGTTCACGG - Intergenic
968516921 4:1019373-1019395 GGGCCTCCTGGCTGGCTACCTGG - Intronic
968965232 4:3766193-3766215 CTGCGCCCCGGCTGGGCTCCGGG + Intergenic
970290299 4:14564216-14564238 CGCCTTCCCTGCTGGCCTCCAGG + Intergenic
972072447 4:35038492-35038514 CTGGGCCCCGGCTGGCGTCCAGG - Intergenic
975778727 4:77818766-77818788 CGCCGTCCCGGGAGGCGTCCGGG + Intronic
985518860 5:361314-361336 AGGCTTCCCGGCTGGGCTCCTGG - Intronic
991371851 5:65926621-65926643 TGGGGTGCGGGCTGGCTTCCTGG - Intronic
992226511 5:74624250-74624272 CGGAGAGCAGGCTGGCTTCCTGG + Intergenic
992769664 5:80035392-80035414 CGGCGTCCGGGCTGCCGTCGGGG - Exonic
993872403 5:93268017-93268039 CGGCCTCCACGCTGGCTGCCTGG - Intergenic
995055701 5:107756635-107756657 AGGAGTCCAGGATGGCTTCCAGG + Intergenic
998491629 5:142551863-142551885 CGGCGCCCCGGGTGGGCTCCCGG + Intergenic
1000296325 5:159916347-159916369 GGGGGACGCGGCTGGCTTCCCGG + Intergenic
1001573775 5:172748535-172748557 GGGCTGCCCGGCTGGCTGCCGGG - Intergenic
1003260741 6:4513247-4513269 TGGCCTCCCTGCTGCCTTCCTGG + Intergenic
1005897634 6:30191576-30191598 TGGGGTGCAGGCTGGCTTCCTGG + Intronic
1015251820 6:131135478-131135500 CGGCGTCCGGCCTGGCATGCGGG + Intergenic
1015701290 6:136038372-136038394 TGGCACCCCGGCCGGCTTCCCGG - Intronic
1017672208 6:156778592-156778614 CGGCGGCCCGGCGGCCGTCCCGG + Exonic
1018941073 6:168309039-168309061 CGGCGTCCGCGCTGGCTTTCTGG + Exonic
1019186659 6:170224476-170224498 TGGCCTCCCTGCTGGCTGCCTGG - Intergenic
1019558742 7:1645489-1645511 AGGTGTCCCCGCTGGCCTCCGGG + Intergenic
1019719460 7:2559441-2559463 CGGCGTCCCGGAGAGCTTCCTGG - Intronic
1019777162 7:2918638-2918660 CTGCGGCCCCGCTGGCTTCCCGG - Intronic
1021960187 7:25862801-25862823 CGGTGTCCCGCCTGTCTCCCGGG + Intergenic
1032087238 7:128890738-128890760 GGCCGTGCCGGCTGGCTCCCAGG + Intronic
1034497730 7:151432318-151432340 CGGAGTCCCGGGGGACTTCCTGG - Intronic
1034838190 7:154371908-154371930 CGACGGCCCCTCTGGCTTCCCGG - Intronic
1037815078 8:22107840-22107862 CGGAGTCCCTGCAGGCTGCCTGG - Exonic
1047406622 8:124590702-124590724 CAGCTTCCCATCTGGCTTCCAGG - Intronic
1049237342 8:141518825-141518847 CGGTGTCCCAGTTGGGTTCCTGG - Intergenic
1049510720 8:143025458-143025480 CCGCGTCCCCACTGGCTTCAAGG - Intergenic
1049646342 8:143737535-143737557 CTGCATCCAGCCTGGCTTCCTGG + Intergenic
1049778009 8:144415332-144415354 CGGCGTCCTGGCTGCCCTGCTGG - Exonic
1057182332 9:93036840-93036862 CGGAGCCCCTGCTGGCTACCTGG + Intergenic
1060828411 9:126699403-126699425 TGGGGTCCCGGCTGGATTCGGGG - Exonic
1061245525 9:129399575-129399597 CTGGGTCCCCGCTGGCTGCCTGG - Intergenic
1062261345 9:135664700-135664722 CATCTTCCTGGCTGGCTTCCAGG + Exonic
1062433784 9:136537163-136537185 GGGCGTCCGGGGTGGCTTCCTGG - Intronic
1062592569 9:137280837-137280859 AGGCGTCCAGGAGGGCTTCCGGG - Exonic
1203773380 EBV:60374-60396 CGGCGTCCCGGCACACATCCTGG + Intergenic
1195688014 X:107602794-107602816 TGGCCTCCCTGATGGCTTCCTGG + Exonic
1200065246 X:153501698-153501720 CGGGGGCCGGGCAGGCTTCCCGG - Intronic
1200110946 X:153740664-153740686 CGACGTCCAGGATGGCTTCCAGG - Exonic